Non-invasive biomarkers of liver injury in ALD and their applications

Abstract

The present invention discloses a non-invasive biomarker of ALD liver damage and its application; extraintestinal pathogenic Escherichia coli (ExPEC) is provided as a non-invasive biomarker of ALD liver damage, which is used for early identification of ALD patients and accurate assessment of their liver damage, and is of great significance for the treatment and prognosis of patients.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to non-invasive biomarkers of ALD liver damage and applications thereof. Background Art

[0002] Many studies have shown that alcohol has become one of the important socioeconomic and health risk factors. Excessive drinking can lead to serious health problems, such as alcohol-related liver disease (ALD). ALD is a multimodal disease, mainly composed of alcoholic fatty liver disease and alcoholic steatohepatitis. In the later stages of ALD, it can progress to liver fibrosis, cirrhosis, and even liver cancer. In the early stages of ALD, most patients often have no symptoms; it is not until liver decompensation occurs that patients seek medical attention due to discomfort. In the early stages of ALD, quitting alcohol can effectively improve the pathological changes of ALD. Therefore, early identification of ALD patients and accurate assessment of their liver damage are particularly important for the treatment and prognosis of patients.

[0003] 1. Epidemiology of ALD

[0004] Chronic alcohol consumption has become a global health problem. In my country, the proportion of drinkers in the population is also rising. According to the Chinese Medical Association's Primary Diagnosis and Treatment Guidelines for Alcoholic Liver Disease, the proportion of drinkers in different regions of my country is different. Alcohol abuse can lead to ALD, including alcoholic fatty liver, alcoholic steatohepatitis or alcoholic hepatitis, alcoholic cirrhosis and alcoholic liver cancer. ALD has become one of the important diseases that seriously threaten the health of the Chinese population and has brought a heavy economic burden. Effective means are urgently needed to diagnose and treat it.

[0005] 2. Diagnosis and Treatment of ALD

[0006] ALD is a complex disease that can affect the whole body. Its diagnosis often requires a comprehensive analysis of medical history, especially drinking history (according to the guidelines issued by China, drinking volume >40g / day for men, >20g / day for women, and drinking time for more than 5 years), clinical manifestations of liver disease, and laboratory and imaging examination results. It is worth noting that 90% of ALD patients may have no obvious clinical manifestations in the early stage, while 63% of ALD patients have entered the decompensated stage at the time of diagnosis. Although liver biopsy can be used as the gold standard for the diagnosis and staging of ALD, it is rarely used in clinical practice because it is an invasive examination and has a certain risk of morbidity. Therefore, it is difficult to identify early ALD patients, and the clinical misdiagnosis rate is high. In addition to liver biopsy, there are many non-invasive examinations that can be used to evaluate ALD. Some biochemical indicators, such as alanine aminotransferase (ALT) and aspartate aminotransferase (AST), are positively correlated with the degree of liver damage. AST / ALT ratio and γ-glutamyl transferase can reflect liver damage and its severity to a certain extent. In addition, liver fibrosis scanners, including FibroScan and FibroTouch, can be used to grade alcohol-related liver fibrosis and can also be used to evaluate the therapeutic effect of ALD. Conventional imaging examination methods, such as ultrasound, CT, MRI, etc., can be used as auxiliary diagnosis of ALD, and can evaluate the complications of advanced ALD, such as ascites, portal vein thrombosis and hepatocellular carcinoma, and can exclude liver function abnormalities caused by other reasons, such as biliary obstructive disease. Although these non-invasive examinations can indeed assist in the diagnosis and evaluation of ALD to a certain extent, they lack disease specificity. In addition, some existing models that can predict the prognosis of ALD also have limitations. Specifically, the indicators used in the Maddrey discriminant function are not standardized; the prediction accuracy of high-score levels of the ABIC score is low; the GAHS score is limited by steroid treatment; and the MELD score has low specificity and sensitivity.

[0007] So far, there is no recognized and approved treatment for ALD except for quitting drinking and liver transplantation for advanced patients. The current medical drugs used to treat ALD often have side effects such as severe liver and kidney damage. Liver transplantation is difficult to be widely carried out clinically due to the shortage of liver sources, high costs, and the need for long-term use of anti-rejection drugs. Therefore, it is very important to actively seek accurate and efficient treatment methods.

