A traditional Chinese medicine composition, a preparation method therefor and application thereof

Abstract

The application relates to the field of medicines, and particularly provides a traditional Chinese medicine composition, a preparation method and application thereof. The traditional Chinese medicine composition takes Radix Saposhnikoviae as a monarch drug, Radix Scutellariae as a minister drug, Astragalus as an assistant drug, and Radix Paeoniae Rubra as a guide drug, and the adding amount of each traditional Chinese medicine raw material is adjusted in a targeted manner. Research finds that the traditional Chinese medicine composition has obvious anti-inflammatory and antiviral effects, and shows outstanding effects in preventing and treating cold, influenza and viral pneumonia diseases; the formula is simple, has no toxic side effects, and is convenient to popularize and apply.

Description

Technical Field

[0001] This invention relates to the technical field of traditional Chinese medicine compositions, specifically to a traditional Chinese medicine composition, its preparation method, and its application. Background Technology

[0002] The common cold is a self-limiting external pathogenic disease, generally divided into the common cold (Cold) and influenza (Epidemic influenza, Grippe). The common cold, known in Traditional Chinese Medicine as "wind-cold," is a common respiratory illness caused by various viruses, with 30%-50% caused by a specific serotype of rhinovirus. While the common cold is most prevalent in early winter, it can occur in any season, such as spring and summer, and the causative viruses differ between seasons. Influenza is an acute respiratory infectious disease caused by the influenza virus. The virus resides in the respiratory tract of infected individuals and is transmitted to others through droplets when the patient coughs or sneezes. If you have cold symptoms, you should contact a health management professional promptly to take appropriate measures to prevent infection and receive proper treatment. Influenza A virus (IAV) infection can cause respiratory illness; it has a wide host range, is highly contagious, and can spread worldwide, seriously threatening human public health. In the past century, there have been several IAV pandemics globally, causing at least tens of millions of deaths. Influenza A virus (IAV) has 18 hemagglutinin and 11 neuraminidase subtypes, with influenza A (H1N1) pdm09 and influenza A (H3N2) viruses currently circulating in humans being the most prevalent. IAV infection can lead to multi-system complications, with viral pneumonia being the most common. IAV neuraminidase is the primary target of antiviral drugs; currently, the neuraminidase inhibitor oseltamivir is the most widely used, but the emergence of drug-resistant strains can lead to treatment failure. The most effective way to prevent influenza is through vaccination, but because the circulating viral strains change every year, influenza vaccines need to be replaced annually.

[0003] Traditional Chinese medicine theory holds that the common cold and influenza of the wind-heat type are caused by the body's exposure to wind-heat pathogens or seasonal toxins. This disease has a short incubation period and a rapid onset. Clinical manifestations are mainly local symptoms and signs, with significant differences between patients. Early symptoms often include dryness and discomfort in the throat, followed by fever, nasal congestion, runny nose, sore throat, cough, red tongue, yellow coating, and a floating and rapid pulse. Systemic symptoms may include limb aches, headache, fatigue, and decreased appetite. This disease can occur in all seasons, but is more common in winter and spring. When it occurs in a localized epidemic at the same time, with similar symptoms, it is called seasonal influenza. Epidemics of seasonal influenza often seriously endanger human health. The common cold primarily affects the upper respiratory tract (lung and wei qi), caused by external wind-heat or seasonal pathogens invading the lung and wei qi, leading to dysfunction of lung and wei qi, and impaired lung function. The illness typically lasts 3-7 days and rarely progresses beyond the initial stage. Seasonal influenza, on the other hand, is caused by wind-heat pathogens invading through the mouth, nose, or skin. It has a rapid onset, primarily affecting the lungs, mainly due to impaired lung function. Early symptoms include external symptoms, but after 3 days, significant pulmonary symptoms become dominant. In traditional Chinese medicine, the common cold and seasonal influenza correspond to acute upper respiratory tract infection and influenza in Western medicine. Acute upper respiratory tract infection refers to acute inflammation of the respiratory mucosa limited to the nasal cavity and pharynx. Approximately 80% are caused by viruses, with rhinovirus, respiratory syncytial virus, influenza virus, parainfluenza virus, adenovirus, and coronavirus being the most common pathogens. While often self-limiting, this illness is prone to bacterial infections, especially seasonal influenza, which can worsen the condition, prolong the illness, and lead to serious complications, even threatening the patient's life.

[0004] Developing a traditional Chinese medicine composition with few side effects and good efficacy for the prevention and treatment of colds and / or influenza is of great significance. Summary of the Invention

[0005] The purpose of this invention is to address the problems existing in the prior art by providing a traditional Chinese medicine composition, its preparation method, and its application. This traditional Chinese medicine composition uses Saposhnikovia divaricata as the principal ingredient, Scutellaria baicalensis as the assistant ingredient, Astragalus membranaceus as the adjuvant ingredient, and Paeonia lactiflora as the guiding ingredient. By specifically adjusting the amount of each traditional Chinese medicine ingredient, the prepared traditional Chinese medicine composition has significant anti-inflammatory and antiviral effects, and shows outstanding effects in the prevention and treatment of colds, influenza, and viral pneumonia. The formula is simple and has no toxic side effects.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A traditional Chinese medicine composition, prepared from the following raw materials in parts by weight,

[0008] Saposhnikovia divaricata 28-32 parts; Scutellaria baicalensis 52-55 parts; Astragalus membranaceus 52-55 parts; Paeonia lactiflora 25-35 parts.

[0009] This invention provides a traditional Chinese medicine composition with Saposhnikovia divaricata as the principal ingredient, Scutellaria baicalensis as the assistant ingredient, Astragalus membranaceus as the adjuvant ingredient, and Paeonia lactiflora as the guiding ingredient. By specifically adjusting the amount of each traditional Chinese medicine ingredient, the prepared traditional Chinese medicine composition has significant anti-inflammatory and antiviral effects, and shows outstanding effects in the prevention and treatment of colds, influenza, and viral pneumonia. The formula is simple, has no toxic side effects, and is easy to promote and apply.

