A swine triple inactivated vaccine and a preparation method thereof

CN118477172BActive Publication Date: 2026-09-04ZHEJIANG VBIOSCI INC +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410029687.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-09
Publication Date
2026-09-04
Estimated Expiration
2044-01-09

AI Technical Summary

Technical Problem

造成PCV2、PCV3、MHP和Ery混合感染,造成猪只发病或死亡,给养殖业带来重大经济损失

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118477172B_ABST
    Figure CN118477172B_ABST
Patent Text Reader

Abstract

The application provides a porcine circovirus type 2b and 2d, porcine circovirus type 3, Mycoplasma hyopneumoniae, swine erysipelas type 1 and type 2 triple inactivated vaccine and a preparation method and application thereof, and belongs to the technical field of veterinary vaccines. The triple inactivated vaccine is prepared by mixing a Cap antigen of porcine circovirus type 2b, a Cap antigen of porcine circovirus type 2d, a Cap antigen of porcine circovirus type 3, inactivated Mycoplasma hyopneumoniae antigens, a SpaA antigen of swine erysipelas type 1 and a SpaA antigen of swine erysipelas type 2 and a suitable water adjuvant, and can play a role of one injection for six prevention and stress reduction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of veterinary vaccine technology, specifically to a trivalent inactivated vaccine containing porcine circovirus type 2b, porcine circovirus type 2d, porcine circovirus type 3, Mycoplasma hyopneumoniae, and swine erysipelas types 1 and 2, and its preparation method. Background Technology

[0002] Porcine circoviruses (PCVs) are single-stranded circular DNA viruses with a genome length of approximately 1.7 kb. Currently, the predominant circulating PCVs are porcine circovirus type 2b and 2d. PCVs primarily cause multisystemic wasting syndrome (MIS), pneumonia, swine dermatitis, nephropathy syndrome, and reproductive disorders in weaned piglets, resulting in significant economic losses for pig farming. Recently, porcine circovirus type 3 (PCV3) has also been on the rise. The Cap protein homology between PCV2 and PCV3 is very low, only about 26%, meaning that PCV2 vaccines do not provide cross-protection against PCV3.

[0003] Mycoplasma hyopneumoniae can cause swine mycoplasmal pneumonia, a contagious chronic respiratory disease. Infected pigs will exhibit symptoms such as coughing, wheezing, and stunted growth. Mycoplasma hyopneumoniae often causes mixed infections with other pathogens, which can worsen the disease and cause significant economic losses to the pig farming industry.

[0004] *Erysipelothrix rhusiopathiae*, commonly known as swine erysipelas bacillus, is a facultative anaerobic, Gram-positive, slender bacillus that causes erysipelas in pigs and other animals. Swine erysipelas is an acute, febrile infectious disease characterized by high fever, acute septicemia, skin rashes, chronic verrucous endocarditis, skin necrosis, and polyarthritis (non-suppurative arthritis). *Erysipelothrix rhusiopathiae* has several serotypes, with most cases caused by serotypes 1a and 2. SpaA protein is the main immunoprotective antigen of *Erysipelothrix rhusiopathiae* and a candidate protein for swine erysipelas vaccines.

[0005] Interleukin-1 (IL-1), also known as lymphocyte activating factor, can induce the release of interleukin-2, promote the maturation and proliferation of B cells, and produce interferon-γ, thereby affecting the body's immune response and activating cellular immunity.

[0006] TH2 is a helper T cell epitope peptide. When fused with a protein, it can induce enhanced humoral immunity during vaccine immunization.

[0007] Mycoplasmal pneumonia in pigs is an immunosuppressive disease that leads to a decline in the immunity of pig herds. It can cause mixed infections of PCV2, PCV3, MHP, and Erythrocyte sedimentation rate (ESR), resulting in morbidity or death in pigs and causing significant economic losses to the pig farming industry.

[0008] Currently, only single or dual vaccines are available on the market, which results in multiple immunizations and greater immune stress. Therefore, developing a safe and effective trivalent inactivated vaccine is of great significance. Summary of the Invention

[0009] The purpose of this invention is to provide a trivalent inactivated vaccine for porcine circovirus type 2b, porcine circovirus type 2d, porcine circovirus type 3, mycoplasma hyopneumoniae, swine erysipelas type 1 and 2, and the preparation method thereof.

[0010] In some respects, this document provides for the invention described in any of the following descriptions.

[0011] 1. A trivalent inactivated vaccine against porcine circovirus types 2b and 2d, porcine circovirus type 3, Mycoplasma hyopneumoniae, and swine erysipelas types 1 and 3, wherein the vaccine contains PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, swine erysipelas SpaA-DC1-IL1 antigen, and swine erysipelas SpaA-DC2-TH2 antigen.

[0012] 2. The trivalent inactivated vaccine according to Project 1, wherein the PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, erysipelas SpaA-DC1-IL1 antigen and erysipelas SpaA-DC2-TH2 antigen are inactivated antigens.

[0013] 3. The trivalent inactivated vaccine according to any one of items 1-2, wherein the polynucleotide sequence encoding the PCV2b Cap antigen is shown in SEQ ID NO:1, the polynucleotide sequence encoding the PCV2d Cap antigen is shown in SEQ ID NO:2, the polynucleotide sequence encoding the PCV3 Cap3 antigen is shown in SEQ ID NO:3, the polynucleotide sequence encoding the porcine erysipelas SpaA-DC1-ILI antigen is shown in SEQ ID NO:4, and the polynucleotide sequence encoding the porcine erysipelas SpaA-DC2-TH2 antigen is shown in SEQ ID NO:5.

[0014] 4. The trivalent inactivated vaccine according to any one of items 1-3, wherein the concentrations of PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, erysipelas SpaA-DC1-IL1 antigen, and erysipelas SpaA-DC2-TH2 antigen are 15-30 μg / ml, preferably, the concentrations of PCV2b Cap antigen and PCV2d Cap antigen are 20 μg / ml, and the concentrations of PCV3 Cap3 antigen are 25-50 μg / ml. The concentrations of Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, SpaA-DC1-IL1 antigen, and SpaA-DC2-TH2 antigen were all 20 μg / ml.

[0015] 5. The trivalent inactivated vaccine according to any one of items 1-4, wherein the vaccine further comprises an adjuvant, such as a biphasic adjuvant, such as ISA201, ISA206, or a water-soluble adjuvant, such as Gel02RP, IMS1313, 7749, preferably Gel02RP.

[0016] 6. The trivalent inactivated vaccine according to Project 5, wherein the volume ratio of the adjuvant to the total amount of antigen is 1:9 to 9:1, preferably 1:9.

[0017] 7. The trivalent inactivated vaccine according to any one of items 1-6, wherein the vaccine described is: IB236105

[0018] (1) The content of the PCV2b Cap antigen is ≥40μg / dose;

[0019] (2) The content of the PCV2d Cap antigen is ≥40μg / dose;

[0020] (3) The content of the PCV3 Cap3 antigen is ≥40μg / dose;

[0021] (4) The content of Mycoplasma pneumoniae Mhp antigen in the pig is ≥80μg / dose;

[0022] (5) The content of SpaA-DC1-IL1 antigen in the porcine erysipelas is ≥40μg / dosage;

[0023] (6) The content of SpaA-DC2-TH2 antigen in the porcine erysipelas is ≥40μg / dosage.

[0024] 8. The preparation method of the trivalent inactivated vaccine according to any one of items 1-7, including:

[0025] The protein sequences of the PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, porcine erysipelas SpaA-DC1-IL1 antigen, and porcine erysipelas SpaA-DC2-TH2 antigen were isolated, and the polynucleotide sequences encoding the protein sequences were codon-optimized and expressed in host cells to obtain the corresponding antigens.

[0026] Isolate and culture Mycoplasma hyopneumoniae, centrifuge, break up the bacterial cells and inactivate them to obtain Mycoplasma hyopneumoniae Mhp antigen;

[0027] Preferably, the obtained PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, swine erysipelas SpaA-DC1-IL1 antigen, and swine erysipelas SpaA-DC2-TH2 antigen are inactivated and then mixed with an adjuvant to obtain the trivalent inactivated vaccine.

[0028] 9. The use of the trivalent inactivated vaccine described in any one of items 1-7 in the preparation of medicines for the prevention of porcine circovirus 2b, porcine circovirus 2d, porcine circovirus 3, mycoplasma hyopneumoniae, and swine erysipelas.

[0029] In some embodiments, the present invention provides a trivalent inactivated vaccine comprising porcine circovirus type 2b Cap antigen, porcine circovirus type 2d Cap antigen, porcine circovirus type 3 Cap antigen, Mycoplasma hyopneumoniae antigen, and SpaA antigen of swine erysipelas, wherein the concentrations of porcine circovirus type 2b Cap antigen, porcine circovirus type 2d Cap antigen, and porcine circovirus type 3 Cap antigen are 15–30 μg / ml, the content of Mycoplasma hyopneumoniae antigen is 25–50 μg / ml, the content of SpaA-DC1-IL1 antigen of swine erysipelas is 25–50 μg / ml, and the content of SpaA-DC2-TH2 antigen of swine erysipelas is 25–50 μg / ml.

[0030] Furthermore, the concentrations of porcine circovirus type 2b Cap antigen, porcine circovirus type 2d Cap antigen, porcine circovirus type 3 Cap antigen, porcine circovirus type 3 Cap antigen, porcine mycoplasma pneumoniae antigen, swine erysipelas SpaA-DC1-IL1 antigen, and porcine erysipelas SpaA-DC2-TH2 antigen are all 20 μg / ml.

