Isolated kcPIF4 gene, kcPIF4 protein and application thereof in breeding of arabidopsis thaliana with high temperature resistance

Abstract

The present application belongs to the technical field of molecular biology breeding, and particularly relates to an isolated KcPIF4 gene, KcPIF4 protein and application of the KcPIF4 gene and the KcPIF4 protein in improving high-temperature resistance breeding of Arabidopsis thaliana. The cDNA sequence of the KcPIF4 gene is shown as SEQ ID NO. 3; and the amino acid sequence of the KcPIF4 protein is shown as SEQ ID NO. 4. The present application provides the KcPIF4 gene and the protein isolated from a desert plant Karelinia caspia, which have the effect of enhancing high-temperature resistance of Arabidopsis thaliana, and are beneficial to the Arabidopsis thaliana to present significant high-temperature resistance for a long time, and provide excellent gene resources for creating new high-temperature resistant plant varieties and germplasm improvement. Through genetic transformation, the expression of the gene in plants is promoted, which opens up a new way for solving high-temperature stress damage and improving high-temperature resistance of plants, and has wide application prospect and good social benefits.

Description

Technical Field

[0001] This invention relates to the field of molecular biology breeding technology, and in particular to a KcPIF4 gene or protein, and the application of the aforementioned KcPIF4 gene or KcPIF4 protein in improving the high-temperature resistance of Arabidopsis thaliana. Background Technology

[0002] Environmental temperature change is one of the environmental stressors that plants must face. With the increasing deterioration of the global climate and the intensification of the greenhouse effect, the frequency and severity of high temperatures are on the rise, and their duration is also significantly increasing. Excessive heat severely affects normal physiological and biochemical processes, disrupts normal molecular regulatory mechanisms, and causes irreversible damage to plant cells and tissues, macroscopically manifesting as stunted growth and development, and decreased quality and yield. High-temperature stress has become a significant adverse factor limiting agricultural production. How to enhance plants' adaptability to high-temperature environments and mitigate their impact on yield and quality is a problem that agricultural production must address and solve.

[0003] To adapt to extreme temperatures, plants have established various protective mechanisms to cope with the damage caused by heat stress. These mechanisms include readjusting their transcriptome, proteome, and metabolome to respond to changes in environmental temperature, such as altering the content of various cellular components, regulating hormone levels, and secreting osmotic regulators. In plants, many genes are induced to express under stress. These genes not only produce resistant functional proteins themselves but also participate in stress responses as signal transduction factors, thus enabling plants to actively adapt to the current environment. Therefore, studying the self-adaptation and resistance mechanisms of plants to heat stress, conducting genomic-level mining and screening of important genes for heat-resistant traits, and performing functional analysis of key regulatory genes, followed by targeted genetic manipulation of heat-resistant genes through genetic engineering breeding techniques and expression in economically valuable crops, can provide important genetic resources and technical support for breeding heat-resistant varieties. This has become an effective way to alleviate plant growth and development stagnation and yield reduction caused by abiotic stress.

[0004] Karelinia caspica is a typical desert plant of the Asteraceae family with broad-spectrum stress resistance (Flora of China, Volume 75, Science Press, September 1979, First Edition, pp. 54-55), making it an ideal material for conducting research on plant abiotic stress and screening for stress-responsive genes. However, there are currently few reports on genes related to abiotic stress in Karelinia caspica, especially those related to high-temperature stress. Summary of the Invention

[0005] To address the aforementioned technical problems in the prior art, this invention provides a KcPIF4 gene and its protein isolated from the desert plant *Arabidopsis thaliana*. Using *Arabidopsis thaliana* as an example, the role and response mechanism of this gene under high-temperature stress in *Arabidopsis thaliana* were studied. It was found that increased expression levels of the KcPIF4 gene significantly enhanced the transgenic *Arabidopsis thaliana*'s resistance to high-temperature stress, exhibiting significant high-temperature resistance over a prolonged period. Therefore, this invention further provides the application of the aforementioned KcPIF4 gene and its protein in breeding to improve the high-temperature resistance of *Arabidopsis thaliana*. The KcPIF4 gene of this invention provides an excellent gene resource for creating new heat-resistant plant varieties and improving germplasm. Promoting the expression of this gene in plants through genetic transformation can open up a new avenue for solving the damage caused by high-temperature stress and improving the heat resistance of plants. It has broad application prospects and good social benefits in agricultural production, such as the improvement of crop varieties with stress resistance. This invention is specifically achieved through the following technical solutions:

[0006] The first aspect of the present invention provides an isolated KcPIF4 gene, the cDNA sequence of which is shown in SEQ ID NO. 3.

[0007] A second aspect of the present invention provides a KcPIF4 protein, the amino acid sequence of which is shown in SEQ ID NO.4.

[0008] The third aspect of the present invention provides the application of the isolated KcPIF4 gene or KcPIF4 protein as described above in the breeding of Arabidopsis thaliana to improve its high-temperature resistance.