[0010] Specifically, Fangfeng (Saposhnikovia divaricata) is pungent, sweet, and slightly warm, entering the Lung meridian. It has the effects of dispelling wind and releasing the exterior, eliminating dampness and relieving pain. This herb is pungent and ascending, warm but not drying, sweet and mild without being drastic, possessing a dispersing and penetrating nature, excelling in dispelling wind, and is a commonly used medicine for treating exogenous febrile diseases. Although it is described as slightly warm, it is not drying, and can be used for exogenous fever, regardless of whether the cold is more severe than the fever or vice versa. It is commonly used to treat exogenous fever. For wind-cold exterior syndrome, it is used in Fangfeng Decoction in *Zheng Yin Mai Zhi*; for exogenous fever, it is used in Jingfang Powder in *Yi Yi Ou Lu*; and for wind-heat exterior syndrome, it is used in Niubang Decoction in *Zheng Zhi Zhun Sheng*. In this formula, the emphasis is on using its pungent nature to release the exterior, dispel wind and expel pathogens, and disperse and clear heat, for symptoms such as fever, aversion to wind, nasal congestion and runny nose, and body aches caused by the invasion of wind-heat pathogens. Saposhnikovia divaricata is a "dispersing herb" (according to *Ben Cao Jing Shu*), possessing the property of dispersing and penetrating, excelling at dispelling wind, and is a "generally applicable herb for all types of wind-related ailments" (according to *Ben Cao Jing Ji Zhu*). It can "eliminate wind-evil in the upper burner" (according to *Yong Yao Fa Xiang*), effectively dispelling wind and expelling pathogens. It is significantly effective in treating fever, aversion to wind, runny nose, and body aches caused by viral upper respiratory tract infections. Modern pharmacological studies have shown that Saposhnikovia divaricata decoction has an antipyretic effect on fever induced by triple vaccine and mixed typhoid vaccine in rabbits, and has a significant inhibitory effect on respiratory syncytial virus; Saposhnikovia divaricata alcohol extract has anti-inflammatory and analgesic effects, and can exert an anti-inflammatory effect on LPS-induced pneumonia in mice by inhibiting the TLR4 / NF-κB pathway; 5-O-methylvisamidol glycoside and cimicifugain glycoside in Saposhnikovia divaricata have significant antagonistic effects on LPS-induced in vivo and in vitro inflammation. Therefore, it is used as the principal herb in this formula.

[0011] Scutellaria baicalensis, being bitter and cold in nature, enters the lung meridian and has the effects of clearing heat and drying dampness, purging fire and detoxifying. As a bitter and cold purgative, it excels at clearing heat from the upper burner and is a commonly used heat-clearing and detoxifying herb in clinical practice. Scutellaria baicalensis can clear excess heat in the qi level and has a good antipyretic effect. This formula uses this herb for several reasons. First, its cold nature helps to clear heat. Together with the chief herb, Saposhnikovia divaricata, it embodies the principle of using pungent herbs to relieve exterior symptoms and cold herbs to clear heat, thus achieving the effect of dispelling wind and reducing fever. It is truly effective in treating exogenous fever, as it "relieves muscle tension and reduces fever, ... without Scutellaria baicalensis, one cannot cool the muscles and reach the exterior (Compendium of Materia Medica)", and "can clear lung fire and relieve muscle heat (Li Gao)". Second, it has a bitter and mild taste. When stir-fried with wine, it ascends and "clears lung heat (Yunnan Materia Medica)" to "clear the fire in the upper burner (Corrected Materia Medica)" and "can treat heat toxins (Treatise on the Nature of Medicinal Herbs)" to "clear the throat (Corrected Materia Medica)", treating symptoms such as dry throat, sore throat, and dry and hot nasal cavity caused by wind-heat. Third, it enters the lungs to clear lung heat, treating symptoms such as cough caused by pathogenic heat entering the lungs and the lungs failing to disperse and descend. Fourth, it clears pathogenic heat, which can resolve the pathogenic heat of the Lesser Yang and prevent the pathogenic heat from spreading internally to the Lesser Yang. Through the above four effects, it directly targets the cause of the disease, wind-heat toxins obstructing the lungs, while also addressing symptoms such as sore throat, cough, wheezing, and phlegm. It is an essential medicine for treating pathogenic factors in the lung and wei levels, and for treating excessive lung heat. Modern pharmacological research shows that Scutellaria baicalensis has broad-spectrum antibacterial and antiviral effects, as well as good antipyretic, anti-inflammatory, and anti-allergic effects. Therefore, it is used as an assistant herb in this formula.

[0012] Astragalus membranaceus (Huangqi) is sweet and warm in nature, primarily entering the spleen and lung meridians. It can "treat chills and fever" (from *Treatise on the Nature of Medicinal Herbs*), "remove muscle heat" (Zhang Yuansu), and "its sweet and warm nature tonifies qi, possessing an ascending and dispersing property, specifically targeting the exterior to strengthen the skin and hair" (from *Correct Interpretation of Materia Medica*). It is a key herb for tonifying qi and relieving exterior symptoms. Firstly, it strengthens the spleen and tonifies qi, nourishing the earth to generate metal, securing the area not yet affected by pathogens, embodying the idea of ​​"prevention before disease." Secondly, it tonifies qi and relieves exterior symptoms, assisting the expulsion of pathogens and enhancing the exterior-releasing effect of the principal and assistant herbs. Saposhnikovia divaricata (Fangfeng) is a "moistening agent for wind-dispelling herbs," most suitable for use with Astragalus membranaceus and other qi-tonifying and exterior-strengthening herbs. "Saposhnikovia divaricata is used to expel exterior pathogens… while Astragalus membranaceus is used to invigorate the body's vital energy; the effect of Saposhnikovia divaricata with Astragalus membranaceus is even greater" (from *Collection of Treatises on Cold Damage*). Modern pharmacological research shows that Astragalus membranaceus has broad-spectrum antiviral and antibacterial effects, effectively protecting mice from influenza virus infection; Astragalus membranaceus also enhances the body's immune function and has sedative and anti-fatigue effects. Therefore, it is used as an adjuvant in this formula.

[0013] Red peony root, bitter and cold in nature, enters the liver meridian and readily travels through the blood. It is used to "disperse stagnant blood and expel pathogenic blood" (from *Mingyi Bielu*) and "reduce blood heat" (from *Diannan Bencao*). It can treat "lung pathogenic qi" (from *Yaoxing Lun*) and "naturally hot diseases and epidemic diseases" (from *Rihua Zi Bencao*). It also "specifically purges liver fire" (from *Yaopin Huayi*). Its effects are excellent in clearing heat, cooling the blood, dispersing blood stasis, and relieving pain. When combined with scutellaria baicalensis, red peony root combines cooling the blood with detoxification, aiming to enhance the heat-clearing, detoxifying, lung-clearing, and fever-reducing effects of scutellaria baicalensis. Modern pharmacological research shows that the water and alcohol extracts of red peony root have antiviral effects against respiratory syncytial virus, herpes simplex virus, Coxsackievirus, and hand-foot-and-mouth disease virus. It also has good anti-inflammatory and analgesic effects; therefore, it is used as the guiding herb in this formula.

[0014] Furthermore, the herbal composition is prepared by weight from the following raw materials: 30-32 parts of Saposhnikovia divaricata; 53-55 parts of Scutellaria baicalensis; 53-55 parts of Astragalus membranaceus; and 30-35 parts of Paeonia lactiflora. The preferred ratio of added raw materials allows the herbal composition to exhibit better anti-inflammatory and antiviral effects. Studies have found that changing or reducing the types of herbs, as well as altering the formulation of the herbal raw materials, significantly reduces the therapeutic effect on colds or pneumonia. More preferably, the herbal composition is prepared by weight from the following raw materials: 30 parts of Saposhnikovia divaricata; 54 parts of Scutellaria baicalensis; 54 parts of Astragalus membranaceus; and 30 parts of Paeonia lactiflora.