[0008] 3. ALD and intestinal flora

[0009] In recent years, with the deepening of understanding of intestinal flora, many studies have shown that intestinal flora plays an important role in the occurrence and development of various diseases, such as cardiovascular disease, respiratory disease, nervous system disease and digestive system disease. The concept of "gut-liver axis" has made more and more people pay attention to the role of intestinal flora in liver diseases, including ALD. In fact, a large number of studies have shown that the composition and abundance of intestinal flora in ALD patients have changed significantly, and they have also found that intestinal flora also has great potential in the diagnosis and treatment of ALD. Candida albicans, an exotoxin from intestinal Candida albicans, is associated with the severity and mortality of patients with alcoholic hepatitis; candida albicans can aggravate the pathological progression of ALD. Cytolysin from intestinal Enterococcus faecalis is also associated with the mortality rate of ALD and can aggravate the pathological progression of ALD. In addition, bacteriophages targeting intestinal Enterococcus faecalis can effectively improve the pathological damage of ALD and may become one of the treatments for ALD. In addition to Candida albicans and Enterococcus faecalis, related studies in recent years have also found that the content of Escherichia coli is increased in ALD patients or model mice through fecal sequencing analysis. Escherichia coli can be divided into commensal Escherichia coli, enteropathogenic Escherichia coli, and extraintestinal pathogenic Escherichia coli (ExPEC). Usually, ExPEC lacks pathogenicity when colonizing the intestine, but when it transfers to other organs, it can cause a variety of diseases and threaten the health of the body. ExPEC can colonize and cause disease in multiple sites outside the intestine, which can cause surgical site infection and urinary tract infection, osteomyelitis, pneumonia, meningitis, etc. The intestine and liver communicate bidirectionally through the portal vein and biliary system. Once the intestinal barrier is damaged, the microorganisms in the intestine and their related products can cross the damaged intestinal barrier, translocate to the liver and trigger a series of immune inflammatory responses. In fact, ExPEC has been shown to play an important role in the pathological progression of various liver diseases, such as non-alcoholic fatty liver disease and primary biliary cholangitis. In previous studies, we constructed an ALD mouse model and found that Escherichia coli was indeed elevated in the feces of ALD model mice, suggesting that there may be non-invasive biomarkers of ALD liver damage. Summary of the invention

[0010] The purpose of the present invention is to provide extraintestinal pathogenic Escherichia coli (ExPEC) as a non-invasive biomarker of ALD liver damage, which is used for early identification of ALD patients and accurate assessment of their liver damage, which is of great significance for the treatment and prognosis of patients.

[0011] In view of this, the scheme of the present invention is as follows:

[0012] The first aspect of the present invention provides the use of an extraintestinal pathogenic Escherichia coli detection reagent in the preparation of an ALD liver injury diagnosis kit.

[0013] Furthermore, the detection reagent is selected from primers, probes, antisense oligonucleotides, aptamers or antibodies specific to extraintestinal pathogenic Escherichia coli.

[0014] Furthermore, the detection reagent includes primers specific to extraintestinal pathogenic Escherichia coli and internal reference primers.

[0015] Furthermore, the detection reagent includes primers specific for the kpsM gene of extraintestinal pathogenic Escherichia coli and primers using Escherichia coli 16SrRNA as an internal reference gene.

[0016] Preferably, the nucleotide sequence of the kpsM gene-specific primer is shown in SEQ ID NOs: 1-2; the nucleotide sequence of the internal reference gene primer is shown in SEQ ID NOs: 3-4.

[0017] Furthermore, the diagnostic kit includes a standard control for providing an average amount of extraintestinal pathogenic Escherichia coli in a normal sample.

[0018] Preferably, the diagnostic kit diagnoses ALD liver damage by in vitro determining whether the amount of extraintestinal pathogenic Escherichia coli in a sample exceeds the average amount of a normal sample.

[0019] Preferably, the sample is derived from feces of the subject.