[0009] Furthermore, the temperature of the high temperature is not higher than 45°C.

[0010] Furthermore, the method for improving the high-temperature resistance of Arabidopsis thaliana includes the following steps:

[0011] A KcPIF4 gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcPIF4 gene expression was obtained.

[0012] Furthermore, the construction of the KcPIF4 gene overexpression vector includes the following steps: using *Pterocarya stenoptera* genomic DNA as a template, the KcPIF4 gene is amplified by PCR using the primer pair shown in SEQ ID NO.5-6, and the amplified KcPIF4 gene is ligated into the plant expression vector pK2GW7 via a Gateway reaction to obtain the KcPIF4 gene overexpression vector.

[0013] Furthermore, the Gateway reaction includes the following steps: ligating the amplified KcPIF4 gene to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TMThe KcPIF4 gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcPIF4 gene overexpression vector.

[0014] Furthermore, the PCR amplification program includes: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 59 °C annealing for 30 s, 72 °C extension for 1.5 min, 32 cycles; 72 °C extension for 10 min.

[0015] Furthermore, the method for transforming the KcPIF4 gene overexpression vector into the wild-type Arabidopsis thaliana is selected from calcium phosphate coprecipitation, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method, or Agrobacterium-mediated method.

[0016] The advantages and positive effects of this invention are as follows:

[0017] This invention cloned the KcPIF4 gene from *Arabidopsis thaliana* and investigated its role and response mechanism under high-temperature stress in *Arabidopsis thaliana*. The results showed that increased expression of the KcPIF4 gene significantly enhanced the plant's resistance to high-temperature stress. Transgenic *Arabidopsis thaliana* overexpressing KcPIF4 exhibited lower relative conductivity and malondialdehyde accumulation under high-temperature stress compared to the wild type, while showing increased activity of antioxidant-related enzymes and chlorophyll accumulation. This indicates that transgenic *Arabidopsis thaliana* overexpressing the KcPIF4 gene can more rapidly and efficiently activate the oxidative stress defense system, improving its ability to cope with high-temperature stress and exhibiting significant high-temperature resistance over a long period. The KcPIF4 gene of this invention provides an excellent gene resource for creating new heat-resistant plant varieties and improving germplasm. Promoting the expression of this gene in plants through genetic transformation opens a new avenue for addressing high-temperature stress damage and improving plant heat resistance, with broad application prospects and significant social benefits in agricultural production, such as crop stress-resistant variety improvement. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a phylogenetic tree of the KcPIF4 protein according to an embodiment of the present invention;

[0020] Figure 2 This is a map of the p35s-KcPIF4 gene overexpression vector of this invention.

[0021] Figure 3 The aboveground phenotypic changes of wild-type Arabidopsis and transgenic Arabidopsis under different time periods of high temperature stress treatment at 45 ℃ in Example 4 of the present invention are shown in Figures a and b, which represent 0 h, 3 h, 6 h and 8 h of high temperature stress treatment at 45 ℃, respectively.

[0022] Figure 4 This is a graph showing the changes in physiological and biochemical indicators of wild-type Arabidopsis and transgenic Arabidopsis under different time periods of high-temperature stress treatment at 45 ℃ in Example 4 of this invention. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0024] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0025] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "about." The term "about" has its usual meaning as indicating a value that includes inherent variations in the error of the equipment or method used to determine that value, or that includes a value close to said value, for example, within 10% of said value (or a range of values). Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. The terms "comprising," "including," "containing," "having," and similar words are non-limiting in meaning, allowing for the addition of other steps and other components that do not affect the result.

[0026] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0027] The term "gene" refers to the complete sequence of nucleotides required to produce a polypeptide chain or functional RNA. Therefore, gene expression includes transcription and the stable accumulation of coding RNA (mRNA) or functional RNA derived from the gene, and can also refer to the translation of mRNA into polypeptides or proteins.

[0028] The term "cDNA" refers to a DNA molecule that, after reverse transcription, is reverse complementary to an RNA molecule (such as mRNA) (first-strand cDNA) or a DNA molecule with the same sequence as an RNA molecule except that U is T (second-strand cDNA). cDNA has no introns and only exons.

[0029] The term "vector" refers to a self-replicating DNA molecule, often in the form of a circular double-stranded DNA molecule, used to transfer a foreign target gene into a host organism. A vector containing the target gene is called a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, granules, and minichromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, plasmids and vectors are used interchangeably.

[0030] The term "expression vector" allows a foreign target gene inserted into the vector to be expressed in a host organism. When an expression vector is introduced into a suitable host organism, the inserted target gene (e.g., the KcPIF4 gene of this invention) can be expressed.