[0015] Furthermore, the traditional Chinese medicine composition is a powder formed by mixing and pulverizing various raw materials; or, the traditional Chinese medicine composition is obtained by heating and reflux extraction using water and / or an organic solvent.

[0016] Furthermore, the traditional Chinese medicine composition is prepared by the following method:

[0017] Step 1: Mix the raw materials of the Chinese herbal medicine composition in a certain proportion;

[0018] Step 2: Add water and / or ethanol to the mixed raw materials obtained in Step 1, and heat under reflux to extract 1-3 times to obtain the extract;

[0019] Step 3: Combine the extracts and sequentially filter, centrifuge, and concentrate to obtain a concentrated paste; if powder is required, dry and pulverize the concentrated paste to obtain the traditional Chinese medicine composition.

[0020] The method for extracting traditional Chinese medicine compositions is simple to operate and has a high raw material utilization rate.

[0021] For example, the traditional Chinese medicine composition is prepared by the following method:

[0022] Step 1: Mix the Chinese herbal raw materials according to the proportion, add water with 8 to 15 times the weight of the herbs and soak for 0.5 to 1 hour, then decoct for 1 to 1.5 hours, and filter to obtain decoction I and dregs I;

[0023] Step 2: Add 6 to 10 times the weight of the dregs I to water and decoct for 1 to 1.5 hours. Filter to obtain decoction II and dregs II.

[0024] Step 3: Add 6 to 10 times the weight of the dregs II to water and decoct for 1 to 1.5 hours. Filter to obtain decoction III and dregs III.

[0025] Step 4: Combine the decoctions, filter, centrifuge and concentrate to obtain a concentrated paste. If powder is required, the concentrated paste can be dried.

[0026] Another object of the present invention is to provide the application of the above-mentioned traditional Chinese medicine composition.

[0027] The above-mentioned traditional Chinese medicine composition is used in the preparation of drugs for the prevention and treatment of colds, and / or influenza, and / or viral pneumonia. Specifically, it is used for colds or influenza caused by wind-heat invasion, wind-heat invading the lungs, or heat-toxin attacking the lungs.

[0028] The application of the above-mentioned traditional Chinese medicine composition in the preparation of anti-inflammatory drugs.

[0029] The application of the above-mentioned traditional Chinese medicine composition in the preparation of antiviral drugs.

[0030] The above-mentioned traditional Chinese medicine composition is used in the preparation of drugs with the effects of dispelling wind and clearing heat, detoxifying and relieving sore throat.

[0031] The present invention also discloses a preparation comprising the above-mentioned traditional Chinese medicine composition.

[0032] A traditional Chinese medicine preparation comprising the above-mentioned traditional Chinese medicine composition and pharmaceutically acceptable excipients.

[0033] Furthermore, the traditional Chinese medicine preparation is in the form of tablets, capsules, pills, granules, or taken orally.

[0034] Furthermore, the excipients include fillers, disintegrants, lubricants, suspending agents, binders, sweeteners, flavoring agents, preservatives, and matrices. Fillers include: starch, pregelatinized starch, lactose, mannitol, chitosan, microcrystalline cellulose, sucrose, etc.; disintegrants include: starch, pregelatinized starch, microcrystalline cellulose, sodium carboxymethyl starch, croscarmellose, low-substituted hydroxypropyl cellulose, croscarmellose sodium, etc.; lubricants include: magnesium stearate, sodium lauryl sulfate, talc, silica, etc.; suspending agents include: polyvinylpyrrolidone, microcrystalline cellulose, sucrose, agar, hydroxypropyl methylcellulose, etc.; binders include: starch paste, polyvinylpyrrolidone, hydroxypropyl methylcellulose, etc.; sweeteners include: sodium saccharin, aspartame, sucrose, cyclamate, glycyrrhetinic acid, etc.; flavoring agents include: sweeteners and various flavorings; preservatives include: parabens, benzoic acid, sodium benzoate, sorbic acid and its salts, benzalkonium bromide, chlorethidium acetate, eucalyptus oil, etc.; matrix includes: PEG6000, PEG4000, insect wax, etc.

[0035] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0036] 1. This invention provides a traditional Chinese medicine composition, with Saposhnikovia divaricata as the principal herb, Scutellaria baicalensis as the assistant herb, Astragalus membranaceus as the adjuvant herb, and Paeonia lactiflora as the guiding herb. The amount of each herbal ingredient is specifically adjusted. This invention has constructed a mouse model of viral influenza infection. Studies have found that after mice were given the traditional Chinese medicine composition of this application, compared with the model group, the mice's mental state was slightly improved, their food consumption, activity level and weight increased to a certain extent, and their body temperature was significantly reduced. It has a good effect on alleviating the clinical symptoms caused by influenza virus infection, has a significant protective effect on various organs of mice infected with influenza A virus, and has a significant anti-inflammatory effect, producing an antiviral effect. Simultaneously, a mouse model of acute pneumonia was established. The study found that, compared to the model group, the low-dose group of the herbal composition described in this application showed a significant decrease in lung index, recovery of lung structure, reduced granulocyte infiltration in the alveolar interstitial spaces, and weakened perivascular edema, with no obvious lung damage observed. Furthermore, after administration, the levels of IL-6 and IL-1β in mouse serum showed a decreasing trend. Therefore, the herbal composition exhibits significant anti-inflammatory and antiviral effects, demonstrating outstanding efficacy in the prevention and treatment of colds, influenza, and viral pneumonia. The formula is simple, has no toxic side effects, and is easy to promote and apply.

[0037] 2. The application of the traditional Chinese medicine composition of this application in the preparation of drugs for the prevention and treatment of colds, and / or influenza, and / or viral pneumonia.

[0038] 3. Application of the traditional Chinese medicine composition in the preparation of anti-inflammatory drugs.

[0039] 4. Application of the traditional Chinese medicine composition in the preparation of antiviral drugs.

[0040] 5. The present invention also provides a traditional Chinese medicine preparation, comprising the above-mentioned traditional Chinese medicine composition and pharmaceutically compatible excipients, which has significant therapeutic effects. Attached Figure Description

[0041] Figure 1 This is a graph showing the comparison of body weight and food consumption of mice in each group in Example 1.

[0042] Figure 2 This is a comparison diagram of the general condition of mice in the blank group and the model group in Example 1.

[0043] Figure 3 This is a graph showing the comparison of body temperature data for each group of mice in Example 1.

[0044] Figure 4 This is a graph showing the organ index ratios of mice in each group in Example 1.

[0045] Figure 5 This is a graph showing the comparison of viral load in each group of mice in Example 1.

[0046] Figure 6 This is a graph showing the comparison of inflammatory factors in the lung tissue of mice in each group during Example 1.

[0047] Figure 7 This is a graph showing the comparison of serum inflammatory factors (IL6, IL-1β) in each group of mice in Example 1.

[0048] Figure 8 This is a comparative graph of the pathological morphology of the lung tissues of mice in each group in Example 1.

[0049] Figure 9 This is a graph showing the effect of prophylactic administration of FQ-01 on mouse body weight in Example 2.

[0050] Figure 10 This is a graph showing the effect of FQ-01 on the lung index of mice in Example 2.