[0031] Furthermore, the trivalent inactivated vaccine also contains an adjuvant, with a volume ratio of adjuvant to antigen of 1:9.

[0032] Furthermore, the adjuvant is selected from Gel02RP, IMS1313, and 7749, with Gel02RP being preferred.

[0033] In some embodiments, the present invention further improves the preparation method of the above-mentioned trivalent inactivated vaccine, which includes the following steps: mixing porcine circovirus type 2b Cap antigen, porcine circovirus type 2d Cap antigen, porcine circovirus type 3 Cap antigen, porcine mycoplasma pneumoniae antigen, porcine erysipelas SpaA-DC1-IL1 antigen, porcine erysipelas SpaA-DC2-TH2 antigen and adjuvant evenly to obtain the vaccine.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] Currently, most vaccines on the market target one or two diseases. The trivalent inactivated vaccine provided by this invention significantly or extremely significantly increases the antibody levels of each component compared to single-component vaccines and commercially available vaccines after immunizing piglets. Simultaneously, this trivalent inactivated vaccine achieves a 5 / 5 protection rate against challenge, higher than the protection rate of single-component or commercial vaccines. This indicates that there is no interference between the six antigens, and the six components work synergistically to improve antibody levels and challenge protection, providing six protections with a single injection and reducing stress. The trivalent inactivated vaccine provided in this invention is safe, effective, and produces high antibody levels and good challenge protection after immunization, effectively solving the problems in the pig farming industry. The trivalent inactivated vaccine provided in this invention is characterized by safety, effectiveness, high antibody levels after immunization, and good challenge protection. The following detailed embodiments further illustrate the above-mentioned content of this invention. However, this should not be construed as limiting the scope of the invention to the following examples. All technologies implemented based on the above-mentioned content of this invention fall within the scope of this invention. Attached Figure Description

[0036] Figure 1 PCV2b Cap protein SDS-PAGE results

[0037] Figure 2 PCV2d Cap protein SDS-PAGE results

[0038] Figure 3 PCV3 Cap protein SDS-PAGE results

[0039] Figure 4 Mhp antigen protein SDS-PAGE results

[0040] Figure 5 SDS-PAGE results of SpaA-DC1-IL1 protein

[0041] Figure 6SDS-PAGE results of SpaA-DC2-TH2 protein

[0042] Figure 7 Results of IFN-γ detection in serum of piglets 14 days after PCV2b monotherapy and triple therapy

[0043] Figure 8 Results of IFN-γ detection in serum of piglets 14 days after immunization with PCV2d monotherapy and triple vaccine

[0044] Figure 9 Results of IFN-γ detection in serum of piglets 14 days after immunization with PCV3 monotherapy and triple vaccine

[0045] Figure 10 Results of serum IFN-γ detection in piglets 14 days after MHP monotherapy and triple vaccine immunization

[0046] Figure 11 Results of IFN-γ detection in serum of piglets 14 days after immunization with SpaA-DC-IL1 monotherapy and triple vaccine

[0047] Figure 12 Results of IFN-γ detection in serum of piglets 14 days after immunization with SpaA-DC-TH2 monotherapy and trivalent vaccine

[0048] Preservation Instructions

[0049] Strains taxonomy: Mycoplasma hyopneumoniae

[0050] Strain name: Mycoplasma hyopneumoniae MHP-DC-M strain

[0051] Latin name: Mycoplasma Hyopneumoniae

[0052] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0053] Collection institution abbreviation: CGMCC

[0054] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0055] Deposit date: December 15, 2023

[0056] Collection Center Registration Number: CGMCC NO.28026 Detailed Implementation

[0057] Unless otherwise specified, all reagents and raw materials used in the following examples and test cases are commercially available products.

[0058] The list of reagents and cell sources for this invention is as follows:

[0059] SF9 cells were purchased from Invitrogen, USA.

[0060] pFastbacl was purchased from Invitrogen, USA.

[0061] The cell culture medium was purchased from Gibco, USA.

[0062] The transfection reagent ExpiFectamine SF was purchased from Gibco, USA.

[0063] Sequences and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0064] PCR polymerase and restriction endonucleases were purchased from NEB, UK.

[0065] DH10Bac receptive cells were purchased from Beijing Solarbio Co., Ltd.

[0066] The adjuvant was purchased from Sepik, France.

[0067] The Mycoplasma hyopneumoniae MHP-DC-M strain was isolated, identified, and preserved by Beijing Dingchi Biotechnology Co., Ltd.

[0068] KM2 culture medium was purchased from Jiangsu Academy of Agricultural Sciences.

[0069] The porcine circovirus type 2 and porcine mycoplasma pneumoniae bivalent inactivated vaccine (recombinant baculovirus CP08 strain + JM strain) was purchased from Sinopharm Animal Health Co., Ltd., and for ease of description, it will be referred to as "commercial porcine circovirus type 2 and porcine mycoplasma pneumoniae bivalent vaccine".

[0070] Inactivated swine erysipelas vaccine was purchased from Chengdu Shiji Biopharmaceutical Co., Ltd.

[0071] Example 1: Preparation of PCV2b Cap antigen

[0072] Based on the Cap protein sequence of the isolated porcine circovirus strain PCV2b, the PCV2b Cap gene sequence was synthesized after optimization according to insect cell codons, as shown in SEQ ID NO.1.

[0073] The sequence was ligated into the pFastbac1 vector and transformed. The correctly sequenced expression plasmid pFastbac1-Cap2b was transformed into DH10Bac competent cells. Blue-white screening was performed, and the correctly identified baculoviruses were transfected into SF9 cells to obtain the recombinant virus rBac-Cap2b. The PCV2 rBac-Cap2b recombinant baculovirus was seeded into HighFive cells at an MOI of 0.1 and cultured at 27°C for 6-9 days. The cell culture was harvested, and the supernatant was collected by centrifugation at 8000 rpm for 15 min. The supernatant was purified, clarified, and concentrated using a 50 kDa ultrafiltration membrane to obtain the PCV2 Cap2b protein solution. The SDS-PAGE electrophoresis image of the purified PCV2 Cap2b protein is shown below. Figure 1 Its size is approximately 27 kDa. The concentration is 250 μg / ml.

[0074] Example 2: Preparation of PCV2d Cap antigen

[0075] Based on the Cap protein sequence of the isolated porcine circovirus strain PCV2d, the PCV2d Cap gene sequence was synthesized after optimization according to insect cell codons, as shown in SEQ ID NO.2.

[0076] The sequence was ligated into the pFastbac1 vector and transformed. The correctly sequenced expression plasmid pFastbac1-Cap2d was transformed into DH10Bac competent cells. Blue-white screening was performed, and the correctly identified baculoviruses were transfected into SF9 cells to obtain the recombinant virus rBac-Cap2d. The rBac-Cap2d recombinant baculovirus was seeded into HighFive cells at an MOI of 0.1 and cultured at 27°C for 6-9 days. The cell culture was harvested, and the supernatant was collected by centrifugation at 8000 rpm for 15 min. The supernatant was purified, clarified, and concentrated using a 50 kDa ultrafiltration membrane to obtain the PCV2 Cap2d protein solution. The SDS-PAGE electrophoresis image of the purified PCV2 Cap2d protein is shown below. Figure 2 Its size is approximately 28 kDa. The concentration is 250 μg / ml.

[0077] Example 3: Preparation of PCV3 Cap antigen

[0078] Based on the Cap protein sequence of the isolated porcine circovirus strain PCV3, the PCV3 Cap3 gene sequence was synthesized after optimization according to insect cell codons, as shown in SEQ ID NO.3.

[0079] The sequence was ligated into the pFastbac1 vector and transformed. The correctly sequenced expression plasmid pFastbac1-Cap3 was transformed into DH10Bac competent cells. Blue-white screening was performed, and the correctly identified baculoviruses were transfected into SF9 cells to obtain the recombinant virus rBac-Cap3. The rBac-Cap3 recombinant baculovirus was seeded into HighFive cells at an MOI of 0.1 and cultured at 27°C for 6-9 days. The cell culture was harvested, and the supernatant was collected by centrifugation at 8000 rpm for 15 min. The supernatant was purified, clarified, and concentrated using a 50 kDa ultrafiltration membrane to obtain the PCV3 Cap3 protein solution. The SDS-PAGE electrophoresis image of the purified PCV3 Cap3 protein is shown below. Figure 3 Its size is approximately 25 kDa. The concentration is 100 μg / ml.

[0080] Example 4: Preparation of MHP antigen

[0081] The Mycoplasma hyopneumoniae MHP-DC-M strain (strain preservation number CGMCC NO.28026) was inoculated at a ratio of 10% (V / V) into KM2 medium containing 10% serum and incubated at 37°C for 48-72 hours. The bacterial culture was harvested when the medium turned yellow and the pH reached approximately 6.8. The viable MHP count was determined to be 8 × 10⁻⁶. 9 CCU / ml, the prepared bacterial culture was centrifuged at 8500 r / min for 30 min, the supernatant was discarded, the precipitate was resuspended in 1 / 100 volume of PBS, and then homogenized (300-400 w, time 5-10 min). The total protein concentration of the precipitate mixture was determined by the BCA method, and the main target bands were detected by SDS-PAGE. See [link to table]. Figure 4 The MHP protein concentration was 750 μg / ml.