[0031] The terms "import" or "transfer" refer to the transfer of a target gene nucleic acid molecule (such as an overexpression vector containing the KcPIF4 gene) into a host organism, resulting in stable genetic inheritance. The imported nucleic acid molecule can be in plasmid form retained in the host organism or can be integrated into the host organism's genome. A host organism containing the imported gene is referred to as a "transgenic," "recombinant," "transformed," or "engineered" organism. The introduction of expression vectors into host organisms can be performed using conventional techniques well known to those skilled in the art.

[0032] The terms "overexpression," "excessive expression," or similar terms refer to a gene expression level that exceeds the normal expression level. In a preferred embodiment, the gene expression level is at least 10%, 20%, 50%, 100% (2-fold), 200% (3-fold), 300% (4-fold), or even more times higher than the normal expression level. In this invention, overexpression or excessive expression is relative to wild-type plants.

[0033] Normally, comparing C t The value method is the most commonly used method for studying the content of gene expression products. The quantitative result is obtained by combining the target gene and the internal reference gene C. t The difference between values ​​(△C) tThis is reflected in the formula, which is a relative quantification. The method for calculating the relative expression level is Formula 2. -ΔΔ C t Calculation. Term "C" t "or "C t "C-value" refers to the number of cycles required for the fluorescence signal in each reaction tube to reach a set threshold. The C-value for each sample template... t The value of C is linearly related to the logarithm of the initial copy number of the template; the higher the initial copy number, the better the C value. t The smaller the value.

[0034] The term "high-temperature stress" refers to a high-temperature environment that is detrimental to plant growth and development, and may even inhibit plant life activities. High temperature is one of the important adverse environmental factors affecting plant growth. When the ambient temperature exceeds the temperature range that plants can adapt to and persists for a period of time, it will cause physiological damage to the plant. The most direct damage is protein denaturation, damage to biomembrane structure, and disorder of physiological and biochemical metabolism within the plant. This will inhibit plant growth and development activities or threaten its survival, and is called high-temperature damage, also known as heat injury.

[0035] Arabidopsis thaliana is currently the most commonly used plant for studying thermomorphogenesis, exhibiting optimal growth and performance at 22°C. However, temperatures above 29°C can stress Arabidopsis growth, causing structural and morphological distortions, reduced seed yield, and significant thermomorphological adjustments, specifically hypocotyl and petiole elongation, as well as stem growth and leaf drooping. Thermomorphological adaptations may alleviate high temperatures by enhancing leaf transpiration cooling.

[0036] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0037] This invention isolates and clones a phytochrome interacting factor 4 (PIF4) from wild *Arabidopsis thaliana* that is induced to express under high temperature and is associated with a high-temperature stress response, participating in *Arabidopsis thaliana* thermomorphogenesis. The cDNA sequence of PIF4 is shown in SEQ ID NO.3, with a full length of 1593 bp. Bioinformatics analysis shows that the open reading frame encodes 530 amino acids, and the protein sequence is shown in SEQ ID NO.4. PIF4 is a central molecular hub regulating plant thermomorphogenesis. The core pathway of thermomorphogenesis is dominated by PIF4 and other factors that regulate plant growth and development in response to temperature and different light conditions. In *Arabidopsis thaliana*, PIF4 is a central regulator of its environmental temperature signaling, belonging to a subfamily of the basic bHLH (Helix-loop-Helix) superfamily, and is regulated at multiple levels, including transcriptional level, post-translational modification level, DNA binding capacity, transcriptional activity, and protein stability. High-temperature induced adaptation is mediated by PIF4; when the temperature rises instantaneously, the expression level of PIF4 increases. PIF4 can bind to its own promoter at high temperatures and induce its expression, thereby generating an autoregulating feedforward loop.

[0038] This invention involves overexpressing the KcPIF4 gene in the model plant Arabidopsis thaliana. Subsequently, transgenic Arabidopsis plants overexpressing the KcPIF4 gene and wild-type Arabidopsis plants were subjected to 45°C high-temperature stress treatment. Results showed that both wild-type and transgenic plants adapted to the high-temperature environment to some extent through thermomorphogenesis, but significant phenotypic differences existed between them. After 8 hours of high-temperature treatment, wild-type plants exhibited significant wilting, curling, water loss, and yellowing of leaves. The leaf damage in the overexpressing plants was significantly less severe than in the wild-type plants, which is beneficial for improving their high-temperature resistance. Survival rate under high temperature stress was assessed. Further physiological and biochemical indicators, including the activity of antioxidant-related enzymes, malondialdehyde (MDA) content, chlorophyll content, and relative conductivity, were measured. Results showed that overexpression of KcPIF4 reduced the relative conductivity and MDA accumulation in transgenic plants under high temperature stress, enhanced the activities of SOD, CAT, and POD, and increased chlorophyll accumulation. This indicates that transgenic Arabidopsis overexpressing the KcPIF4 gene can more rapidly and efficiently activate the oxidative stress defense system of Arabidopsis, improving its ability to cope with high temperature stress and its tolerance to prolonged high-temperature environments. This invention, through the isolation and functional analysis of the KcPIF4 gene, establishes the role and regulatory mechanism of the KcPIF4 gene and its protein in plant resistance to high temperature stress.