[0051] Figure 11 This is a graph showing the effect of FQ-01 on the pathological morphology of mouse lung tissue in Example 2.

[0052] Figure 12 This is a graph showing the effect of FQ-01 on serum IL-6 in mice with acute pneumonia in Example 2.

[0053] Figure 13 This is a graph showing the effect of FQ-01 on serum IL-6 in mice with acute pneumonia in Example 2. Detailed Implementation

[0054] The present invention will now be described in detail with reference to the accompanying drawings.

[0055] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0056] Example 1

[0057] Anti-influenza virus experiment

[0058] 1. Experimental drugs

[0059] 1.1 Experimental Drugs

[0060] Table 1. Experimental Drug Information Table

[0061]

[0062] 1.2 Preparation of FQ-01 lyophilized powder

[0063] Weigh 30g of Saposhnikoviae Radix, 54g of Scutellariae Radix, 54g of Astragali Radix, and 30g of Paeoniae Radix Rubra, soak them in 15 times the volume (v / w) of pure water for 60min, heat to boiling under reflux and time for 60min, then filter with four layers of gauze to obtain filtrate 1; add 10 times the volume (v / w), 2000ml of pure water to the drug residue, heat under reflux for 60min, filter with four layers of gauze to obtain filtrate 2; add 8 times the volume (v / w), 1500ml of pure water to the drug residue, heat under reflux for 60min, filter with four layers of gauze to obtain filtrate 3; combine the three filtrates, centrifuge at 3000rpm for 5min, suction filter the supernatant with a Buchner funnel, concentrate the cooled filtrate using a rotary evaporator to obtain 500ml of FQ-01 aqueous extract. Place the obtained concentrated solution in a freeze dryer for freeze-drying, and finally obtain FQ-01 freeze-dried powder.

[0064] 1.3 Experimental reagents

[0065] Table 2 Experimental reagent information sheet

[0066]

[0067]

[0068] 1.4 Virus strain

[0069] Mouse-adapted strain of influenza A virus H1N1 (A / FM / 1 / 1947, H1N1) was a gift from Professor Yang Falong of Southwest Minzu University; the strain was passaged in chicken embryos, the allantoic fluid was collected, aliquoted and frozen for storage, and preserved in a -80℃ refrigerator.

[0070] 1.5 Experimental animals

[0071] 30 SPF-grade BALB / c mice, regardless of gender, with a body mass of 20±2g for females and 22±2g for males. They were purchased from Beijing Sibeifu Biotechnology Co., Ltd., with the animal production license number: SCXK (Beijing) 2019-0010, and the animal certificate number: NO110324231106357526. The feeding temperature of all animals was controlled at 23±1℃, the humidity was controlled at 50±5%, with a 12-hour light-dark cycle (light period from 8:00 to 20:00, dark period from 20:00 to 8:00). All animals were treated humanely in accordance with the guidelines of the National Institutes of Health, USA, and approved by the Animal Care and Use Committee of the Institute of Industrial Antibacterials of Chengdu University (Animal Ethics Approval No.: SIIA20230901). The animal experiment site is the BSL-2 laboratory of Sichuan Industrial Antibiotics Research Institute.

[0072] 1.6 Main instruments and equipment

[0073] Table 3 Main experimental instrument information sheet

[0074]

[0075]

[0076] 2. Experimental Methods

[0077] 2.1 Grouping and Modeling

[0078] Thirty mice were randomly divided into five groups according to their sex and body weight after three days of acclimatization: blank control group, model group, oseltamivir group, high-dose group (clinically equivalent dose), and low-dose group (half the equivalent dose), with six mice in each group. After anesthetizing the mice with 0.3% sodium pentobarbital via intraperitoneal injection, the mice were positioned with their heads facing upward and backward, and their nostrils facing upward. The model was established by nasal drops of 0.8LD50 30μl / mouse virus dilution. The position was maintained for 10-15 seconds to allow the virus dilution to enter the mouse's respiratory tract. The mice were then placed on their sides in cages. Mice in the blank control group were given an equal amount of PBS nasal drops as a control. The mice's body temperature, weight, and food consumption were measured and recorded daily.

[0079] 2.2 Experimental Dosing Regimen

[0080] Administering drugs began 24 hours after exposure. Mice in each group were given 0.2 mL / 10 g via gavage twice daily for 5 consecutive days. The normal control group and the model group were given 0.5% CMC-Na under the same conditions. The high-dose group was given 4.2 mg / g / day of FQ-01 lyophilized powder via gavage, and the low-dose group was given 2.1 mg / g / day of FQ-01 lyophilized powder dissolved in 0.5% CMC-Na, twice daily (morning and evening). Grouping and administration are shown in Table 4.

[0081] Table 4 Animal grouping and drug administration

[0082] Control 6 0.5% CMC-Na PBS IAV 6 0.5% CMC-Na 0.8LD50 30μl / each OSE 6 2.5 mg / kg, soluble in 0.5% CMC-Na 0.8LD50 30μl / each FQ-01-L 6 2.1 g / kg, soluble in 0.5% CMC-Na 0.8LD50 30μl / each FQ-01-H 6 4.2 g / kg, soluble in 0.5% CMC-Na 0.8LD50 30μl / each

[0083] 2.3 Indicator Testing

[0084] 2.3.1 Observation of general condition and measurement of general signs (weight, body temperature, diet) of mice

[0085] From the day of model establishment (day 0 of infection), the activity, fur condition, mental state, diet, and weight of each group of mice were observed and recorded daily. Body temperature was measured using a veterinary electronic rectal thermometer, with the following procedures: a. Gently restrain the mouse, disinfect the electronic rectal thermometer, and apply an appropriate amount of lubricant to ensure no discomfort or injury during insertion; b. Slowly and carefully insert the electronic rectal thermometer into the mouse's anus until the measuring part is fully inserted, maintaining a consistent insertion depth; c. Wait a sufficient time (usually a few seconds to half a minute) to ensure the temperature stabilizes, and record the displayed temperature reading. The final temperature is indicated by the "beep" sound of the rectal thermometer after measurement. After each measurement, clean and disinfect the anus with 75% alcohol before measuring the next mouse to avoid cross-infection.

[0086] 2.3.2 Lung Index Measurement

[0087] On day 6 after infection, mice were weighed and euthanized by collecting blood through the orbital cavity. Blood was collected using ordinary serum collection tubes and allowed to stand at room temperature (20-25℃) for 30 minutes until coagulation (a pale yellow liquid was precipitated). The blood was then centrifuged at 3000×g for 10 minutes at 4℃. The collection tubes were removed and placed on a test tube rack (operated on ice). The supernatant (i.e., serum) was aliquoted and dispensed into labeled 200µl EP tubes. These tubes were stored at -80℃. Mice were quickly dissected, and lung tissue was harvested, cleaned with physiological saline, dried, weighed, and recorded. The left lung lobe was fixed in 4% neutral formaldehyde and stained with hematoxylin and eosin (HE) for pathological examination. The right lung lobe was frozen at -80℃ for subsequent viral load testing. The lung index for each group was calculated using the following formula:

[0088]

[0089] 2.3.3 RT-PCR method for detecting nucleic acid content in lung tissue

[0090] Follow the instructions for the Chengdu Fuji Bio Animal Total RNA Isolation Kit extraction kit. The specific steps are as follows: Before the first use of the reagent, add 60 mL of anhydrous ethanol to Buffer cRL2 and 120 mL of anhydrous ethanol to Buffer RW2.