[0082] Example 5: Preparation of SpaA antigen from porcine erysipelas

[0083] Based on the SpaA antigen sequences of swine erysipelas serotype 1a strain LA150627 (GenBank: KU214211.1) and swine erysipelas serotype 2 strain C43311 (GenBank: EF635597.1) reported by NCBI, these sequences were fused with a small fragment of interleukin IL1, VQGDDSNNK, and the helper T cell epitope KLIPNASLIENCTKAEL, respectively. After codon optimization according to E. coli, SpaA-DC1-IL1, which has only the antigen characteristics of serotype 1a, and SpaA-DC2-TH2, which has the characteristics of serotype 2, were synthesized. The specific sequences are shown in SEQ ID No. 4 and SEQ ID No. 5.

[0084] Two sequences were synthesized and ligated between the BamHI and EcoRI restriction sites of the pET28a vector to construct the prokaryotic expression vectors pET28a-SpaA-DC1-IL1 and pET28a-SpaA-DC2-TH2. The correct vectors were then transformed into BL21 competent cells. Positive plasmids were transformed into BL21 competent cells, and the correctly identified positive strains SpaA-DC1-IL1-BL21 and SpaA-DC1-TH2-BL21 were induced to express the culture. Positive colonies were cultured overnight in 50 ml LB medium, then inoculated at a 1% inoculum into 150 ml TB medium and cultured at 37°C with shaking until OD600 = 1.8. IPTG was added to a final concentration of 1 mmol / L, and induction was performed for 6 h. After centrifugation, the culture was resuspended in 1 / 10 volume of PBS, sonicated, and the precipitate was harvested by centrifugation.

[0085] Inclusion body purification: The precipitate was added to cold washing buffer (20 mM Tris, 2 mM EDTA, 1% Trixon 100, 1% Tween 20, 0.5 M Urea, pH 8.2) at a ratio of 1:10 (w:v) and stirred for 20 minutes. Centrifuge at 12000 rpm for 25 minutes at 2–8°C, discard the supernatant, and collect the precipitate. Repeat once (washing for 2–4 hours to remove membrane fragments and proteins). The resulting precipitate was then washed once more with 50 mmol / L Tris-HCl under the same centrifugation conditions, discarding the supernatant. The resulting precipitate was the washed inclusion bodies. The washed inclusion body precipitate was resuspended in inclusion body denaturation and lysis buffer (50 mM Tris, 8 M Urea, 5 mM MGS, pH 8.2) at a ratio of 1:10 (w:v). The mixture was stirred at room temperature for 30–60 minutes to ensure complete dissolution. The mixture was then centrifuged at 12,000 rpm for 15 minutes at 2–8 °C. The precipitate was discarded, and the supernatant was collected. The supernatant was slowly and evenly added to 7 volumes of PBS solution. The mixture was incubated overnight at 2–8 °C for renaturation. The supernatant was centrifuged and filtered through a 0.22 μm filter membrane for sterilization. This was the renatured protein antigen solution. The washed inclusion body precipitate was resuspended in inclusion body denaturation and lysis buffer at a ratio of 1:10 (w:v). The mixture was stirred at room temperature for 30–60 minutes to ensure complete dissolution. Centrifuged at 12000 rpm for 15 minutes at 2–8°C, the precipitate was discarded, and the supernatant was collected. The supernatant was slowly and evenly added to 7 volumes of PBS solution, and the mixture was incubated overnight at 2–8°C for renaturation. The supernatant was then centrifuged and filtered through a 0.22 μm filter for sterilization. This was the renatured protein antigen solution. The renatured SpaA-DC1-IL1 and SpaA-DC2-TH2 were subjected to SDS-PAGE electrophoresis, as shown in the figures below. Figure 5 and Figure 6 The protein concentrations of SpaA-DC1-IL1 and SpaA-DC2-TH2 were 1.6 mg / ml and 1.8 mg / ml, respectively.

[0086] Example 6 Vaccine Preparation

[0087] 1) Inactivation: The prepared protein antigen solutions PCV2 Cap2b, PCV2 Cap2d, PCV3 Cap3, MHP, SpaA-DC1-IL1, and SpaA-DC2-TH2 were added to 1 mol / L BEI solution to a final concentration of 0.005 mol / L, stirring constantly while adding until homogeneous. The mixture was then inactivated at 37°C for 24 hours. After inactivation, a filtered, sterilized 2 mol / L sodium thiosulfate (Na2S2O3) solution was added to a final concentration of 0.005 mol / L. The mixture was stirred thoroughly and reacted at 37°C for 1 hour to terminate the inactivation process. The mixture was then stored at 2–8°C.

[0088] 2) The aseptic test for semi-finished products shall be carried out in accordance with the appendix of the current Chinese Veterinary Pharmacopoeia; the protein content shall be determined by the BCA method; the inactivation test shall be judged as qualified if no colony growth is observed.

[0089] 3) Vaccine finished product preparation

[0090] Trivalent inactivated vaccine preparation: After mixing the above semi-finished products, mix them with adjuvants at a ratio of 9:1 (v / v). The final concentrations are: PCV2Cap2b 20 μg / ml, PCV2 Cap2d 20 μg / ml, PCV3 Cap3 20 μg / ml, MHP 40 μg / ml, SpaA-DC1-IL1 25 μg / ml, and SpaA-DC2-TH2 25 μg / ml.

[0091] Single-dose preparation: Inactivated antigens PCV2b Cap, PCV2d Cap, PCV3 Cap3, MHP, SpaA-DC1-IL1, and SpaA-DC2-IL2 were mixed with adjuvants at a ratio of 9:1. The final antigen concentrations in the single-dose were 20 μg / ml for PCV2Cap2b, 20 μg / ml for PCV2 Cap2d, 20 μg / ml for PCV3 Cap3, 40 μg / ml for MHP, 25 μg / ml for SpaA-DC1-IL1, and 25 μg / ml for SpaA-DC2-IL2.

[0092] 4) The dosage inspection was carried out in accordance with the current appendix of the Chinese Veterinary Pharmacopoeia and met the requirements.

[0093] 5) The sterility test was conducted in accordance with the current appendix of the Chinese Veterinary Pharmacopoeia and met the requirements.

[0094] Example 7 Immunoassay

[0095] Healthy Landrace pigs aged 3-4 weeks (negative for porcine circovirus type 2b, porcine circovirus type 2d, porcine circovirus type 3, mycoplasma hyopneumoniae, and erysipelas antibodies and antigens, and negative for African swine fever antigen and porcine reproductive and respiratory syndrome antigen) were selected for immunization tests by intramuscular injection in the neck. A booster immunization was given 3 weeks (21 days) after the initial immunization, and challenge was performed 14 days after immunization.

[0096] 1.PCV2b

[0097] 1.1 Vaccine Immunization and Challenge Procedures

[0098] This experiment consisted of 5 groups: Group A1 was the trivalent inactivated vaccine immunization group, Group A2 was the PCV2b monotherapy immunization group, Group A3 was the circovirus bivalent commercial vaccine group, Group A4 was the non-immunized challenge control group, and Group A5 was the non-immunized and non-challenge blank control group. Each group contained 5 piglets, with an immunization dose of 2 ml, administered twice. 14 days after the second immunization, Groups A1 (trivalent inactivated vaccine immunization group), A2 (PCV2 monotherapy immunization group), A3 (circovirus bivalent commercial vaccine), and A4 (non-immunized challenge control group) were challenged with the virulent PCV2b-DC21 strain, injected with 10 ml of the vaccine. 5.6 TCID 50 / ml porcine circovirus PCV2b-DC21 strain 8ml (4ml intramuscular injection, 4ml nasal drops). Each group was isolated and observed. On the 4th and 7th day after challenge, all pigs in groups A1, A2 and A3 were inoculated with keyhole hemocyanin (KLH / ICFA, 0.5mg / ml) emulsified with Freund's incomplete adjuvant at 4 points on both sides of the armpit and both sides of the buttocks, 1ml at each point (4ml / pig). At the same time, 10ml / pig was intraperitoneally inoculated with thioglycolic acid medium. On the 11th and 19th day after challenge, 10ml / pig was intraperitoneally inoculated with thioglycolic acid medium again. Following viral challenge, piglets were observed for 25 consecutive days. On day 25, all piglets in groups A1, A2, A3, A4, and A5 were weighed, and blood samples were collected from infected piglets. Serum was separated, and the PCV2 viral load in the serum was measured. Infected piglets were culled, and inguinal lymph nodes were collected for PCV2 antigen detection using immunohistochemical methods. Disease was diagnosed based on viremia (viral viral load), relative daily weight gain, and inguinal lymph node antigen detection results. The presence of any two or three of these indicators constituted disease.

[0099] 1.2 Relative daily weight gain

[0100] On the day of challenge and 25 days after challenge, the body weight of each group of experimental pigs was measured. The relative daily weight gain of each group of experimental pigs within 25 days after challenge was calculated. If the relative daily weight gain of the challenged group of experimental pigs was lower than that of the blank control group and the difference was significant (P<0.05), the experimental pigs in that group were judged to have poor growth and development and all had clinical symptoms.

[0101] Relative daily weight gain = (Weight 25 days after infection - Weight on the day of infection) / Weight on the day of infection / 25

[0102] Relative weight gain rate (%) = (Average daily weight gain of piglets in the blank control group - Average daily weight gain of piglets in the challenge experiment) / Average daily weight gain of piglets in the blank control group * 100

[0103] 1.3 Viral antigen detection was performed using immunohistochemistry.

[0104] 1) Sampling and Sample Fixation: After bloodletting from the animal's carotid artery, quickly collect inguinal lymph node tissue, immerse it in a 2.5% glutaraldehyde-paraformaldehyde mixture, and fix it for 8–12 hours. Trim the fixed tissue into appropriately sized blocks. The knife used for trimming should be sharp, and it is best to make a single cut to form a row, avoiding back-and-forth sawing.