[0039] The KcPIF4 gene of the present invention has the ability to improve the heat resistance of plants. By overexpressing this gene, it can also be used to cultivate heat-resistant varieties of plants including cotton, rapeseed, rice, wheat, soybean, and corn.

[0040] Based on the above findings, an embodiment of the present invention provides an isolated KcPIF4 gene, the cDNA sequence of which is shown in SEQ ID NO.3.

[0041] Another embodiment of the present invention provides a KcPIF4 protein, the amino acid sequence of which is shown in SEQ ID NO.4.

[0042] Another embodiment of the present invention provides the application of the isolated KcPIF4 gene or KcPIF4 protein as described above in the breeding of Arabidopsis thaliana to improve high temperature resistance.

[0043] The KcPIF4 gene provided by this invention is closely related to the thermomorphogenesis and heat response performance of Arabidopsis thaliana under high-temperature stress at the protein level. The gene was cloned in vitro, and an overexpression vector of the KcPIF4 gene was constructed. Agrobacterium-mediated transformation of Arabidopsis thaliana revealed that increased gene expression significantly enhanced the heat stress resistance of Arabidopsis thaliana, exhibiting remarkable high-temperature resistance. This provides an excellent gene resource for creating new heat-resistant plant varieties and improving germplasm. Using this gene in genetic engineering breeding, promoting its expression in plants through genetic transformation lays a theoretical and practical foundation for addressing heat stress damage and improving plant heat resistance. It has broad application prospects and significant social benefits in agricultural production, such as improving crop varieties with stress resistance.

[0044] Optionally, the high temperature is not higher than 45 ℃ (including 45 ℃). Arabidopsis thaliana prefers a humid environment, and its suitable growth temperature is 21-25 ℃, with the optimal growth temperature being 22 ℃. Temperatures exceeding 29 ℃ will put pressure on the growth and development of Arabidopsis thaliana, causing thermomorphological adjustments. Therefore, for Arabidopsis thaliana, the temperature for high-temperature stress can be 29-45 ℃.

[0045] Optionally, the above-described method for improving the high-temperature resistance of Arabidopsis thaliana includes the following steps:

[0046] A KcPIF4 gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcPIF4 gene expression was obtained.

[0047] The original expression vectors used to construct overexpression vectors are any conventional expression vectors in this field, as long as they can contain the KcPIF4 gene and initiate the transcription and translation processes of that gene to achieve gene expression. Typical vectors include plasmids, viral vectors, bacteriophages, kinases, and mini-chromosomes. Plasmids are the most common vector form.

[0048] When the KcPIF4 gene of this invention is constructed into an expression vector, a promoter can be added upstream of its transcription initiation nucleotide. This promoter can be a strong promoter, a specific promoter, or an inducible promoter to ensure transcription of the KcPIF4 gene. Furthermore, enhancers can also be used. These enhancer regions can be located upstream of the ATG start codon or adjacent start codons, but must be within the same reading frame as the coding sequence to ensure translation of the KcPIF4 gene.

[0049] In a typical implementation, the expression vector is selected as a plant expression vector; for example, the pK2GW7 vector can be selected.

[0050] Specifically, the construction of the KcPIF4 gene overexpression vector includes the following steps: using the genomic DNA of *Cypripedium lancifolium* as a template, the KcPIF4 gene is amplified by PCR using the primer pair shown in SEQ ID NO.5-6, and the amplified KcPIF4 gene is ligated into the plant expression vector pK2GW7 via the Gateway reaction to obtain the KcPIF4 gene overexpression vector.

[0051] More specifically, the Gateway reaction includes the following steps: ligating the amplified KcPIF4 gene to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TM The KcPIF4 gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcPIF4 gene overexpression vector.

[0052] Optionally, the PCR amplification program includes: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 59 °C annealing for 30 s, 72 °C extension for 1.5 min, 32 cycles; 72 °C extension for 10 min.

[0053] Transformation of host cells using expression vectors can be performed using conventional techniques well known to those skilled in the art. Overexpression vectors carrying the KcPIF4 gene can be introduced into Arabidopsis cells or tissues using the following DNA transfection methods: calcium phosphate co-precipitation, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method, or Agrobacterium-mediated transformation, etc. The transformed cells or tissues can then be cultured into plants. For specific procedures, please refer to: Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0054] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0055] Example

[0056] 1. Discovery and cloning of the KcPIF4 gene in the Chinese tallow tree (Pterocarya stenoptera).