[0020] The second aspect of the present invention provides a system for predicting ALD liver damage using microbial markers, comprising:

[0021] Nucleic acid sample separation unit: used to separate intestinal flora nucleic acid samples from the test object;

[0022] Detection unit: used to sequence the isolated intestinal flora nucleic acid samples to obtain the sequencing results of extraintestinal pathogenic Escherichia coli;

[0023] A data processing unit is used to process the relative abundance of the extraintestinal pathogenic Escherichia coli according to the sequencing results, and obtain the relative abundance value;

[0024] The result determination unit is used to compare the relative abundance value obtained by the data processing unit with the normal value.

[0025] Furthermore, the detection unit uses an extraintestinal pathogenic Escherichia coli detection reagent, which includes a primer specific to the kpsM gene of extraintestinal pathogenic Escherichia coli and a primer using Escherichia coli 16SrRNA as an internal reference gene.

[0026] Preferably, the nucleotide sequence of the kpsM gene-specific primer is shown in SEQ ID NOs: 1-2; the nucleotide sequence of the internal reference gene primer is shown in SEQ ID NOs: 3-4.

[0027] Compared with the prior art, the beneficial effects of the present invention include but are not limited to:

[0028] The present invention provides extraintestinal pathogenic Escherichia coli (ExPEC) as a non-invasive biomarker of ALD liver damage, which is used for early identification of ALD patients and accurate assessment of their liver damage, and is of great significance for the treatment and prognosis of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0030] Figure 1 This is a graph showing the effect of alcohol on liver enzyme levels in mouse serum in Example 1.

[0031] Figure 2 This is a graph showing the β-diversity analysis results of the fecal flora of each group of mice in Example 1.

[0032] Figure 3 This is a bar graph of the Wilcoxon rank sum test at the species level of fecal flora of each group of mice in Example 1.

[0033] Figure 4 The expression results of the kpsM gene in each group of mice in Example 2 are shown.

[0034] Figure 5 This is a graph showing the effect of ExPEC on the levels of liver enzymes in the serum of ALD mice in Example 3.

[0035] Figure 6 This is a graph showing the effect of ExPEC on the expression of genes related to liver inflammation in ALD mice in Example 3.

[0036] Figure 7 This is a graph showing the effect of ExPEC on fatty degeneration and inflammation in liver tissue of ALD mice in Example 3. DETAILED DESCRIPTION

[0037] The following provides definitions of some terms used in this specification. Unless otherwise specified, all terms used herein are generally understood by those skilled in the art to which this solution belongs.

[0038] The term "sample" or "test sample" as used herein refers to any liquid material or solid material containing nucleic acid. In some embodiments, the test sample is obtained from a biological source, such as cells in culture, or a tissue sample from an animal and most preferably from a human. In a preferred embodiment, the sample is feces.

[0039] The term "amplification" used in the text represents one or more methods known in the prior art for replicating a target nucleic acid and thereby increasing the number of copies of a selected nucleic acid sequence. Amplification can be exponential or linear. The target nucleic acid can be a DNA or RNA. The sequence amplified in this way forms an "amplicon". Although the exemplary method described below involves amplification using polymerase chain reaction ("PCR"), many other methods known in the prior art for amplifying nucleic acids (e.g., isothermal method, rolling circle method, etc.) are also included in the present invention. It will be appreciated by those skilled in the art that these other methods can be used in place of the PCR method or can be used together with the PCR method.

[0040] The "primer" used in the present invention for amplification is an oligonucleotide that specifically anneals to a target nucleotide sequence or a marker nucleotide sequence. The 3' nucleotide of the primer should be identical to the target sequence or the marker sequence at the corresponding nucleotide position to achieve optimal primer extension by the polymerase.

[0041] Herein, the term "antibody" is used in the broadest sense and specifically covers, for example, monoclonal antibodies, polyclonal antibodies, antibodies with multiple epitope specificities, single-chain antibodies, multispecific antibodies and antibody fragments. Such antibodies can be chimeric, humanized, human and synthetic.