[0105] 2) Tissue Dehydration, Clearing, and Embedding: Remove the fixed tissue, make minor adjustments, and place it in a dehydration basket. Dehydrate using a gradient of alcohols: 75% ethanol for 2 hours, 85% ethanol for 2 hours, 95% ethanol for 1-2 hours, anhydrous ethanol for approximately 30 minutes, and anhydrous ethanol:xylene (1:1) for approximately 30 minutes. Then, immerse the dehydrated tissue in xylene solution 1 and xylene solution 2 until completely clear (generally no more than 20 minutes). After removal, permeate the tissue in old wax at 60℃ for 40 minutes, then permeate it in the embedding machine's wax tanks 1 and 2 for 40 minutes each. After permeation, embed the tissue in old wax.

[0106] 3) Treatment of slides and coverslips: Soak new slides and coverslips in acid overnight, wash them thoroughly with distilled water, then blot them with deionized water, and dry them in an oven for later use.

[0107] 4) When preparing tissue sections, the thickness should not exceed 5 μm. After fully spreading the cut tissue in a 42°C water bath, mount it onto a glass slide. After mounting, lay it flat for a period of time to prevent the tissue from slipping off, and then place it on a staining rack and bake it overnight at 60°C. The processed tissue sections can be stored at 2-8°C.

[0108] 5) Dewaxing and hydration: Immerse the tissue array in xylene for 10 minutes, then replace the xylene and immerse for another 10 minutes; then in a xylene:ethanol (1:1) solution for 5 minutes; then immerse in anhydrous ethanol 1 for 5 minutes, then replace with anhydrous ethanol 2 and immerse for another 5 minutes; immerse in 95% ethanol for 3 minutes; immerse in 85% ethanol for 3 minutes, then immerse in 75% ethanol for 3 minutes, then replace with 75% ethanol and immerse for another 5 minutes. Rinse three times with PBS (0.01 mol / L, pH 7.4), 5 minutes each time.

[0109] 6) Blocking endogenous peroxidase: Add 100 μL of 3% H2O2 solution to each cleaned tissue section and block at room temperature for 20 minutes. Do not allow the tissue sections to dry completely, otherwise false positives may occur.

[0110] 7) Antigen retrieval: Heat sodium citrate buffer (0.01 mol / L, pH 6.0, containing 3 g of trisodium citrate and 0.4 g of citric acid per 1000 ml) to 97°C in a microwave oven. Place the tissue sections in the buffer and continue to maintain the temperature at 97°C in the microwave oven for 10-20 minutes. After removing the sections, allow them to cool naturally to room temperature. Then wash them three times with PBS (0.01 mol / L, pH 7.4), each time for 5 minutes.

[0111] 8) Blocking: Add 1.5% BSA blocking solution dropwise to the tissue, 50 μL / piece, and block at 37°C for 25-30 minutes.

[0112] 9) PCV2 antibody incubation: After diluting the PCV2 monoclonal antibody 1:100, add 50 μL to each tissue slide and incubate in a humidified chamber at 37°C for 1 hour. Wash with PBS (0.01 mol / L, pH 7.4) 3-5 times, 5 min each time.

[0113] 10) HRP-goat anti-mouse IgG was diluted 1:100 with PBS (0.01mol / l, pH 7.4), and 50ul was added to each tissue sample. The sample was incubated at 37°C for 1 hour and then washed with PBS (0.01mol / l, pH 7.4) 3-5 times for 5 minutes each time.

[0114] 11) DAB staining: Blot dry the PBS around the tissue slides, add 50 μL of DAB staining solution to each tissue slide, and incubate at room temperature. The specific staining time can be determined under a microscope. Stop the staining with distilled water. After staining, soak the tissue slides in PBS (0.01 mol / L, pH 7.4) for 10 min to prevent the background from being too dark.

[0115] 12) After staining, the tissue was stained with hematoxylin for about 7 minutes, then rinsed with distilled water, separated with 1% color alcohol, and then bluing. Then it was dehydrated with a gradient of alcohols, namely 75% ethanol for 3-5 minutes, 85% ethanol for 3-5 minutes, 95% ethanol for 3 minutes, 95% ethanol for 3 minutes, anhydrous ethanol solution 1 for 3 minutes, anhydrous ethanol solution 2 for 3 minutes, anhydrous ethanol:xylene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and xylene solution 2 for 5 minutes until fully transparent. After removing it, xylene:benzene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and xylene solution 2 for about 5 minutes until fully transparent. Before the xylene has completely evaporated, it was mounted with neutral resin.

[0116] 13) Microscopic observation: Under a microscope, the presence of obvious brownish-yellow staining in the cytoplasm indicates a positive result, while the absence of obvious brownish-yellow staining indicates a negative result.

[0117] 1.4 Viremia was determined by PCR detection of PCV2b virus in serum.

[0118] 1) Primer and probe sequences: The following specific primers and probes were used for PCR detection of PCV2 virus.

[0119] P1: 5'-GAATCTCATCATGTCCACCGC-3' (SEQ ID No. 6)

[0120] P2: 5'-GTTACCGCTGGAGAAGGAAAA-3' (SEQ ID No. 7)

[0121] Probe sequence: 5'-FAM-TTCAACACCCGCCTCTCCCGCA-BHQ1-3' (SEQ ID No. 8)

[0122] 2) DNA extraction: Blood and serum separation were performed according to the kit instructions to extract DNA.

[0123] 3) The PCR reaction uses a 20ul reaction system: 10μl of Premix Ex Taq™ (2x) and mixed primers (10μmol / L).

[0124] Premix EX Taq 2X 10μl 1 P1 0.4μl 0.2 P2 0.4μl 0.2 probe 0.8μl ROX Reference Dye(50X)*3 0.4μl 1 DNA template 2μl Sterilized water 6μl Total 20μl

[0125] PCR reaction parameters: denaturation at 95℃ for 5 seconds, annealing at 60℃ for 40 seconds, for a total of 40 cycles. A standard curve was prepared using plasmid standards; a value higher than 1000 copies / ml was considered positive, and a value lower than 1000 copies / ml was considered negative.

[0126] 1.5 Immunopotency Test Results

[0127] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever. No redness or swelling appeared at the injection site. Specific antibody detection and challenge protection results for the experimental animals are shown in Table 1. Table 1 indicates that both the triple vaccine and the PCV2b monotherapy vaccine had excellent immunizing effects. Fourteen days after the second immunization, the PCV2 ELISA antibody level was significantly different from that of the PCV2b monotherapy vaccine and the commercial vaccine (P < 0.01); the triple vaccine significantly increased antibody levels compared to the monotherapy and commercial vaccines (P < 0.01); the challenge protection rate for the triple vaccine was 5 / 5, while the challenge protection rate for the PCV2b monotherapy and the commercial vaccine was 4 / 5. Simultaneously, serum γ-interferon levels were measured 14 days after the second immunization. Figure 7The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine and commercial vaccine (P < 0.01); there was no significant difference in the level of interferon-gamma between the single vaccine and commercial vaccine (P > 0.05).

[0128] Table 1. Immunopotency Test of PCV2b

[0129]

[0130] Note: A "-" indicates a viral nucleic acid load of no more than 1000 copies / ml, which is considered negative; a "+" indicates a viral nucleic acid load of more than 1000 copies / ml, which is considered positive.

[0131] The relative daily weight gain before and after challenge is indicated by “-”, which means that the relative daily weight gain is not significantly different from that of the control pigs (P < 0.05), and “+”, which means that the relative daily weight gain is significantly different from that of the control pigs (P > 0.05).

[0132] Immunohistochemistry "-" indicates that no fluorescence was detected, meaning no PCV2b virus was detected. "+" indicates that fluorescence was detected, meaning PCV2b virus was present.

[0133] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0134] 2.PCV2d

[0135] 2.1 Vaccine Immunization and Challenge Procedures

[0136] This experiment involved 25 experimental animals, divided into 5 groups of 5 animals each. Group B1 received a trivalent inactivated vaccine, Group B2 received a PCV2b monotherapy vaccine, Group B3 received a commercial circovirus bivalent vaccine, Group B4 was a non-immunized control group (challenged only), and Group B5 was a blank control group (neither immunized nor challenged). Each group of 5 piglets received two immunizations at a dose of 2ml. Fourteen days after the second immunization, Groups B1 (trivalent inactivated vaccine), B2 (PCV2d monotherapy), B3 (circovirus bivalent vaccine), and B4 (non-immunized challenge control group) were challenged with the virulent PCV2d-DC22 strain, and each group was injected with 10 ml of the vaccine. 6.0 TCID 50 / ml porcine circovirus PCV2d-DC22 strain 8ml (4ml intramuscular injection, 4ml nasal drops). Each group was isolated and observed. On the 4th and 7th day after challenge, groups B1, B2, B3 and B4 were inoculated with keyhole hemocyanin (KLH / ICFA, 0.5mg / ml) emulsified with Freund's incomplete adjuvant at 4 points on both sides of the armpit and both sides of the buttocks of each pig, 1ml at each point (4ml / pig). At the same time, 10ml / pig was intraperitoneally inoculated with thioglycolic acid medium. On the 11th and 19th day after challenge, 10ml / pig was intraperitoneally inoculated with thioglycolic acid medium again. Following viral challenge, piglets were observed for 25 consecutive days. On the 25th day, all piglets in groups B1, B2, B3, B4, and B5 were weighed, and blood was collected from infected piglets. Serum was separated, and the PCV2 viral nucleic acid load in the serum was detected. Infected piglets were culled, and inguinal lymph nodes were collected for PCV2 antigen detection using the immunohistochemical method. The diagnosis was based on piglet viremia (viral nucleic acid load), relative daily weight gain, and inguinal lymph node viral antigen detection results. The presence of any two or three of these indicators constituted disease. 2.2 Relative Daily Weight Gain

[0137] On the day of challenge and 25 days after challenge, the body weight of each group of experimental pigs was measured. The relative daily weight gain of each group of experimental pigs within 25 days after challenge was calculated. If the relative daily weight gain of the challenged group of experimental pigs was lower than that of the blank control group and the difference was significant (P<0.05), the experimental pigs in that group were judged to have poor growth and development and all had clinical symptoms.