[0057] In this embodiment, degenerate primers were designed using the PIF4 gene from other cloned species as a template to clone a DNA sequence with high homology to the Arabidopsis thaliana AtPIF4 gene from *Pterocarya stenoptera* cDNA, named KcPIF4. This gene participates in the thermomorphogenesis of *Pterocarya stenoptera* at the protein level, is related to the high-temperature stress response of *Pterocarya stenoptera*, and plays an important role in its heat tolerance. The *Pterocarya stenoptera* germplasm resources used were obtained from the Key Laboratory of Biological Resources Conservation and Utilization of the Xinjiang Production and Construction Corps in the Tarim Basin, and were collected in Alar City, Xinjiang Uygur Autonomous Region, China in October 2019. Specific procedures are as follows:

[0058] 1) Total RNA extraction and genomic DNA acquisition from *Hylocereus undatus* leaves: Total RNA extraction kit of RNAprep Pure polysaccharide and polyphenol plant (purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number DP441) was used to reverse transcribe the RNA into cDNA using EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (purchased from Quanshijin Company (Beijing), catalog number AE311-03). The reaction conditions were: 45 ℃ for 30 min, followed by 85 ℃ for 5 s.

[0059] 2) Obtaining the full-length sequence of the KcPIF4 gene from *Pterocarya stenoptera*: Specific amplification primers KcPIF4-F and KcPIF4-R were designed based on the transcriptome sequence. Using *Pterocarya stenoptera* cDNA as a template, the open reading frame (ORF) of the KcPIF4 gene was amplified using PCR technology. PCR conditions were: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 s, 59 ℃ annealing for 30 s, 72 ℃ extension for 1.5 min, 30 cycles; 72 ℃ extension for 10 min. The amplified PCR product was ligated into the pMD-19T vector (purchased from TAKARA, catalog number 3271), positive clones were screened and sequenced, and the successfully constructed plasmid was named pMD-19T-KcPIF4. The primer sequences (5′-3′) are shown below:

[0060] KcPIF4-F: ATGATGAATCATATTGTTCCTTATTTTGAGACGGAC (see SEQ ID NO. 1);

[0061] KcPIF4-R: TCAGCAACCAGTTTGGTGATTATCAGG (see SEQ ID NO. 2).

[0062] The full-length cDNA of the KcPIF4 gene is 1593 bp. Analysis of the obtained cDNA using the online ORF Finder tool revealed that it contains a complete ORF encoding a 530-amino acid protein sequence. Specifically, the cDNA sequence of the KcPIF4 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein is shown in SEQ ID NO.4.

[0063] The sequence of the KcPIF4 gene is shown below:

[0064]

[0065] The sequence of the KcPIF4 protein is shown below:

[0066] (See SEQ ID NO.4).

[0067] Sequence analysis using MEGA 11.0 software and the NCBI online alignment tool BlastX showed that the KcPIF4 protein has a 71.48% identity with the burdock (Arctium lappa) PIF4 protein (NCBI accession number: KAI3667966.1), and is most closely related to Artemisia annua (NCBI accession number: PWA82746.1) and Erigeron tigrinum (NCBI accession number: XP_043611470.1). Figure 1 A phylogenetic tree of the KcPIF4 protein is shown.

[0068] 2. Construction of KcPIF4 gene overexpression vector

[0069] Based on the obtained KcPIF4 gene cDNA sequence, primers KcPIF4BP-F and KcPIF4BP-R were designed, with BP adapters for the Gateway reaction added to both ends of the primers. The primer sequences (5'-3') are shown below:

[0070] KcPIF4-BP-F: ggggacaagtttgtacaaaaaagcaggcttcatgatgaatcatattgttccttattttgagacggac (see SEQ ID NO. 5);

[0071] KcPIF4-BP-R:ggggaccactttgtacaagaaagctgggtctcagcaaccagtttggtgattatcagg (see SEQ ID NO. 6).

[0072] PCR amplification was performed using pMD-19T-KcPIF4 plasmid as a template. The PCR reaction conditions were as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 59 °C annealing for 30 s, 72 °C extension for 1.5 min, 32 cycles; 72 °C extension for 10 min. The PCR product containing the complete ORF was obtained after PCR amplification.

[0073] The PCR product of the KcPIF4 gene was ligated to pDONR via a BP reaction. TM 221 vector (BP enzyme and pDONR) TM The pONDR221 vector was purchased from Invitrogen, Inc. (catalog number 11791-100). The process included: mixing the PCR product with the pONDR221 plasmid vector, adding Gateway™ BP Clonase™ enzyme mixture for BP reaction, ligating at 25°C for 1 h, adding 1 μL of proteinase K to terminate the ligation, incubating at 37°C for 10 min, and then transforming the cells into E. coli DH-5α competent cells using the heat shock method. Activated single colonies were picked, and colony PCR was performed using KcPIF4 specific primers under the same PCR conditions. Positive clones were selected to extract the plasmid, and the successfully constructed BP plasmid was named pONDR221-KcPIF4.