[0091] (1) Homogenization: Take 10-20 mg of fresh tissue and add it to 500 μL Buffer RL1. Use a glass homogenizer or electric homogenizer to homogenize the tissue.

[0092] (2) Transfer the homogenized slurry to a DNA-Cleaning Column (place the DNA-Cleaning Column in a collection tube), and centrifuge at 12,000 rpm (~13,400×g) for 2 min. Remove the DNA-Cleaning Column and retain the supernatant in the collection tube.

[0093] (3) Add 1.6 times the volume of Buffer cRL2 to the supernatant and mix gently.

[0094] (4) Transfer all the mixture to the RNA-only column (place the purification column in the collection tube), centrifuge at 12000 rpm for 1 min, and discard the waste liquid in the collection tube.

[0095] (5) Add 500 μL Buffer RW1 to the purification column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid in the collection tube.

[0096] (6) Add 700 μL of Buffer RW2 to the purification column (please confirm that anhydrous ethanol has been added according to the instructions before use), centrifuge at 12,000 rpm for 1 min, and discard the waste liquid in the collection tube.

[0097] (7) Repeat step (6).

[0098] (8) Place the purification column back into the collection tube, centrifuge at 12,000 rpm for 2 min in an empty tube, and remove any remaining buffer from the centrifuge column.

[0099] (9) Transfer the purification column to a new centrifuge tube, add 50-200 μL of preheated RNase-free ddH2O (at 65°C) to the center of the membrane of the purification column, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400 × g) for 1 min to collect the liquid in the collection tube, which is the total RNA. Store at -80°C.

[0100] (10) Total RNA quality detection: The absorbance ratio of the extracted total RNA at 260 nm and 280 nm was detected using a Nano Drop 2000 micro-volume nucleic acid analyzer, expressed as R = A260nm / A280nm. The R value of the extracted total RNA was determined to be between 1.8 and 2.2, and it was then ready for subsequent experiments.

[0101] 2.4.3 Reverse transcription reaction

[0102] Reverse transcription was performed according to the instructions of the Wuhan Saiwei Biotechnology cDNA reverse transcription kit. The transcribed cDNA was stored at -80℃. The reaction system for this experiment is shown in Table 5 below:

[0103] Table 5 Reverse Transcription System

[0104]

[0105] The above reverse transcription system was mixed, centrifuged, and the reverse transcription reaction conditions were set as shown in Table 6 below:

[0106] Table 6 Reverse Transcription Reaction Conditions

[0107]

[0108]

[0109] 2.4.4 Real-time quantitative polymerase chain reaction

[0110] (1) Specific primer design

[0111] All primers used in this experiment were designed based on the full sequences of relevant genes obtained from the National Center for Biotechnology Information (NCBI) database. Primers for each target gene were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences are shown in Table 7 below.

[0112] Table 7 Primer sequences

[0113] α-Tublin-F ATCACAGGCAAGGAGGATGC α-Tublin-R GCACTGGTCAGCCAGCTT IL-6-F TAGTCCTTCCTACCCCAATTTCC IL-6-R TGGTCCTTAGCCACTCCTTC TNF-F GTGCCTATGTCTCAGCCTCTTCTC TNF-R CCGATCACCCCGAAGTTCAGTAG IFN-F CTCCAGCTCCAAGAAAGGAC IFN-R TGGCAAAGGCAGTGTAACTC H1N1-F CTTCTAACCGAGGTCGAAACGTA H1N1-R GGTGACAGGATTGGTCTTGTCTTTA IL-1β-F CTGGTGTGTGACGTTCCCATTA IL-1β-R CCGACAGCACGAGGCTTT

[0114] (2) RT-PCR reaction system

[0115] The cDNA obtained by reverse transcription was added to the Real-time PCR reagents according to the Real-time PCR assay kit instructions. The reaction conditions were set as follows: pre-denaturation at 94℃ for 20 seconds, denaturation at the same temperature for 10 seconds, annealing at 60℃ for 10 seconds, and full extension at 72℃ with fluorescence collection for 10 seconds. The above reaction was repeated 40 times. Finally, the data were analyzed and processed.

[0116] Table 8 Amplification reaction system

[0117] 2x SYBR Green qPCR Master Mix(None ROX) 10μL <![CDATA[Forward Primer(10μM) a ]]> 0.4μL <![CDATA[Reverse Primer(10μM) a ]]> 0.4μL <![CDATA[Template b ]]> XμL Nuclease-Free Water (9.2-X)μL

[0118] (3) RT-qPCR data processing

[0119] The Ct value reflects the concentration of the target cDNA. The expression of the target gene relative to the internal reference gene is calculated using the 2-ΔΔCt method, and the results are used for statistical analysis. ΔΔCt = (Ct value of the target gene in the treatment group - Ct value of the internal reference gene in the treatment group) - (Ct value of the target gene in the blank group - Ct value of the internal reference gene in the blank group).

[0120] 2.4.5 Serum IL6 and IL1β ELISA kit detection

[0121] The levels of IL6 and IL1β in the serum of mice in each group were determined strictly according to the instructions of the kit.

[0122] 2.4.6 Lung tissue pathology scoring

[0123] Mice were anesthetized and euthanized after blood was collected from the eyeballs. Lung tissue was weighed and fixed in paraformaldehyde for 48 hours. The tissue was then dehydrated and embedded in paraffin using an automated dehydrator. Paraffin-embedded sections (5 μm) were prepared, and sections with intact pulmonary bronchioles were selected for HE staining. This experiment was conducted in a double-blind manner, with evaluation performed by two pathologists unaware of the sample grouping and treatment. Five high-power fields (40x) were taken from each pathological section for scoring, and the average of the five scores was used as the pathological score for that section. A higher score indicated a more severe degree of lung tissue lesion. The pathological scoring was performed according to the following scoring table (see Table 9).

[0124] Table 9 Pathology Scoring Table

[0125]

[0126] 3. Experimental Results

[0127] 3.1 General condition, weight, and diet of mice

[0128] Depend on Figure 2 It can be seen that in the normal control group, the mice were in good mental condition, moved quickly, had smooth fur, breathed evenly, ate well, and gained weight normally. The model group mice exhibited varying degrees of influenza symptoms, including reduced activity, curled-up posture, dull fur, reduced water and food intake, and weight loss. Compared with the model group, the mice in each treatment group showed slight improvement in mental condition, with increases in food consumption, activity level, weight, and body temperature, especially in the oseltamivir group and the FQ-01-low-dose group, whose overall condition was good. (See Table 10...) Figure 1 It was found that, compared with the control group, the body weight and food consumption of mice in the model group were significantly reduced, and the difference was statistically significant (P<0.001). Compared with the model group, the body weight of the oseltamivir group was significantly improved (P<0.001); the body weight of the high- and low-dose FQ-01 groups also increased significantly (P<0.001). These results demonstrate that FQ-01 has a good effect in alleviating the clinical symptoms caused by influenza virus infection.