[0138] Relative daily weight gain = (Weight 25 days after infection - Weight on the day of infection) / Weight on the day of infection / 25

[0139] Relative weight gain rate (%) = (Average daily weight gain of piglets in the blank control group - Average daily weight gain of piglets in the challenge experiment) / Average daily weight gain of piglets in the blank control group * 100

[0140] 2.3 Viral Antigen Detection Viral antigen detection was performed using immunohistochemistry. 1) Sampling and Sample Fixation After bloodletting from the animal's carotid artery, inguinal lymph node tissue was quickly collected and soaked in a 2.5% glutaraldehyde-paraformaldehyde mixture for 8–12 hours. The fixed tissue was then trimmed into appropriately sized blocks. A sharp knife was used for trimming; ideally, a single cut should be made to create a straight line, avoiding back-and-forth sawing. 2) Tissue Dehydration, Clearing, and Embedding The fixed tissue was removed, slightly modified, and placed in a dehydration basket. It was dehydrated using a gradient of alcohols: 75% ethanol for 2 hours, 85% ethanol for 2 hours, 95% ethanol for 1–2 hours, anhydrous ethanol for approximately 30 minutes, and anhydrous ethanol:xylene (1:1) for approximately 30 minutes. The dehydrated tissue was then immersed in xylene solution 1 and xylene solution 2 until completely clear (generally no more than 20 minutes). After removal, permeate the tissue in old wax at 60℃ for 40 minutes, then permeate it in embedding chambers 1 and 2 for 40 minutes each. After permeation, embed the tissue in old wax. 3) Treatment of slides and coverslips: Soak new slides and coverslips in acid overnight, wash thoroughly with distilled water, then blot with deionized water, and dry in an oven for later use. 4) Sectioning, mounting, and baking: When preparing tissue sections, the thickness should not exceed 5 μm. After fully spreading the sectioned tissue in a 42℃ water bath, mount it onto a glass slide. After mounting, lay it flat for a period of time to prevent the tissue from slipping, then place it on a staining rack and bake at 60℃ overnight. The prepared tissue sections can be stored at 2-8℃. 5) Dewaxing and Hydration: Immerse the tissue microarray in xylene for 10 minutes, then replace the xylene and immerse for another 10 minutes; then in a xylene:ethanol (1:1) solution for 5 minutes; then immerse in anhydrous ethanol 1 for 5 minutes, then replace with anhydrous ethanol 2 and immerse for another 5 minutes; immerse in 95% ethanol for 3 minutes; immerse in 85% ethanol for 3 minutes, then immerse in 75% ethanol for 3 minutes, then replace with 75% ethanol and immerse for another 5 minutes. Rinse three times with PBS (0.01 mol / L, pH 7.4), 5 minutes each time. 6) Blocking Endogenous Peroxidase: Add 100 μL of 3% H2O2 solution to each of the cleaned tissue sections and block at room temperature for 20 minutes. Do not allow the tissue sections to dry completely, otherwise false positives may occur. 7) Antigen retrieval: Heat sodium citrate buffer (0.01 mol / L, pH 6.0, containing 3 g trisodium citrate and 0.4 g citric acid per 1000 ml) to 97°C in a microwave oven. Place the tissue sections in the buffer and continue to microwave at 97°C for 10-20 minutes. After removing, allow to cool naturally to room temperature, then wash three times with PBS (0.01 mol / L, pH 7.4), 5 minutes each time. 8) Blocking: Add 1.5% BSA blocking solution dropwise to the tissue (50 μL / section) and block at 37°C for 25-30 minutes.9) PCV2 antibody incubation: After diluting PCV2d monoclonal antibody 1:100, add 50 μL to each tissue slide and incubate at 37°C for 1 hour in a humidified chamber. Wash 3-5 times with PBS (0.01 mol / L, pH 7.4), 5 min each time. 10) HRP-goat anti-mouse IgG: Dilute 1:100 with PBS (0.01 mol / L, pH 7.4), add 50 μL to each tissue slide, incubate at 37°C for 1 hour, and wash 3-5 times with PBS (0.01 mol / L, pH 7.4), 5 min each time. 11) DAB staining: Blot dry the PBS around the tissue slide, add 50 μL of DAB staining solution to each tissue slide, and develop at room temperature. The specific development time can be determined under a microscope. Stop the staining with distilled water. After staining, soak in PBS (0.01 mol / L, pH 7.4) for 10 min to prevent excessive background staining. 12) After staining, the tissue is stained with hematoxylin and eosin for about 7 minutes, then rinsed with distilled water, separated with 1% color alcohol, and then bluing. It is then dehydrated with a gradient of alcohols: 75% ethanol for 3-5 minutes, 85% ethanol for 3-5 minutes, 95% ethanol for 3 minutes, 95% ethanol for 3 minutes, anhydrous ethanol solution 1 for 3 minutes, anhydrous ethanol solution 2 for 3 minutes, anhydrous ethanol:xylene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and then thoroughly cleared in xylene solution 2 for about 5 minutes. After removal, it is stained with xylene-benzene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and then thoroughly cleared in xylene solution 2 for about 5 minutes. Before the xylene has fully evaporated, it is mounted with neutral resin. 13) Microscopic observation: Under a microscope, the presence of obvious brownish-yellow staining in the cytoplasm indicates a positive result; the absence of obvious brownish-yellow staining indicates a negative result.

[0141] 2.4 Viremia was determined by PCR detection of PCV2d virus in serum. 1) Primer and probe sequences: The following specific primers and probes were used for PCR detection of PCV2d virus.

[0142] P1: 5'-AAATCTCATCATGTCCACATT-3' (SEQ ID No. 9)

[0143] P2: 5'-GTTACCGCTGGAGAAGGAAAA-3' (SEQ ID No. 10)

[0144] Probe sequence: 5'-FAM-TTCAACACCCGCCTCTCCCGCA-BHQ1-3' (SEQ ID No. 11)

[0145] 2) DNA extraction: Blood and serum separation were performed according to the kit instructions to extract DNA.

[0146] 3) The PCR reaction uses a 20ul reaction system: 10μl of Premix Ex Taq™ (2x) and mixed primers (10μmol / L).

[0147] Premix EX Taq 2X 10μl 1 P1 0.4μl 0.2 P2 0.4μl 0.2 probe 0.8μl ROX Reference Dye(50X)*3 0.4μl 1 DNA template 2μl Sterilized water 6μl Total 20μl

[0148] PCR reaction parameters: denaturation at 95℃ for 5 seconds, annealing at 60℃ for 40 seconds, for a total of 40 cycles. A standard curve was prepared using plasmid standards; a value higher than 1000 copies / ml was considered positive, and a value lower than 1000 copies / ml was considered negative.

[0149] 2.5 Immunopotency Test Results

[0150] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever, and no redness or swelling appeared at the injection site. Specific antibody detection and challenge protection results are shown in Table 2. The results in Table 2 indicate that 14 days after the second immunization, the PCV2 ELISA antibody level was significantly different from that of PCV2d monotherapy and commercial vaccines (P < 0.05); the triple vaccine significantly increased antibody levels compared to monotherapy and commercial vaccines (P < 0.05), with a 5 / 5 challenge protection rate for the triple vaccine, while the PCV2b monotherapy and commercial vaccines had a 4 / 5 challenge protection rate. Simultaneously, serum γ-interferon levels were measured 14 days after the second immunization. Figure 8 The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine and commercial vaccine (P < 0.01); there was no significant difference in the level of interferon-gamma between the single vaccine and commercial vaccine (P > 0.05).

[0151] Table 2. Immunopotency Test of PCV2d

[0152]

[0153] Note: A "-" indicates a viral nucleic acid load of no more than 1000 copies / ml, which is considered negative; a "+" indicates a viral nucleic acid load of more than 1000 copies / ml, which is considered positive.

[0154] The relative daily weight gain before and after challenge is indicated by “-”, which means that the relative daily weight gain is not significantly different from that of the control pigs (P < 0.05), and “+”, which means that the relative daily weight gain is significantly different from that of the control pigs (P > 0.05).

[0155] Immunohistochemistry "-" indicates no fluorescence was detected, meaning no PCV2d virus was detected. "+" indicates that fluorescence was detected, meaning PCV2d virus was present.