[0074] The KcHMR gene on the pONDR221-KcPIF4 plasmid was then ligated into the plant expression vector pK2GW7.0 (a gift from Huazhong Agricultural University; the LR enzyme was purchased from Invitrogen, USA, catalog number 11791-100) using an LR reaction. The procedure included: mixing the BP plasmid obtained in the previous step with the pK2GW7 plasmid, adding Gateway™ LR Clonase™ enzyme mixture, ligating at 25°C for 1 h, then adding 1 μL of proteinase K to terminate the ligation, incubating at 37°C for 10 min, and then transforming into E. coli DH5α using the heat shock method. Activated single colonies were picked, and colony PCR was performed using KcPIF4-specific primers under the same conditions. Positive clones were selected for plasmid extraction. The positive clones were the obtained overexpression vector for transformation, named p35s-KcPIF4. The vector map of p35s-KcPIF4 is shown below. Figure 2 .

[0075] The constructed p35s-KcPIF4 vector was transformed into Agrobacterium strain GV3101. The transformation method is described in the literature "Hellens R P , Mullineaux P , Klee H .A guide to Agrobacterium binary Ti vectors[J].Trends in Plant Science, 2000, 5(10):446-451.". Single colonies were picked and inoculated into LB liquid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin. The medium was cultured in a shaker at 150 rpm and 26 ℃ for 48 h. The bacterial culture was added to a 1.5 mL centrifuge tube at a volume ratio of 1:1 and mixed well. The medium was stored at -80 ℃ and then transformed into Arabidopsis thaliana using the Agrobacterium-mediated transformation method.

[0076] 3. Genetic transformation of the KcPIF4 gene and screening and identification of transgenic Arabidopsis thaliana overexpressing the KcPIF4 gene.

[0077] 1) Preparation of Arabidopsis thaliana: The test material was wild-type Arabidopsis thaliana L. Columbiaecotype. After vernalization treatment, wild-type Arabidopsis seeds were sown in nutrient soil (purchased from Pinsch & Lomb peat moss in Denmark) and placed in an artificial culture chamber. They were cultured under 16-hour light and 22±2 ℃ conditions until the Arabidopsis had approximately 4 leaves. Afterward, seedlings were thinned to control the growth density. Transformation was carried out when the Arabidopsis began to flower after about 6 weeks of growth. The Arabidopsis was thoroughly watered the day before transformation.

[0078] 2) Activation of Agrobacterium: Glycerol tubes containing the target gene of strain GV3101 (purchased from Tiangen Biotech (Beijing) Co., Ltd., catalog number AE1001) were thawed on ice after being removed from an ultra-low temperature freezer. The tubes were then streaked onto LB solid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin and incubated in the dark at 28 ℃ for 36-48 h. Once clear single colonies appeared on the plates, these colonies were picked and incubated overnight at 28 ℃ and 100 rpm in LB liquid medium containing 25 mg / L rifampicin and 50 mg / L kanamycin until OD (Organic Oxygen Species) reached its OD value. 600 When the concentration is 0.8-1.0, it can be used for transformation. First, transfer the bacterial culture to a centrifuge tube and centrifuge at 5000 rpm for 5 min, then discard the supernatant. Add 100 mL of 5% (w / v) sucrose solution to resuspend Agrobacterium GV3101 and incubate at 28 ℃ in a shaker for 1-2 h. Add 0.02% (v / v) Silwet L-77 surfactant and mix thoroughly by shaking.

[0079] 3) Agrobacterium-mediated inflorescence transformation of Arabidopsis thaliana and screening of transgenic Arabidopsis thaliana: The method of Agrobacterium-mediated floral dip transformation of Arabidopsis thaliana is referenced in "Xiuren Z, Rossana H, Shih-Shun L, et al.Agrobacterium-mediated transformation of Arabidopsis thaliana using thefloral dip method[J]. Nature Protocol, 2006, 2(1):1-6.). The specific steps are as follows: (1) Immerse the Arabidopsis thaliana floral parts in Agrobacterium suspension and gently stir for about 30 seconds. Use a paper towel to absorb the excess bacterial solution and wrap the Arabidopsis thaliana plant in a black plastic bag for moisturizing and light protection for 24 hours; (2) After 24 hours, gradually uncover the plastic bag to allow ventilation and culture normally; (3) Repeat the above operation (1) after one week; (4) Stop watering and harvest the seeds when the seeds are mature, i.e., T1 generation seeds; (5) Disinfect the harvested seeds: first soak them in 70% (V / V) ethanol for 1 hour. During the above treatment, the seeds should be suspended from time to time; then wash four times with sterile water; (6) The treated seeds are evenly spread on the surface of solid MS medium containing 100 mg / L kanamycin with 0.1% (W / V) agar aqueous solution; (7) Vernalize at 4 ℃ for 3 days, and after being cultured in the culture room for 10 days, a total of 35 plants with kanamycin resistance are selected; (8) The 35 transgenic T1 generation Arabidopsis plants are transplanted into the soil for culture, and the seeds are collected by individual plants after maturity, that is, T2 generation seeds; (9) The collected T2 generation seeds are repeated once according to the operation steps (5)-(6); (10) Vernalize at 4 ℃ for 3 days, and then culture normally for 10 days. After d, the segregation ratio of kanamycin-resistant plants to non-resistant plants was calculated and statistical analysis was performed; (11) The line with a segregation ratio of resistant to non-resistant plants of 3:1 was considered a single-copy line, transplanted into soil culture, and seeds were collected as single plants after maturity, i.e. T3 generation seeds.