[0042] As used herein, the term "aiding diagnosis" refers to assisting in differentiating or identifying a disease, syndrome, or condition, or refers to assisting in differentiating or identifying a person who has a particular disease, syndrome, or condition.

[0043] The term "ALD model" or NIAAA model used in this article represents a standard model in this field, that is, people in this field can confirm that the model represents a real alcohol-related liver disease sample, so there is no difference between the model and the real sample, and there is no difference between the models.

[0044] In order to make the purpose, technical scheme and beneficial technical effects of the present invention clearer, the technical scheme of the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. The experimental methods in the embodiments where specific conditions are not specified are usually based on conventional conditions. It should be understood that the specific embodiments described in this specification are only for explaining the present invention and are not intended to limit the present invention.

[0045] The serotype, virulence factors, gene structure and gene expression regulation of ExPEC are complex, and its pathogenic mechanism has not been fully studied. The capsule is the main polysaccharide structure covering the surface of ExPEC, which can protect the bacteria from being eliminated by the host immune system and is therefore considered one of the pathogenic factors of ExPEC. The phylogenetic groups of Escherichia coli include group A, group B1, group B2 and group D. The dominant groups of ExPEC are group B2 and group D. The kps gene locus of the genome expressing the capsule of group B2 is a conservative structure composed of three regions. kpsM is a highly conserved gene locus in region 3 of the flail gene cluster, encoding a channel protein that spans the inner membrane in the ABC transporter. Studies have shown that knocking out the kpsM gene can significantly reduce the virulence of ExPEC strains. Therefore, kpsM can be regarded as one of the important pathogenic genes of ExPEC. In an embodiment of the present invention, the abundance of extraintestinal pathogenic Escherichia coli (ExPEC) in the feces of patients was detected by using kpsM-specific primers and Escherichia coli 16SrRNA internal reference gene primers, and it was found that the ALD model was different from the control group, which can be used to evaluate alcohol-related liver disease liver damage, that is, ExPEC can be used as a non-invasive biomarker for evaluating ALD liver damage.

[0046] Example 1 Detection of fecal flora in ALD mice

[0047] 1. Purpose of the experiment: To construct an internationally recognized mouse ALD model (i.e., NIAAA model) and analyze the differences in fecal flora between the model and control mice by sequencing, in order to determine whether the intestinal flora of ALD model mice has changed.

[0048] 2. Experimental methods: C57 mice (8 weeks old) were used, and they were adapted for one week before modeling. In the first 5 days of modeling, all mice were given Lieber-DeCarli control liquid feed, and the mice were free to eat. From the 6th to the 15th day of modeling, the mice were divided into a "control group" (ND group) and a "model group" (ALD group) according to the different liquid feeds fed. The mice in the "ALD group" were given Lieber-DeCarli alcohol liquid feed with an alcohol content of 5%, vol / vol, and the mice were free to eat; the mice in the "ND group" were given Lieber-DeCarli control liquid feed with the same caloric content as the mice in the "ALD group". On the 16th day of modeling, a large amount of alcohol (5g / Kg, 40% vol / vol) was given to the "ALD group" mice by gavage at 9 am, and the "ND group" was gavaged with an equal volume of PBS at the same time. After 9 hours of alcohol gavage, the mice were anesthetized, and the blood, liver, intestines and intestinal contents of the mice were taken for subsequent experiments.

[0049] 3. Experimental results

[0050] (1) Alcohol causes an increase in liver enzymes (alanine aminotransferase ALT, aspartate aminotransferase AST, which are positively correlated with the degree of liver damage).

[0051] Figure 1 The results of the effects of alcohol on liver enzymes in mouse serum, Figure A: ALT levels of serum alanine aminotransferase in each group of mice; Figure B: AST levels of aspartate aminotransferase in each group of mice. The difference between the two groups was analyzed using the t test. (*: p<0.05, **p<0.01, ***p<0.001). Figure 1 As can be seen, the levels of liver enzymes ALT and AST in the "ALD group" were significantly higher than those in the "ND group", which preliminarily indicated that alcohol can cause liver damage and the ALD model was successfully established.

[0052] (2) Alcohol causes intestinal flora disorders.