[0156] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0157] 3.PCV3

[0158] 3.1 Vaccine Immunization and Challenge Procedures

[0159] This experiment involved 20 animals, divided into 4 groups of 5 each. Group C1 was immunized with a triple inactivated vaccine, Group C2 with a PCV3 monotherapy vaccine, Group C3 was a non-immunized control group challenged with the virus, and Group C4 was a non-immunized, non-challenged control group. The immunization dose was 2 ml, administered twice. Fourteen days after the second immunization, Groups C1 (triple inactivated vaccine), C2 (PCV3 monotherapy), and C3 (non-immunized, challenged control group) were challenged with the PCV3 test virus strain PCV3-DC23, injected with 10 ml of the virus. 6.0 TCID 50 8 ml of porcine circovirus PCV3-DC23 strain was administered (4 ml intramuscularly and 4 ml intranasally). Each group was isolated and observed. On days 4 and 7 post-challenge, pigs in groups C1, C2, and C3 were inoculated at four points (two axillae and two buttocks) with Freund's incomplete adjuvant emulsified keyhole hemocyanin (KLH / ICFA, 0.5 mg / ml), 1 ml at each point (4 ml / pig). Simultaneously, 10 ml / pig was intraperitoneally inoculated with thioglycolic acid medium. On days 11 and 19 post-challenge, pigs were again intraperitoneally inoculated with thioglycolic acid medium, 10 ml / pig. Pigs were observed continuously for 25 days post-challenge. On day 25, all piglets in groups C1, C2, C3, and C4 were weighed, and blood was collected from infected piglets. Serum was separated, and the PCV3 viral nucleic acid load in the serum was detected. Infected piglets were culled, and inguinal lymph nodes were collected for PCV3 antigen detection using immunohistochemical methods. The diagnosis is based on the results of viremia (viral nucleic acid load), relative daily weight gain, and inguinal lymph node viral antigen testing. The presence of any two or three of these indicators indicates disease.

[0160] 3.2 Relative daily weight gain

[0161] On the day of challenge and 25 days after challenge, the body weight of each group of experimental pigs was measured. The relative daily weight gain of each group of experimental pigs within 25 days after challenge was calculated. If the relative daily weight gain of the challenged group of experimental pigs was lower than that of the blank control group and the difference was significant (P<0.05), the experimental pigs in that group were judged to have poor growth and development and all had clinical symptoms.

[0162] Relative daily weight gain = (Weight 25 days after infection - Weight on the day of infection) / Weight on the day of infection / 25

[0163] Relative weight gain rate (%) = (Average daily weight gain of piglets in the blank control group - Average daily weight gain of piglets in the challenge experiment) / Average daily weight gain of piglets in the blank control group * 100

[0164] 3.3 Viral antigen detection was performed using immunohistochemistry.

[0165] 1) Sampling and Sample Fixation: After bloodletting from the animal's carotid artery, quickly collect inguinal lymph node tissue, immerse it in a 2.5% glutaraldehyde-paraformaldehyde mixture, and fix it for 8–12 hours. Trim the fixed tissue into appropriately sized blocks. The knife used for trimming should be sharp, and it is best to make a single cut to form a row, avoiding back-and-forth sawing.

[0166] 2) Tissue Dehydration, Clearing, and Embedding: Remove the fixed tissue, make minor adjustments, and place it in a dehydration basket. Dehydrate using a gradient of alcohols: 75% ethanol for 2 hours, 85% ethanol for 2 hours, 95% ethanol for 1-2 hours, anhydrous ethanol for approximately 30 minutes, and anhydrous ethanol:xylene (1:1) for approximately 30 minutes. Then, immerse the dehydrated tissue in xylene solution 1 and xylene solution 2 until completely clear (generally no more than 20 minutes). After removal, permeate the tissue in old wax at 60℃ for 40 minutes, then permeate it in the embedding machine's wax tanks 1 and 2 for 40 minutes each. After permeation, embed the tissue in old wax.

[0167] 3) Treatment of slides and coverslips: Soak new slides and coverslips in acid overnight, wash them thoroughly with distilled water, then blot them with deionized water, and dry them in an oven for later use.

[0168] 4) When preparing tissue sections, the thickness should not exceed 5 μm. After fully spreading the cut tissue in a 42°C water bath, mount it onto a glass slide. After mounting, lay it flat for a period of time to prevent the tissue from slipping off, and then place it on a staining rack and bake it overnight at 60°C. The processed tissue sections can be stored at 2-8°C.

[0169] 5) Dewaxing and hydration: Immerse the tissue array in xylene for 10 minutes, then replace the xylene and immerse for another 10 minutes; then in a xylene:ethanol (1:1) solution for 5 minutes; then immerse in anhydrous ethanol 1 for 5 minutes, then replace with anhydrous ethanol 2 and immerse for another 5 minutes; immerse in 95% ethanol for 3 minutes; immerse in 85% ethanol for 3 minutes, then immerse in 75% ethanol for 3 minutes, then replace with 75% ethanol and immerse for another 5 minutes. Rinse three times with PBS (0.01 mol / L, pH 7.4), 5 minutes each time.

[0170] 6) Blocking endogenous peroxidase: Add 100 μL of 3% H2O2 solution to each cleaned tissue section and block at room temperature for 20 minutes. Do not allow the tissue sections to dry completely, otherwise false positives may occur.

[0171] 7) Antigen retrieval: Heat sodium citrate buffer (0.01 mol / L, pH 6.0, containing 3 g of trisodium citrate and 0.4 g of citric acid per 1000 ml) to 97°C in a microwave oven. Place the tissue sections in the buffer and continue to maintain the temperature at 97°C in the microwave oven for 10-20 minutes. After removing the sections, allow them to cool naturally to room temperature. Then wash them three times with PBS (0.01 mol / L, pH 7.4), each time for 5 minutes.

[0172] 8) Blocking: Add 1.5% BSA blocking solution dropwise to the tissue, 50 μL / piece, and block at 37°C for 25-30 minutes.

[0173] 9) PCV3 antibody incubation: After diluting the PCV3 monoclonal antibody 1:100, add 50 μL to each tissue slide and incubate in a humidified chamber at 37°C for 1 hour. Wash with PBS (0.01 mol / L, pH 7.4) 3-5 times, 5 min each time.

[0174] 10) HRP-goat anti-mouse IgG was diluted 1:100 with PBS (0.01mol / l, pH 7.4), and 50ul was added to each tissue sample. The sample was incubated at 37°C for 1 hour and then washed with PBS (0.01mol / l, pH 7.4) 3-5 times for 5 minutes each time.

[0175] 11) DAB staining: Blot dry the PBS around the tissue slides, add 50 μL of DAB staining solution to each tissue slide, and incubate at room temperature. The specific staining time can be determined under a microscope. Stop the staining with distilled water. After staining, soak the tissue slides in PBS (0.01 mol / L, pH 7.4) for 10 min to prevent the background from being too dark.

[0176] 12) After staining, the tissue was stained with hematoxylin for about 7 minutes, then rinsed with distilled water, separated with 1% color alcohol, and then bluing. Then it was dehydrated with a gradient of alcohols, namely 75% ethanol for 3-5 minutes, 85% ethanol for 3-5 minutes, 95% ethanol for 3 minutes, 95% ethanol for 3 minutes, anhydrous ethanol solution 1 for 3 minutes, anhydrous ethanol solution 2 for 3 minutes, anhydrous ethanol:xylene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and xylene solution 2 for 5 minutes until fully transparent. After removing it, xylene:benzene (1:1) for 5 minutes, xylene solution 1 for 5 minutes, and xylene solution 2 for about 5 minutes until fully transparent. Before the xylene has completely evaporated, it was mounted with neutral resin.

[0177] 13) Microscopic observation: Under a microscope, the presence of obvious brownish-yellow staining in the cytoplasm indicates a positive result, while the absence of obvious brownish-yellow staining indicates a negative result.

[0178] 3.4 Viremia was determined by PCR detection of PCV3 virus in serum.

[0179] 1) Primer and probe sequences: The following specific primers and probes were used for PCR detection of PCV3 virus.

[0180] P1: 5'-AGGAGACGACGACGCCACAG-3' (SEQ ID No. 12)

[0181] P2: 5'-TTATTATCCTGAGGGGTTC-3' (SEQ ID No. 13)

[0182] Probe sequence: 5'-FAM-TATGCCAGGAGAAGACTATTCATT-BHQ1-3' (SEQ ID No. 14)

[0183] 2) DNA extraction: Blood and serum separation were performed according to the kit instructions to extract DNA.

[0184] 3) The PCR reaction uses a 20ul reaction system: 10μl of Premix Ex Taq™ (2x) and mixed primers (10μmol / L).

[0185]

[0186]

[0187] PCR reaction parameters: denaturation at 95℃ for 5 seconds, annealing at 60℃ for 40 seconds, for a total of 40 cycles. A standard curve was prepared using plasmid standards; a value higher than 1000 copies / ml was considered positive, and a value lower than 1000 copies / ml was considered negative.

[0188] 3.5 Immunopotency Test Results

[0189] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever, and no redness or swelling appeared at the injection site. Specific antibody detection and challenge protection results for the experimental animals are shown in Table 3. The results in Table 3 indicate that 14 days after the second immunization, the PCV2 ELISA antibody level was significantly higher than that of the PCV3 monotherapy (P < 0.05); challenge protection showed 5 / 5 protection with the triple inactivated vaccine and 4 / 5 protection with the PCV Cap3 monotherapy. Simultaneously, serum gamma interferon levels were measured 14 days after the second immunization. Figure 9 The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine (P < 0.01).

[0190] Table 3. PCV3 Immunopotency Test

[0191]

[0192] Note: A "-" indicates a viral load of no more than 1000 copies / ml, which is considered negative; a "+" indicates a viral load of more than 1000 copies / ml, which is considered positive.

[0193] The relative daily weight gain before and after challenge is indicated by “-”, which means that the relative daily weight gain is not significantly different from that of the control pigs (P < 0.05), and “+”, which means that the relative daily weight gain is significantly different from that of the control pigs (P > 0.05).