[0129] Table 10. Body weight of mice in each group ( n = 6 to 8)

[0130]

[0131] Note: On day 6 of infection, compared with the control group, *P<0.05, **P<0.01, ***P<0.001; compared with the model group, #P<0.05, ##P<0.01

[0132] From Table 11, Figure 3 It was found that, compared with the control group, the body temperature of mice in the model group was significantly lower, and this was statistically significant (P<0.01). Compared with the model group, the body temperature of the oseltamivir group was significantly improved (P<0.001); the body temperature of the high- and low-dose FQ-01 groups also increased significantly (P<0.05). Combined with the results of mouse weight and diet, the experiment demonstrated that FQ-01 has a good effect in alleviating the clinical manifestations caused by viral infection.

[0133] Table 11 Comparison of body temperature in mice of different groups ( n = 6 to 8)

[0134]

[0135] Note: On day 6 of infection, compared with the control group, *P<0.05, **P<0.01, ***P<0.001; compared with the model group, #P<0.05, ##P<0.01

[0136] 3.2 Organ Index

[0137] Influenza virus infection caused viral pneumonia in mice. Inflammatory exudation increased lung weight; the higher the lung index value, the more severe the pneumonia. (See Table 12...) Figure 4 The results showed that, compared with the control group, the lung index of mice in the model group was significantly increased (P<0.01); compared with the model group, the lung index of all treatment groups was significantly decreased (P<0.001), and the low-dose FQ-01 group was superior to the oseltamivir group in improving the lung index. Compared with the control group, the brain index of mice in the model group was significantly increased (P<0.01), and compared with the model group, the brain index of all treatment groups was significantly decreased (P<0.05). Compared with the control group, the spleen index of mice in the model group was significantly increased (P<0.05), and compared with the model group, the spleen index of all treatment groups was significantly decreased (P<0.01). Compared with the control group, the thymus index of mice in the model group was decreased, but the difference was not statistically significant; compared with the model group, the thymus index of all treatment groups did not change significantly. In summary, FQ-01 has a significant protective effect on various organs of mice infected with influenza A virus and has a significant anti-inflammatory effect.

[0138] Table 12 Effects of FQ-01 on organ indices in mice infected with H1N1 virus ( n=6)

[0139]

[0140]

[0141] Note: Compared with the control group, *P<0.05, **P<0.01, ***P<0.001; compared with the model group, #P<0.05, ##P<0.01, ###P<0.001

[0142] 3.3 Viral load in lung tissue

[0143] Depend on Figure 5 It was found that the viral load in the model group mice was significantly higher than that in the control group (P<0.05); compared with the model group, the viral load in the lung tissue of all treatment groups was significantly lower (P<0.01), and the FQ-01 group was significantly more effective than the oseltamivir group in antiviral efficacy, indicating that FQ-01 can inhibit viral replication in mouse lung tissue and has a significant antiviral effect.

[0144] 3.4 Inflammatory factors in lung tissue

[0145] Influenza viruses often cause inflammation of the lung parenchyma, caused by Figure 6 The results showed that, compared with the control group, the levels of IL-6 and IL-1β in the lung tissue of the model group mice were significantly increased (P<0.01); compared with the model group, the levels of inflammatory factors in the lung tissue were significantly decreased after administration of FQ-01 (P<0.001), especially in the low-dose group; compared with the control group, the levels of TNF-α in the lung tissue were increased, and the TNF-α levels in each drug group also showed a decreasing trend (P>0.05), but this was not statistically significant. In conclusion, H1N1 infection significantly increased the levels of IL-1β, TNF-α, and IL-6 inflammatory factors in the lung tissue of mice, indicating that influenza virus invasion triggered a severe inflammatory response in mice, and FQ-01 can effectively improve the inflammatory response in lung tissue, thereby producing an antiviral effect.

[0146] 3.5 Mouse serum inflammatory factors (ELISA method)

[0147] Depend on Figure 7 It was found that, compared with the control group, the serum IL-6 and IL-1β levels in the model group mice were significantly increased (P<0.05); compared with the model group, the oseltamivir group showed a significant decrease in inflammatory factors, and the FQ-01 group showed a significant decrease in serum inflammatory factor levels (P>0.05), but these differences were not statistically significant. In summary... Figure 5 and Figure 6 It is known that FQ-01 can effectively improve the inflammatory response in mice, thereby producing an antiviral effect.

[0148] 3.6 Pathological findings of mouse lung tissue

[0149] Depend on Figure 8It can be seen that the alveolar morphology in the lung tissue of mice in the blank group is intact without injury, the alveolar wall is thin, and there is no obvious inflammatory cell infiltration. Compared with the blank group, the pathological score of lung tissue of mice in the model group increased significantly (P<0.05), indicating that the pathological injury of lung tissue of mice was significantly aggravated after H1N1 virus infection. A large number of inflammatory cell infiltration, widened alveolar septum, incomplete structure, interstitial edema accompanied by inflammatory cell infiltration, and obvious signs of lung injury can be seen in the lesion area of lung tissue of mice in the model group. Compared with the model group, the alveolar structure of the oseltamivir group, the FQ-01 low-dose group and the high-dose group was significantly improved compared with the model group, and the inflammatory cell infiltration was significantly reduced, and the pathological scores of lung tissue were all significantly decreased (no significant difference), indicating that the pathological injury of lung tissue of mice was significantly alleviated after intragastric administration of FQ-01.

[0150] Example 2

[0151] Anti-pneumonia experiment

[0152] 1. Experimental animals

[0153] Male Kunming mice (KM), SPF grade, with a body weight of 20±2g, were purchased from Hunan Silaikejingda Experimental Animal Co., Ltd. The animal production license number is SCXK(Xiang)2019-0004, and the animal certificate number is No.430727230102794438. The feeding temperature of all animals is controlled at 23±1℃, the humidity is 50±5%, and a 12-hour light-dark cycle is adopted (light period: 8:00-20:00, dark period: 20:00-8:00). All animals were humanely cared for in accordance with the guidelines of the National Institutes of Health (USA) and approved by the Animal Care and Use Committee of Chengdu University of Traditional Chinese Medicine (Animal Ethics Approval No.: 2024051).

[0154] 2. Drugs and instruments

[0155] 2.1 Drugs and reagents

[0156] Table 13 Experimental drug information table

[0157]

[0158]

[0159] 2.2 Experimental instruments

[0160] Table 14 Main experimental instrument information table

[0161]

[0162] 2.3 Test site

[0163] The State Administration of Traditional Chinese Medicine Level III Laboratory – Chengdu University of Traditional Chinese Medicine Level III Laboratory of Traditional Chinese Medicine Pharmacology (TCM-2009-315). All laboratory personnel must wear medical masks, lab coats, gloves, and caps.