[0053] Figure 2-3 The results show the effect of alcohol on the intestinal flora of mice. Figure 2 The results of β-diversity analysis of fecal flora of mice in each group; Figure 3 The bar graphs are Wilcoxon rank sum test at the species level of fecal flora of mice in each group. The composition of fecal flora of mice in the "ALD group" and "ND group" was significantly different, among which Escherichia coli was significantly enriched in the ALD group.

[0054] 4. Experimental conclusion: Alcohol can change the composition and abundance of intestinal flora. In particular, the proportion of Escherichia coli in the intestine of ALD model mice increased significantly.

[0055] Example 2 ALD mouse feces ExPEC detection

[0056] 1. Experimental purpose: To further clarify whether ExPEC is elevated in the intestinal flora of ALD model mice.

[0057] 2. Experimental methods: There is currently no kit or recognized detection method for ExPEC, and kpsM is one of the key pathogenic genes of ExPEC as mentioned above. Therefore, the abundance changes of ExPEC can be indirectly explained by detecting the expression of the kpsM gene. DNA was extracted from the intestinal contents of the "ALD group" and "ND group" mice, and then qPCR was performed, using Escherichia coli 16SrRNA as the internal reference gene to analyze the expression of the kpsM gene in the feces of the two groups of mice.

[0058] kpsM:

[0059] F: GCAAGCTTTCATGACGTCAGCATTGCC (SEQ ID NO: 1);

[0060] R: GCGGTACCATGGCAAGAAGTGGATTTGAA (SEQ ID NO: 2);

[0061] 16S rRNA:

[0062] F: CGGTGAATACGTTCYCGG (SEQ ID NO: 3);

[0063] R:GGWTACCTTGTTACGACTT (SEQ ID NO: 4).

[0064] 3. Experimental results: Alcohol caused a significant increase in the abundance of intestinal ExPEC.

[0065] Figure 4 The expression level of kpsM gene in the feces of mice in each group, and the difference between the two groups was analyzed using t-test. (***p<0.001). The expression level of kpsM gene in the feces of mice in the "ALD group" was significantly higher than that in the "ND group", which indirectly indicates that the abundance of ExPEC in the feces of mice in the "ALD group" was significantly higher than that in the "ND group".

[0066] 4. Experimental conclusion: Alcohol causes a significant increase in the abundance of ExPEC in the intestine.

[0067] Example 3 Effect of ExEPC on ALD

[0068] 1. Experimental purpose: To construct an internationally recognized mouse ALD model (i.e., NIAAA model) and treat it with ExPEC to explore the effect of ExPEC on the pathological progression of ALD.

[0069] 2. Experimental methods: C57 mice (8 weeks old) were used, and they were adapted for one week before modeling. In the first 5 days of modeling, the mice were given Lieber-DeCarli control liquid feed, and the mice were free to eat. From the 6th to the 15th day of modeling, the mice were given Lieber-DeCarli alcohol liquid feed with an alcohol content of 5%, vol / vol, and the mice were free to eat. According to the different treatments of the mice, they were divided into "ALD+PBS group" (100ulPBS was gavaged to each mouse on the 6th, 9th, 12th, and 15th days of modeling) and "ALD+ExPEC group" (100ul ExPEC was gavaged to each mouse on the 6th, 9th, 12th, and 15th days of modeling, and the number of ExPEC was 10^9CFU / mouse). Among them, ExPEC was isolated from the brain of a sick pig in Hunan Province, China. The strain was ExPEC PCN033 carrying kpsM, and the isolate was donated by Huazhong Agricultural University. On the 16th day of modeling, mice were given a large amount of alcohol (5g / Kg, 40% vol / vol) by gavage at 9 am. At 12 noon, each mouse in the "ALD+ExPEC group" was gavaged with 100ul ExPEC, with the number of ExPEC being 10^9 CFU / mouse; at the same time, each mouse in the "ALD+PBS group" was gavaged with 100ul PBS. After 9 hours of alcohol gavage, the mice were anesthetized, and the blood, liver, intestines, and intestinal contents of the mice were taken for subsequent experiments.