[0080] Pure line detection of transgenic Arabidopsis plants: The collected T3 generation seeds were operated once using the above steps (5)-(6); then vernalized at 4 ℃ for 3 days, and then cultured in the culture room for 10 days. After that, the transgenic plants were checked to see if resistance segregation occurred on solid MS medium containing 100 mg / L kanamycin. The lines that did not show resistance segregation were transgenic pure line T4 generation seeds, which were used for the next step of phenotypic analysis and functional identification.

[0081] 4. Analysis of the high-temperature resistance of transgenic Arabidopsis thaliana

[0082] 4.1 Phenotypic analysis of KcPIF4 overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana seedlings under high temperature treatment

[0083] The expression of the target gene was detected by PCR amplification of the obtained transgenic Arabidopsis thaliana. After high-temperature treatment, three strains (OE1 and OE2) with significant phenotypic differences from wild-type Arabidopsis thaliana were selected for physiological testing. The three transgenic Arabidopsis thaliana strains (OE1, OE2 and OE3) and wild-type Arabidopsis thaliana (WT) were sown in Arabidopsis thaliana-specific nutrient soil (purchased from Top peat moss from Pinsch, Denmark) and placed in an artificial climate culture chamber. They were cultured under conditions of 16 hours of light and 22±2 ℃. After 4 weeks of growth, the Arabidopsis thaliana was treated with a high temperature of 45 ℃ for 8 h.

[0084] Figure 3 The aboveground phenotypic changes of wild-type Arabidopsis and transgenic Arabidopsis (OE1-3) under different high-temperature treatment times are shown in Figures a and b, representing 0 h, 3 h, 6 h, and 8 h of treatment at 45 ℃. It can be seen that under 45 ℃ high-temperature stress, the leaves of wild-type plants are generally smaller than those of transgenic plants. At 3 h of high-temperature treatment, some young leaves of both wild-type and KcPIF4-overexpressing lines showed curling. At 6 h of treatment, the leaves were clearly upright, and wild-type leaves began to yellow. At 8 h of treatment, the yellowing of wild-type leaves was obvious, and the overexpressing lines OE1 and OE3 also showed varying degrees of yellowing. OE1 leaves, in addition to remaining upright, only showed yellowing at some leaf edges, while OE2 leaves showed almost no yellowing. Overall, overexpression of the KcPIF4 gene in Arabidopsis enhances the high-temperature adaptability of transgenic Arabidopsis. Subsequent related physiological and biochemical indicators were obtained using OE1 and OE2 lines as materials.

[0085] 4.2 Analysis of physiological and biochemical indicators of KcPIF4 overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana seedlings under high temperature treatment

[0086] Transgenic and wild-type Arabidopsis plants with similar growth were subjected to a 45 °C high-temperature treatment, with three replicates for each treatment. Samples were taken at 0 min, 5 min, 30 min, 120 min, and 240 min of the 45 °C high-temperature treatment to determine the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), malondialdehyde (MDA), chlorophyll content, and relative conductivity.

[0087] 1) Determination of antioxidant indicators: The determination methods for SOD, POD, CAT and MDA shall be performed in accordance with the instructions of the Solarbio SOD (Catalog No. BC0175), POD (Catalog No.: BC0095), CAT (Catalog No.: BC0205) and MDA (Catalog No.: BC0025) test kits.

[0088] 2) Chlorophyll determination: Weigh 0.1g of young, green leaves, cut them into small pieces, and place them in 10 mL of 95% ethanol solution. Keep them in the dark until the leaves turn white and harden. Using the 95% ethanol solution as a control, measure the absorbance at 470 nm, 649 nm, and 665 nm using a UV spectrophotometer. Calculate the chlorophyll content using the relevant formula.

[0089] Chlorophyll a (Chl a) = (13.95 × A) 665 -6.88×A 649 ) × V ÷ W;

[0090] Chlorophyll b (Chl b) = (24.96 × A) 649 -7.32×A 665 ) × V ÷ W;

[0091] Carotenoids (Car) = [(1000 × A)] 470 -2.05×Chl a-114.8×Chl b) / 248]×V÷W;

[0092] Total chlorophyll content = Chl a + Chl b;

[0093] In the above formula, V represents the volume of 95% ethanol (unit: L); W represents the fresh weight of the leaf (unit: g); and A represents the absorbance value, with the numerical value indicating the absorbance value at the corresponding wavelength.

[0094] 3) Measurement of relative conductivity: Take 1 g of the leaf at each time point, put it into 10 mL of distilled water and let it stand for 12 h to measure the conductivity R1. After boiling for 30 min, cooling and shaking, measure the conductivity R2. Calculate the relative conductivity = (R1 / R2) × 100.