[0164] 3. Animal grouping and intervention

[0165] 3.1 Grouping and treatment of prophylactic administration

[0166] Mice were acclimatized for 3 days and then randomly divided into 4 groups according to body weight: sham operation group (Sham), LPS model group (LPS group), dexamethasone group (Dexamethasone, DEX, 2.5 mg / mouse), high-dose H-FQ-01 group (administered at twice the clinical equivalent dose), medium-dose M-FQ-01 group (administered at the clinical equivalent dose), and low-dose L-FQ-01 group (administered at half the clinical equivalent dose), with 10 mice in each group. The H-FQ-01 group received 8.4 mg / g once by gavage for 3 consecutive days; the M-FQ-01 group received 4.2 mg / g once by gavage for 3 consecutive days; the low-dose L-FQ-01 group received 2.1 mg / g once by gavage for 3 consecutive days; and the DEX group received a single intravenous injection via tail vein on day 3. Two hours after the last administration, mice were anesthetized with isoflurane and their trachea exposed. Within 3 minutes, LPS (5 mg / mL, administration volume 10 μl / 10 g) was instilled to establish an acute pneumonia model in mice. After modeling, blood was collected from the orbital cavity at different time points (determined based on the kinetic results of the detection indicators). Six hours after modeling, mice were sacrificed, and whole blood and lung samples were collected under aseptic conditions. Lung index was measured, and the samples were fixed in 4% neutral formaldehyde and stained with hematoxylin and eosin (HE) for pathological examination.

[0167] 3.2 Detection Indicators

[0168] (1) Weight measurement

[0169] Weigh and record the sample 2 hours before molding, and record it once a day thereafter.

[0170] (2) Organ index measurement

[0171] After the animal is euthanized, its chest is immediately opened, lung tissue is aseptically removed, weighed immediately, and the lung index is calculated.

[0172]

[0173] (3) Serum inflammatory marker measurement

[0174] Blood was collected from the orbital cavity of mice before sacrifice, and serum was separated. Blood was collected from the orbital cavity 2 hours later (to test for IL-6) and 6 hours later (to test for IL-1β).

[0175] (4) Lung pathology score

[0176] Mice were euthanized by blood collection from the eyeballs. Lung tissue was weighed, fixed in paraformaldehyde for 48 hours, dehydrated using an automated dehydrator, and embedded in paraffin. Paraffin-embedded sections (5 μm) were prepared, and sections with intact pulmonary bronchioles were selected for HE staining. This experiment was conducted in a double-blind manner, with evaluation performed by two pathologists unaware of the sample grouping and treatment. Five high-power fields (40x) were taken from each pathological section for scoring, and the average of the five scores was used as the pathological score for that section. A higher score indicated a more severe degree of lung tissue lesion. The pathological scoring was performed according to the following scoring table (see Table 15).

[0177] Table 15 Pathology Scoring Table

[0178]

[0179] 3.3 Data Processing and Statistical Analysis

[0180] Quantitative data that meet the normal distribution are expressed as mean ± standard deviation. "" indicates that a one-way ANOVA was used to compare the significance between groups. p < 0.05 was considered statistically significant.

[0181] 4. Experimental Results

[0182] 4.1 Effects of FQ-01 on mouse body weight and lung index

[0183] Three days after prophylactic administration, there was no significant difference in body weight change between the LPS model group and the other administration groups compared to the Sham group. Figure 9 (Table 16) Mice required anesthesia for model establishment on day 4, therefore fasting for 8 hours overnight resulted in a slight decrease in body weight the following day compared to day 3. Compared to the control group, the lung index of the model group was significantly higher (p < 0.01); compared to the model group, the lung index of the dexamethasone group and the low-dose FQ-01 group was significantly lower (p < 0.05), while the lung index of the high-dose and medium-dose drug groups was significantly lower, but not statistically significant. Figure 10 ).

[0184] Table 16. Body weight and lung index of mice in each group ( n=10)

[0185]

[0186] Note: Compared with the control group, *P<0.05, **P<0.01, ***P<0.001; compared with the model group, #P<0.05, ##P<0.01, ###P<0.001.

[0187] 4.2 Pathological findings of mouse lung tissue

[0188] In the prophylactic administration, the alveolar structure of mice in the Sham group was normal, the alveoli were intact, the pulmonary artery lumen was large, the wall thickness was uniform without thickening, there were few inflammatory cells in the alveolar spaces and no hemorrhage or edema, and the lung pathology score was recorded as 0. Figure 11 The LPS group mice showed varying degrees of lung structural damage, including disordered alveolar structure, thinning or rupture of alveolar walls, thickening of alveolar spaces, narrowing of the lumen, extensive inflammatory cell infiltration in the alveolar spaces, significant perivascular edema and hemorrhage, and obvious signs of pulmonary consolidation. Their pathological scores were significantly higher than those of the Sham group (p<0.0001). Figure 11 After treatment with DEX and FQ-01, lung structure showed improvement, interalveolar granulocyte infiltration decreased, perivascular edema was reduced, and no significant lung damage was observed. The pathological score of the high-dose group was lower than that of the LPS group, but the difference was not statistically significant. The low-dose group showed a significant decrease compared to the model group (p<0.01), and the medium-dose group showed a significant decrease compared to the model group (p<0.001).

[0189] 4.3 Mouse serum inflammatory factors

[0190] In prophylactic administration, the serum IL-6 level in mice in the LPS group was significantly higher than that in the Sham group (p<0.001); compared with the LPS group, the serum IL-6 levels in the DEX group and the three FQ-01 administration groups were slightly lower than those in the LPS group, but the difference was not statistically significant (p>0.05). Figure 12 ).

[0191] Compared with the Sham group, the serum IL-1β levels in the LPS group mice showed an increasing trend but no significant difference (p>0.05); compared with the LPS group, the serum IL-1β levels in the DEX group and the FQ-01 drug group mice showed a decreasing trend but no significant difference (p>0.05). Figure 13 ).

[0192] Example 2

[0193] Traditional Chinese medicine composition

[0194] Weigh 28g of Saposhnikovia divaricata, 52g of Scutellaria baicalensis, 52g of Astragalus membranaceus, and 25g of Paeonia lactiflora. Soak in 15 times (v / w) pure water for 60 min, reflux and heat to boiling, then time for 60 min. Filter through four layers of gauze to obtain filtrate 1. Add 10 times (v / w) 2000ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 2. Add 8 times (v / w) 1500ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000 rpm for 5 min, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of FQ-02 water extract. Freeze-dry the obtained concentrate to obtain FQ-02 lyophilized powder.

[0195] Example 3

[0196] Traditional Chinese medicine composition

[0197] Weigh out 32g of Saposhnikovia divaricata, 55g of Scutellaria baicalensis, 55g of Astragalus membranaceus, and 35g of Paeonia lactiflora. Soak in 15 times the volume (v / w) of pure water for 60 min, reflux and heat to boiling, then time for 60 min. Filter through four layers of gauze to obtain filtrate 1. Add 10 times the volume (v / w) of 2000ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 2. Add 8 times the volume (v / w) of 1500ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000rpm for 5 min, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of FQ-03 water extract. Freeze-dry the obtained concentrate in a freeze dryer to obtain FQ-03 lyophilized powder.