[0070] 3. Experimental results

[0071] (1) ExPEC can significantly increase the levels of ALD liver enzymes (alanine aminotransferase ALT, aspartate aminotransferase AST, which are positively correlated with the degree of liver damage).

[0072] Figure 5 The effect of ExPEC on liver enzymes in the serum of ALD mice. Figure A: The level of serum alanine aminotransferase ALT in each group of mice; Figure B: The level of aspartate aminotransferase AST in each group of mice. The difference between the two groups was analyzed using the t test. (*: p<0.05, **p<0.01, ***p<0.001). The ALT and AST in the "ALD+ExPEC group" were significantly higher than those in the "ALD+PBS group", which shows from the biochemical level that ExPEC can significantly aggravate ALD liver damage.

[0073] (2) ExPEC can further upregulate the expression of inflammation-related genes (IL-1β, Cxcl1, Cxcl2) in ALD.

[0074] Figure 6The results of the effect of ExPEC on the expression of genes related to liver inflammation in ALD mice are shown in Figure A: expression of IL-1β in the liver; Figure B: expression of Cxcl1 in the liver; Figure C: expression of Cxcl2 in the liver. The difference between the two groups was analyzed using the t-test. (*:p<0.05,**p<0.01,***p<0.001). The levels of IL-1β, Cxcl1 and Cxcl2 in the "ALD+ExPEC group" were significantly higher than those in the "ALD+PBS group", which shows that ExPEC can aggravate liver inflammation in ALD at the transcriptome level.

[0075] (3) ExPEC can further aggravate fatty degeneration and inflammation in ALD liver tissue.

[0076] Figure 7 The effect of ExPEC on liver pathology of ALD mice (HE staining, magnified 200 times). Liver HE staining determines liver fatty degeneration and hepatitis through the distribution and composition of vacuoles of varying sizes in the cytoplasm of hepatocytes and inflammatory cells. Compared with the "ALD+PBS group", the "ALD+ExPEC group" has a significant increase in fat vacuoles and inflammatory cell infiltration, mainly lymphocytes, which shows from the histological level that ExPEC can aggravate liver fatty degeneration and inflammation in ALD.

[0077] 4. Experimental conclusion: ExPEC can aggravate ALD at multiple levels: at the biochemical level, ExPEC can significantly increase the levels of serum biochemical indicators reflecting liver damage (ALT and AST); at the transcriptional level, it can significantly upregulate the expression of liver inflammation-related genes (IL-1β, Cxcl1 and Cxcl2); at the tissue level, it can aggravate lipid deposition and inflammatory cell infiltration in the liver.

[0078] Although the present invention is disclosed as above, the protection scope of the present invention is not limited thereto. Those skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. Application of extraintestinal pathogenic Escherichia coli abundance detection reagent in the preparation of ALD liver injury diagnostic kit.

2. The use according to claim 1, characterized in that: The abundance detection reagent is selected from primers or probes specific to extraintestinal pathogenic Escherichia coli.

3. The use according to claim 1, characterized in that: The abundance detection reagent comprises primers specific to extraintestinal pathogenic Escherichia coli and internal reference primers.

4. The use according to claim 1, characterized in that: The abundance detection reagent comprises a specific primer for the kpsM gene of extraintestinal pathogenic Escherichia coli and a primer using Escherichia coli 16SrRNA as an internal reference gene.

5. The use according to claim 4, characterized in that: The nucleotide sequences of the kpsM gene-specific primers are shown in SEQ ID NOs: 1-2; the nucleotide sequences of the internal reference gene primers are shown in SEQ ID NOs: 3-4.

6. The use according to claim 1, characterized in that: The diagnostic kit includes a standard control for providing the average amount of extraintestinal pathogenic Escherichia coli in a normal sample.

7. The use according to claim 6, characterized in that: The diagnostic kit diagnoses ALD liver damage by determining in vitro whether the abundance value of extraintestinal pathogenic Escherichia coli in a sample exceeds the average amount of a normal sample.

8. The use according to claim 7, characterized in that: The sample is derived from the feces of the subject.

Images