[0095] Under high-temperature stress, harmful free radicals in plants increase. Superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) act as protective enzymes that can scavenge reactive oxygen species in plants, thereby improving stress resistance. Furthermore, as temperature rises, the stability of plant cell membranes is disrupted. Changes in malondialdehyde (MDA) and relative conductivity can indicate the extent of cell membrane damage; the greater the damage, the higher the values. Chlorophyll a, chlorophyll b, and carotenoids decompose at high temperatures. Carotenoids, in particular, can scavenge reactive oxygen species in plants and can be used to assess plant stress resistance.

[0096] Figure 4The changes in physiological and biochemical parameters of wild-type Arabidopsis and transgenic Arabidopsis overexpressing KcPIF4 at different times under 45 °C high-temperature stress are shown. From left to right and top to bottom, the parameters are CAT activity, SOD activity, POD activity, MDA content, chlorophyll a content, chlorophyll b content, carotenoid content, and relative conductivity. The figure shows that the CAT activity of the KcPIF4 overexpressing line initially increased and then decreased, reaching a maximum at 30 min, followed by a decrease, but the CAT activity at 120 min and 240 min was still higher than that of the wild type. The SOD activity of the KcPIF4 overexpressing line increased with increasing treatment time, with the largest increase at 240 min, significantly higher than that of the wild type. The POD activity of wild-type Arabidopsis was higher than that of the KcPIF4 overexpressing line in both untreated and 5 min of high-temperature treatment, but it began to fall below that of the overexpressing line after 30 min of treatment. MDA content measurements showed that the MDA content of the KcPIF4 overexpressing lines initially increased and then decreased, with a relatively small overall change. However, the decrease was more pronounced after 120 min of treatment and was significantly lower than that of wild-type Arabidopsis. Chlorophyll content measurements showed that the chlorophyll a and chlorophyll b contents of wild-type Arabidopsis decreased with increasing high-temperature treatment time, while the overexpressing lines showed little change due to temperature. The carotenoid content of wild-type Arabidopsis showed little change with treatment time, exhibiting a decreasing trend, while the overexpressing lines initially decreased and then increased, reaching a maximum at 240 min of high-temperature treatment. Relative conductivity measurements showed that the overexpressing lines exhibited a decreasing-increasing-decreasing trend, significantly lower than the wild type after 120 min of treatment, but higher than the wild type at 30 min, indicating that the KcPIF4 overexpressing lines suffered greater damage but responded promptly.

[0097] Overall, during high-temperature treatment, the transgenic line OE1-3 showed higher SOD, CAT, and POD activities and chlorophyll content than the wild type, while its MDA content and electrolyte leakage were lower. This confirms that overexpression of the KcPIF4 gene is beneficial for Arabidopsis thaliana to activate its oxidative stress defense capabilities more quickly and efficiently, improve its ability to cope with oxidative damage under high-temperature stress, and enhance its high-temperature resistance.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An isolated KcPIF4 gene, characterized in that, The cDNA sequence of the gene is shown in SEQ ID NO.

3.

2. A KcPIF4 protein, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

4.

3. The application of the isolated KcPIF4 gene as described in claim 1 or the KcPIF4 protein as described in claim 2 in breeding to improve the high-temperature resistance of Arabidopsis thaliana.

4. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 3 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The temperature mentioned above does not exceed 45°C.

5. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 3 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The method for improving the high-temperature resistance of Arabidopsis thaliana includes the following steps: A KcPIF4 gene overexpression vector was constructed, transformed into wild-type Arabidopsis thaliana, and transgenic Arabidopsis thaliana with increased KcPIF4 gene expression was obtained.

6. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 5 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The construction of the KcPIF4 gene overexpression vector includes the following steps: Using *Pterocarya stenoptera* genomic DNA as a template, the KcPIF4 gene was amplified by PCR using the primer pair shown in SEQ ID NO.5-6. The amplified KcPIF4 gene was then ligated into the plant expression vector pK2GW7 via a Gateway reaction to obtain the KcPIF4 gene overexpression vector.

7. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 6 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The Gateway reaction includes the following steps: The amplified KcPIF4 gene was ligated to pDONR via a BP reaction. TM pDONR was then transferred to the 221 vector via an LR reaction. TM The KcPIF4 gene on vector 221 was ligated into the plant expression vector pK2GW7 to obtain the KcPIF4 gene overexpression vector.

8. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 6 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The PCR amplification program included: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 59 °C annealing for 30 s, 72 °C extension for 1.5 min, 32 cycles; 72 °C extension for 10 min.

9. The application of the isolated KcPIF4 gene or KcPIF4 protein according to claim 5 in breeding to improve the high-temperature resistance of Arabidopsis thaliana, characterized in that, The transformation method is selected from viral vector method, gene gun method, microinjection method, electroporation method or Agrobacterium-mediated method.

Images