[0198] Comparative Example 1

[0199] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 1 changed the proportions of each raw material, while keeping other parameters unchanged, as follows:

[0200] Weigh 22g of Saposhnikovia divaricata, 45g of Scutellaria baicalensis, 54g of Astragalus membranaceus, and 20g of Paeonia lactiflora. Soak in 15 times the volume (v / w) of pure water for 60 min, reflux and heat to boiling, then time for 60 min. Filter through four layers of gauze to obtain filtrate 1. Add 10 times the volume (v / w) of pure water (2000ml) to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 2. Add 8 times the volume (v / w) of pure water (1500ml) to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000 rpm for 5 min, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0201] Comparative Example 2

[0202] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 2 had a different ratio of each raw material added, while other parameters remained unchanged, as detailed below:

[0203] Weigh out 35g of Saposhnikovia divaricata, 60g of Scutellaria baicalensis, 54g of Astragalus membranaceus, and 40g of Paeonia lactiflora. Soak in 15 times the volume (v / w) of pure water for 60 minutes, then reflux and heat to boiling for 60 minutes. Filter through four layers of gauze to obtain filtrate 1. Add 10 times the volume (v / w) of pure water (2000ml) to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 2. Add 8 times the volume (v / w) of pure water (1500ml) to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000 rpm for 5 minutes, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0204] Comparative Example 3

[0205] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 3 removed Saposhnikovia divaricata, while other parameters remained unchanged.

[0206] Weigh 54g of Scutellaria baicalensis, 54g of Astragalus membranaceus, and 30g of Paeonia lactiflora. Soak in 15 times the volume (v / w) of pure water for 60 min, reflux and heat to boiling, then time for 60 min. Filter through four layers of gauze to obtain filtrate 1. Add 10 times the volume (v / w) of pure water (2000ml) to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 2. Add 8 times the volume (v / w) of pure water (1500ml) to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000 rpm for 5 min, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0207] Comparative Example 4

[0208] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 4 removed Scutellaria baicalensis, while other parameters remained unchanged.

[0209] Weigh 30g of Saposhnikovia divaricata, 54g of Astragalus membranaceus, and 30g of Paeonia lactiflora. Soak in 15 times (v / w) pure water for 60 minutes, reflux and heat to boiling, then time for 60 minutes. Filter through four layers of gauze to obtain filtrate 1. Add 10 times (v / w) 2000ml of pure water to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 2. Add 8 times (v / w) 1500ml of pure water to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000rpm for 5 minutes, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0210] Comparative Example 5

[0211] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 5 removed Astragalus membranaceus, while other parameters remained unchanged.

[0212] Weigh 30g of Saposhnikovia divaricata, 54g of Scutellaria baicalensis, and 30g of Paeonia lactiflora. Soak in 15 times (v / w) pure water for 60 minutes, then reflux and heat to boiling for 60 minutes. Filter through four layers of gauze to obtain filtrate 1. Add 10 times (v / w) 2000ml of pure water to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 2. Add 8 times (v / w) 1500ml of pure water to the residue, reflux and heat for 60 minutes, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000rpm for 5 minutes, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0213] Comparative Example 6

[0214] Compared with Example 1, the traditional Chinese medicine composition prepared in Comparative Example 6 removed Paeonia lactiflora, while other parameters remained unchanged.

[0215] Weigh out 30g of Saposhnikovia divaricata, 54g of Astragalus membranaceus, and 54g of Scutellaria baicalensis. Soak in 15 times (v / w) pure water for 60 min, reflux and heat to boiling, then time for 60 min. Filter through four layers of gauze to obtain filtrate 1. Add 10 times (v / w) 2000ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 2. Add 8 times (v / w) 1500ml of pure water to the residue, reflux and heat for 60 min, then filter through four layers of gauze to obtain filtrate 3. Combine the three filtrates, centrifuge at 3000 rpm for 5 min, filter the supernatant using a Buchner funnel, and concentrate the filtrate using a rotary evaporator after cooling to obtain 500ml of water extract. Freeze-dry the obtained concentrate in a freeze dryer.

[0216] The traditional Chinese medicine compositions prepared in Examples 2-3 and Comparative Examples 1-6 were tested for efficacy using the same methods as in Example 1. The results showed that the traditional Chinese medicine compositions prepared in Examples 2-3 exhibited significant anti-inflammatory and antiviral effects, demonstrating outstanding efficacy in the prevention and treatment of colds, influenza, and viral pneumonia. The efficacy of the traditional Chinese medicine compositions prepared in Comparative Examples 1-6 was significantly reduced.

[0217] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A traditional Chinese medicine composition, characterized in that, Prepared by weight from the following raw materials: Saposhnikovia divaricata 30-32 parts, Scutellaria baicalensis 53-55 parts, Astragalus membranaceus 53-55 parts, Paeonia lactiflora 30-35 parts; The traditional Chinese medicine composition uses Saposhnikovia divaricata as the principal herb, Scutellaria baicalensis as the assistant herb, Astragalus membranaceus as the adjuvant herb, and Paeonia lactiflora as the guiding herb.

2. The traditional Chinese medicine composition according to claim 1, characterized in that, It is prepared from the following raw materials in parts by weight: Saposhnikovia divaricata 30 parts, Scutellaria baicalensis 54 parts, Astragalus membranaceus 54 parts, and Paeonia lactiflora 30 parts.

3. The traditional Chinese medicine composition according to claim 1 or 2, characterized in that, The traditional Chinese medicine composition is a powder made by mixing and pulverizing various raw materials; or, the traditional Chinese medicine composition is obtained by extracting it by heating and reflux with water.

4. The traditional Chinese medicine composition according to claim 3, characterized in that, The traditional Chinese medicine composition is prepared by the following method: Step 1: Mix the raw materials of the Chinese herbal medicine composition in a certain proportion; Step 2: Add water to the mixture obtained in Step 1, and heat under reflux to extract 1 ton of water. Repeat 3 times to obtain the extract; Step 3: Combine the extracts and sequentially filter, centrifuge, and concentrate to obtain a concentrated paste; if powder is required, dry and pulverize the concentrated paste to obtain the traditional Chinese medicine composition.

5. The use of the traditional Chinese medicine composition according to any one of claims 1-4 in the preparation of drugs for the prevention and treatment of H1N1 influenza and / or viral pneumonia.

6. The use of the traditional Chinese medicine composition according to any one of claims 1-4 in the preparation of drugs against H1N1 virus.

7. A traditional Chinese medicine preparation, characterized in that, It consists of the traditional Chinese medicine composition according to any one of claims 1-4, and pharmaceutically acceptable excipients.

8. The traditional Chinese medicine preparation according to claim 7, characterized in that, The traditional Chinese medicine preparations are tablets, capsules, pills, granules, or oral liquids.

Images