[0194] Immunohistochemistry "-" indicates no fluorescence was detected, meaning no PCV3 virus was detected. "+" indicates that fluorescence was detected, meaning PCV3 virus was present.

[0195] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0196] 4Mhp

[0197] 4.1 Vaccine Immunization

[0198] This experiment consisted of four groups of five piglets each. Group D1 received a trivalent inactivated vaccine, Group D2 received a single MHP vaccine, Group D3 received a bivalent commercial circovirus vaccine, and Group D4 was a control group that was challenged without immunization. The immunization dose was 2 ml, administered twice. Fourteen days after the second immunization, all piglets were injected intratracheally with MHP-DC-XJ2018 strain, 5 ml / pig (100 MID). After challenge, the piglets were observed for 28 days, and then euthanized. Lung lesions in each piglet were scored using a 28-point scoring system. Antibiotics were contraindicated in all piglets during the experiment.

[0199] 4.2 Scoring criteria for porcine mycoplasmal pneumonia lesions

[0200] The scoring criteria for porcine mycoplasmal pneumonia lesions (based on a 28-point scoring method) quantifies the lesion area by the percentage of specific lesions in each lung lobe (left apical lobe, left cardiac lobe, left diaphragmatic lobe, right apical lobe, right cardiac lobe, right diaphragmatic lobe, and accessory lobe (intermediate lobe)) relative to the total area of ​​each lobe. No pneumonia lesions in any lung lobe are scored as 0 points; lesions covering 1%–25% of the lobe area are scored as 1 point; lesions covering 26%–50% of the lobe area are scored as 2 points; lesions covering 51%–75% of the lobe area are scored as 3 points; and lesions covering more than 75% of the lobe area are scored as 4 points. The highest possible score for each lung lobe is 4 points, with a maximum score of 28 points for lesions in all seven lobes. If lesions are present on both sides of a lung lobe, the side with the larger lesion area is scored.

[0201] 4.3 Immunopotency Test Results

[0202] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever. No redness or swelling appeared at the injection site. The specific antibody levels and challenge protection results of the experimental animals after immunization are shown in Table 4. Table 4 shows that 14 days after the second immunization, the MHP ELISA antibody level was significantly different from that of the MHP monotherapy (P < 0.05); the triple inactivated vaccine significantly increased antibody levels compared to the commercial vaccine (P < 0.01). The protection rate after MHP challenge with the triple inactivated vaccine was 5 / 5, while the protection rates with both the MHP monotherapy and the commercial vaccine were 4 / 5. Serum gamma interferon levels were also measured 14 days after the second immunization. Figure 10 The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine and commercial vaccine (P < 0.01); there was no significant difference in the level of interferon-gamma between the single vaccine and commercial vaccine (P > 0.05).

[0203] Table 4. MHP Immunopotency Test

[0204]

[0205] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0206] 5Ery SpaA-DC1-IL1

[0207] This experiment consisted of four groups: Group E1 was the trivalent inactivated vaccine immunization group, Group E2 was the SpaA-DC1 single vaccine immunization group, Group E3 was the commercial inactivated swine erysipelas vaccine, and Group E4 was the non-immunized challenge control group. Each group consisted of five piglets, with an immunization dose of 2 ml, administered twice. Challenge was performed 14 days after the second immunization. All experimental pigs were injected intramuscularly into the neck with a highly virulent strain of *Erysipelothrix rhusiopathiae* type 1 in the logarithmic growth phase. The challenge dose was 2 ml (2 × 10⁻⁶). 8 CFU Ery-DC-1), antibiotics are prohibited in all piglets during the feeding process.

[0208] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever, and no redness or swelling appeared at the injection site. Meanwhile, the results in Table 5 show that 14 days after the second immunization, the ELISA antibody levels of the trivalent vaccine were significantly different from those of the SpaA-DC1 monotherapy vaccine (P < 0.05); the antibody levels of the trivalent inactivated vaccine were significantly higher than those of the commercial inactivated swine erysipelas vaccine (P < 0.01). The protection against challenge with the trivalent inactivated vaccine, the SpaA-DC1-IL1 monotherapy vaccine, and the commercial inactivated swine erysipelas vaccine were all 5 / 5, while the protection against challenge with the control vaccine was 0 / 5. Serum levels of interferon-gamma were also measured 14 days after the second immunization. Figure 11The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine and the commercial vaccine (P < 0.01); the single vaccine significantly increased the level of interferon-gamma compared with the commercial vaccine (P < 0.01).

[0209] Table 5. Ery Immunopotency Test

[0210]

[0211] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0212] 6Ery SpaA-DC2-TH2

[0213] This experiment consisted of four groups: F1 was the trivalent inactivated vaccine immunization group, F2 was the SpaA-DC2-TH2 single vaccine immunization group, F3 was the commercial inactivated swine erysipelas vaccine group, and F4 was the non-immunized challenge control group. Each group contained five piglets, with an immunization dose of 2 ml, administered twice. Challenge was performed 14 days after the second immunization. All experimental pigs were injected intramuscularly into the neck with a highly virulent strain of *Erysipelothrix rhusiopathiae* type 2 in the logarithmic growth phase. The challenge dose was 2 ml (2 × 10⁻⁶ ml). 8 CFU Ery-DC-2), antibiotics are prohibited in all piglets during the feeding process.

[0214] After immunization, none of the piglets showed adverse clinical symptoms such as decreased appetite, lethargy, or fever, and no redness or swelling appeared at the injection site. Meanwhile, the results in Table 6 show that 14 days after the second immunization, the ELISA antibody level of the trivalent inactivated vaccine was significantly different from that of the SpaA-DC2-TH2 monotherapy (P < 0.01); the antibody level of the trivalent inactivated vaccine was significantly higher than that of the commercial inactivated swine erysipelas vaccine (P < 0.01). The protection against challenge with the trivalent inactivated vaccine, the SpaA-DC2-TH2 monotherapy, and the commercial inactivated swine erysipelas vaccine were all 5 / 5, indicating that both the trivalent inactivated vaccine and the monotherapy had good immunizing effects. Simultaneously, serum gamma interferon levels were measured 14 days after the second immunization. Figure 12 The triple vaccine significantly increased the level of interferon-gamma compared with the single vaccine and the commercial vaccine (P < 0.01); the single vaccine significantly increased the level of interferon-gamma compared with the commercial vaccine (P < 0.01).

[0215] Table 6. Ery Immunopotency Test

[0216]

[0217] Note: Data were analyzed using a two-way ANOVA. P < 0.05 indicates a significant difference, P < 0.01 indicates a highly significant difference, and P > 0.05 indicates no significant difference.

[0218] The results of the above-mentioned immune challenge experiments show that this trivalent inactivated vaccine can resist challenges from virulent strains of porcine circovirus type 2b, porcine circovirus type 2d, porcine circovirus type 3, Mycoplasma hyopneumoniae, swine erysipelas type 1, and swine erysipelas type 2, demonstrating excellent protective efficacy. Furthermore, the antibody levels of this trivalent inactivated vaccine were significantly (P < 0.05) or highly significantly (P < 0.01) higher than those of the individual single vaccines; and significantly (P < 0.05) or highly significantly (P < 0.01) higher than those of commercial vaccines. Simultaneously, the levels of interferon-gamma in serum were measured 14 days after the second immunization. The trivalent vaccine showed a highly significantly higher level of interferon-gamma compared to the individual component vaccines and commercial vaccines (P < 0.01); specifically, the SpaA-DC1-IL1 and SpaA-DC2-TH2 single vaccine groups showed a highly significantly higher level of interferon-gamma compared to the commercial vaccine (P < 0.01). Compared to single vaccines or commercial vaccines, this trivalent vaccine demonstrates a higher protection rate against viral challenge. The above results indicate that the six antigenic components of the triple vaccine are highly compatible and do not interfere with each other. Furthermore, the combination of these six antigens can mutually promote each other, increasing the production levels of their corresponding antibodies. Antigens SpaA-DC1-IL1 and SpaA-DC2-TH2 induce humoral immunity while also enhancing cellular immunity. Activated cytokines act as molecular adjuvants, promoting the increase of antibodies in the other four components. Under the combined effect of cellular and humoral immunity, the triple vaccine improves antibody levels and the protection rate against viral challenge.

[0219] sequence

[0220] SEQ ID NO.1 PCV2b Cap gene sequence

[0221] ATGACTTACCCAAGACGCAGATACAGACGCAGAAGACACAGACCAAGATCCCACCTGGGTCAGATCCTGAGACGCAGACCATGGCTGGTGCACCCAAGACACAGATACAGATGGAGAAGAAAGAACGGTATCTTCAACACTAGACTGTCCCGCACTTTCGGTTACACTATCAAGAGAACTACTGTGAAGACTCCACCATGGGCTGTGGACATGATGAGATTCAACATCAACGACTTCCTGCCACCTGGTGGAGGTTCCAACCCAAGATCCGTGCCATTCGAGTACTACAGAATCAGAAAGGTGAAGGTGGAGTTCTGGCCATGCTCCCCAATCACTCAAGGTGACAGAGGTGTGGGTTCCTCCGCTGTGATCCTGGACGACAACTTCGTGACTAAGGCTACTGCTCTGACTTACGACCCATACGTGAACTACTCCTCCCGCCACACTATCACTCAGCCATTCTCCTACCACTCCCGCTACTTCACTCCAAAGCCAATCCTGGACTCCACTATCGACTACTTTCAGCCAAACAACAAGAGAAATCAGCTGTGGCTGAGACTGCAGACTGCTGGTAACGTGGACCACGTGGGTCTGGGTACTGCTTTCGAGAACTCCATCTACGACCAAGAGTACAACATCAGAGTGACTATGTACGTGCAGTTCAGAGAGTTCAACCTGAAGGACCCACCACTGAACCCATAA

[0222] SEQ ID NO. 2 PCV2d Cap Gene Sequence

[0223] ATGACTTATCCTCGCCGTCGCTTTCGCCGCCGTCGTCATCGTCCTCGTTCCCATCTGGGTCAGATTCTGCGTCGCCGTCCTTGGCTGGTTCATCCTCGTCATCGTTATCGTTGGCGTCGCAAAAATGGTATTTTCAACACCCGCCTGTCCCGCACCATCGGTTACACTGTGAAAAAGACCACCGTGCGCACCCCTTCCTGGAACGTGGATATGATGCGCTTCAACATCAACGACTTCCTGCCTCCTGGTGGTGGTTCCAACCCTCTGACTGTGCCTTTCGAGTACTACCGCATCCGCAAGGTGAAGGTGGAGTTCTGGCCTTGCTCCCCTATCACCCAGGGTGACCGTGGTGTGGGTTCCACTGCTGTTATTCTGGACGACAACTTCGTGACCAAGGCTAACGCTCTGACCTACGACCCTTACGTGAACTACTCCTCCCGCCACACCATCACCCAGCCTTTTTCCTACCACTCCCGCTACTTCACCCCTAAGCCTGTGCTGGACCGCACCATTGACTACTTCCAGCCTAACAACAAGCGCAACCAGCTGTGGCTGCGCCTGCAAACTACTGGTAACGTGGATCACGTGGGTCTGGGCACCGCTTTCGAAAACTCCATCTACGACCAGGACTACAACATCCGCATCACCATGTACGTGCAGTTCCGCGAGTTCAACCTGAAGGACCCTCCTCTGAACCCTAAGTAA

[0224] SEQ ID NO: 3 PCV3 Cap3 gene sequence

[0225] ATGAGACACAGAGCTATCTTCAGACGCAGACCAAGACCAAGACGCAGACGCAGACACAGACGCAGATACGCTAGACGCAGACTGTTCATCAGAAGACCAACTGCTGGTACTTACTACACTAAGAAGTACTCCACTATGAACGTGATCTCCGTGGGTACTCCACAAGACAACAAGCCATGGCACGCTAACCACTTCATCACTAGACTGAACGAGTGGGAGACTGCTATCTCCTTCGAGTACTACAAGATCCTGAAGATGAAGGTGACTCTGTCCCCTGTGATCTCCCCTGCTCAGCAGACTAAGACTATGTTCGGTCACACTGCTATCGACCTGGACGGTGCTTGGACTACTAACACTTGGCTGCAAGACGACCCATACGCTGAGTCCTCCACTAGAAAGGTGATGACTTCCAAGAAAAAGCACTCCCGCTACTTCACTCCAAAGCCAATCCTGGCTGGTACTACTTCCGCTCACCCTGGTCAGTCCCTGTTCTTTTTCTCCCGCCCAACTCCATGGCTGAACACTTACGACCCAACTGTGCAGTGGGGTGCTCTGCTGTGGTCCATCTACGTGCCTGAGAAGACTGGTATGACTGACTTCTACGGTACTAAAGAGGTGTGGATCAGATACAAGTCCGTGCTGTAATAA

[0226] SEQ ID NO. 4 SpaA-DC1-IL1 Gene Sequence

[0227]

[0228] SEQ ID NO.5 SpaA-DC2-TH2 gene sequence

[0229]

[0230] SEQ ID NO.6PCV2b P1SECTION

[0231] 5'-GAATCTCATCATGTCCACCGC-3'

[0232] SEQ ID NO.7PCV2b P2 SECTION

[0233] 5'-GTTACCGCTGGAGAAGGAAAA-3

[0234] SEQ ID NO.8PCV2b probe

[0235] 5′-FAM-TTCAACACCCGCCTCTCCCGCA-BHQ1-3′

[0236] SEQ ID NO.9PCV2d P1 SECTION

[0237] 5'-AAATCTCATCATGTCCACATT-3'

[0238] SEQ ID NO.10PCV2d P2 SECTION

[0239] 5'-GTTACCGCTGGAGAAGGAAAA-3

[0240] SEQ ID NO.11PCV2d probe

[0241] 5′-FAM-TTCAACACCCGCCTCTCCCGCA-BHQ1-3′

[0242] SEQ ID NO.12PCV3 P1SECTION

[0243] 5'-AGGAGACGACGACGCCACAG-3

[0244] SEQ ID NO.13PCV3 P2 SECTION

[0245] 5'-TTATTATCCTGAGGGGTTC-3'

[0246] SEQ ID NO.14PCV3 probe

[0247] 5′-FAM-TATGCCAGGAGAAGACTATTCATT-BHQ1-3′

[0248] The above description is merely the preferred embodiment of the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A trivalent inactivated vaccine against porcine circovirus types 2b and 2d, porcine circovirus type 3, Mycoplasma hyopneumoniae, and swine erysipelas types 1 and 2, wherein the vaccine comprises PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, swine erysipelas SpaA-DC1-IL1 antigen, and swine erysipelas SpaA-DC2-TH2 antigen, wherein the concentrations of PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, swine erysipelas SpaA-DC1-IL1 antigen, and swine erysipelas SpaA-DC2-TH2 antigen are 20 μg / ml, respectively, 40 μg / ml, 25 μg / ml, and 25 μg / ml, and wherein the vaccine further comprises an adjuvant.

2. The trivalent inactivated vaccine according to claim 1, wherein the PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, erysipelas SpaA-DC1-IL1 antigen, and erysipelas SpaA-DC2-TH2 antigen are inactivated antigens.

3. The trivalent inactivated vaccine according to claim 1, wherein the polynucleotide sequence encoding the PCV2b Cap antigen is shown in SEQ ID NO: 1, the polynucleotide sequence encoding the PCV2d Cap antigen is shown in SEQ ID NO: 2, the polynucleotide sequence encoding the PCV3 Cap3 antigen is shown in SEQ ID NO: 3, the polynucleotide sequence encoding the porcine erysipelas SpaA-DC1-ILI antigen is shown in SEQ ID NO: 4, and the polynucleotide sequence encoding the porcine erysipelas SpaA-DC2-TH2 antigen is shown in SEQ ID NO:

5.

4. The trivalent inactivated vaccine according to claim 1, wherein the adjuvant is a biphasic adjuvant or a water-soluble adjuvant.

5. The trivalent inactivated vaccine according to claim 1, wherein the adjuvant is ISA201, ISA206, Gel02RP, IMS1313 or IMS7749.

6. The trivalent inactivated vaccine according to claim 1, wherein the adjuvant is Gel02RP.

7. The trivalent inactivated vaccine according to claim 1, wherein the volume ratio of the adjuvant to the total amount of antigen is 1:9 to 9:

1.

8. The trivalent inactivated vaccine according to claim 1, wherein the volume ratio of the adjuvant to the total amount of antigen is 1:

9.

9. The trivalent inactivated vaccine according to any one of claims 1-8, wherein the vaccine comprises: (1) The content of the PCV2b Cap antigen is ≥40μg / dose; (2) The content of the PCV2d Cap antigen is ≥40μg / dose; (3) The content of the PCV3 Cap3 antigen is ≥40μg / dose; (4) The content of Mycoplasma pneumoniae Mhp antigen in the pig is ≥80μg / dose; (5) The content of the SpaA-DC1-IL1 antigen in the porcine erysipelas is ≥40μg / dose; (6) The content of the SpaA-DC2-TH2 antigen in the porcine erysipelas is ≥40μg / dosage.

10. A method for preparing a trivalent inactivated vaccine according to any one of claims 1-9, comprising: The protein sequences of the PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, porcine erysipelas SpaA-DC1-IL1 antigen, and porcine erysipelas SpaA-DC2-TH2 antigen were isolated, and the polynucleotide sequences encoding the protein sequences were codon-optimized and expressed in host cells to obtain the corresponding antigens. Mycoplasma hyopneumoniae was isolated and cultured, centrifuged, the bacterial cells were broken and inactivated to obtain Mycoplasma hyopneumoniae Mhp antigen.

11. The preparation method according to claim 10, wherein the obtained PCV2b Cap antigen, PCV2d Cap antigen, PCV3 Cap3 antigen, Mycoplasma hyopneumoniae Mhp antigen, erysipelas SpaA-DC1-IL1 antigen and erysipelas SpaA-DC2-TH2 antigen are inactivated and then mixed with an adjuvant to obtain the triple inactivated vaccine.

12. The use of the trivalent inactivated vaccine according to any one of claims 1-9 in the preparation of a medicine for preventing porcine circovirus 2b, porcine circovirus 2d, porcine circovirus 3, mycoplasma hyopneumoniae, and swine erysipelas.

Citation Information

Patent Citations

  • Polypeptide and application thereof

    CN106810603A

  • PCV2 (porcine circovirus type 2) baculovirus vector, mycoplasma hyopneumoniae and haemophilus parasuis inactivated trivalent vaccine and preparation method

    CN112294953A

  • Swine erysipelas rSpaA-Fc fusion protein and application thereof in vaccine

    CN115926000A

  • Porcine circovirus, mycoplasma hyopneumoniae and porcine Seneca virus triple inactivated vaccine as well as preparation method and application thereof

    CN116036260A