Recombinant lactic acid bacteria and application thereof in prevention and treatment of african swine fever
Patent Information
- Application Number
- CN202410635152.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-21
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2044-05-21
AI Technical Summary
总而言之,ASFV的复杂性、高度遗传变异性以及强大的生存能力使得开发有效的防治措施极具挑战
[0021]Specifically, this invention, by displaying ASFV antigens on the surface of these recombinant *Lactobacillus plantarum*, can directly deliver antigens to the host's immune system, particularly by using CTB as an adjuvant to enhance the host's immune response to these antigens. This method can induce an immune response at the mucosal level, and is particularly effective against pathogens transmitted via the mucosal route. The recombinant *Lactobacillus plantarum* of this invention is selected using non-antibiotic resistance markers, such as the asd-alr fusion gene, reducing the risk of antibiotic resistance gene transmission in the environment and enhancing biosafety. As a mucosal delivery vector, the recombinant *Lactobacillus plantarum* of this invention can effectively deliver antigens to the mucosal immune system, promoting the generation of mucosal immune responses, which is particularly important for preventing pathogens transmitted through the respiratory and digestive tracts. The recombinant *Lactobacillus plantarum* of this invention can promote a bidirectional response of cellular and humoral immunity in the host, increasing the production of specific antibodies, such as IgA and IgG, thereby enhancing the overall defense against pathogens. Furthermore, the combined use of recombinant *Lactobacillus plantarum* expressing different ASFV antigens as described in this invention can produce a combined immune effect, significantly inducing the host's immune response; the multi-strain strategy has a better immunoprotective effect than a single strain. Furthermore, the fusion gene of the present invention can simplify the later purification and detection process of the fusion protein by adding a His-tag, which can facilitate the production and quality control of vaccines.
Smart Images

Figure CN118497236B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant lactic acid bacteria and its application in the prevention and control of African swine fever. Background Technology
[0002] Any discussion of prior art throughout the specification should not be construed as an admission that such prior art is well-known or constitutes part of common general knowledge in the art.
[0003] African swine fever (ASF) is a highly lethal infectious disease caused by the African swine fever virus (ASFV), posing a significant threat to the global pig farming industry. Due to the large and complex genome of ASFV, the functions of most genes are not yet fully understood, which greatly hinders the understanding of its immune mechanisms and the development of effective drugs and vaccines. Currently, no effective drugs or vaccines have been developed to prevent or treat ASF, making the control and prevention of this virus exceptionally difficult. ASFV exhibits significant genetic diversity and strong survival capabilities, resisting extreme temperatures, pH levels, and chemical agents. Its infection process is divided into early, middle, and late stages, primarily expressing proteins related to viral replication and particle structure, and releasing viral particles through cell membrane budding. These characteristics of the virus, coupled with frequent genetic mutations, lead to the diversity of viral strains, resulting in varied clinical symptoms in infected animals and making timely diagnosis difficult. ASF has diverse transmission routes, including not only major hosts such as domestic pigs and wild boars, but also blood-sucking insects such as soft ticks and mosquitoes, and potentially non-major hosts such as leeches. ASFV DNA can be detected in the bodily fluids of infected animals and in contaminated soil samples. The detection of the virus in various internal organs and tissues, and its long-term survival in some hosts, further complicates ASF control. Current vaccine development faces significant challenges. Inactivated vaccines have failed to provide effective protection against ASFV infection, possibly due in part to the complexity and high variability of ASFV. Although studies have attempted to develop inactivated vaccines by treating ASFV with glutaraldehyde, detergents, or diethyleneimine (BEI), these methods have failed to achieve the expected protective effects. Meanwhile, subunit vaccines based on specific ASFV proteins (such as p54, p30, and p72) and improved DNA vaccine construction strategies have shown some protective potential, but have not yet completely prevented infection. Attenuated vaccine research has also made some progress, developing vaccines through continuous passage in vitro or in non-host animals and by deleting genes associated with viral pathogenicity (such as 9GL, UK, CD2v, DP148R, and MGFs). These strategies have shown some immune effects in animal models, but safety and stability remain key issues that need to be addressed. In conclusion, the complexity, high genetic variability, and strong survivability of ASFV make the development of effective prevention and control measures extremely challenging. Summary of the Invention
[0004] The main challenges in developing traditional ASF vaccines include vaccine safety, consistency and durability of immune efficacy, and production costs. To address these shortcomings, this invention provides a fusion gene and constructs a recombinant lactic acid bacterium containing and expressing this fusion gene. This recombinant lactic acid bacterium can be used to produce a vaccine against ASF, and it serves as a live vector to express the ASFV antigen fusion protein. Immunizing animals with this vaccine not only effectively induces specific cellular and humoral immune responses, but also, through oral administration, allows the recombinant lactic acid bacterium to directly contact the host's mucosal immune system, promoting mucosal immune responses and thus enhancing overall defense against African swine fever virus. Furthermore, the live vector vaccine of this invention is also safe and environmentally friendly.
[0005] Specifically, the present invention provides the following technical solution:
[0006] In a first aspect of the invention, a fusion gene is provided, comprising: a gene encoding a cholera toxin B subunit (CTB) and at least one gene selected from the following: a gene encoding a p49 protein, a gene encoding a p22 protein, a gene encoding a K205R protein, a gene encoding an A137R protein, and a protein encoding an E248R protein. In embodiments of the invention, the nucleotide sequence of the gene encoding CTB is shown in SEQ ID NO:1; the nucleotide sequence of the gene encoding p49 protein is shown in SEQ ID NO:2; the nucleotide sequence of the gene encoding p22 protein is shown in SEQ ID NO:3; the nucleotide sequence of the gene encoding K205R protein is shown in SEQ ID NO:4; the nucleotide sequence of the gene encoding A137R protein is shown in SEQ ID NO:5; and the nucleotide sequence of the gene encoding E248R protein is shown in SEQ ID NO:6.
[0007] In some embodiments of the present invention, the fusion gene is obtained by fusing a gene encoding the adjuvant CTB with genes encoding proteins p49, p22, K205R, A137R, and E248R, respectively. In some embodiments of the present invention, the fusion gene may contain a gene encoding a His-tag. In some embodiments of the present invention, the fusion gene may contain a restriction endonuclease recognition site sequence, such as XbaI and / or HindIII, preferably containing both XbaI and HindIII. In some embodiments of the present invention, the fusion gene may contain a stop codon.
[0008] In some embodiments of the present invention, the gene encoding the cholera toxin B subunit (CTB) is linked via a linker to a gene encoding the p49 protein, a gene encoding the p22 protein, a gene encoding the K205R protein, a gene encoding the A137R protein, or a gene encoding the E248R protein, respectively. For example, in one embodiment, the nucleotide sequence of the linker is shown in SEQ ID NO:7. In some embodiments of the present invention, the nucleotide sequence of the fusion gene is selected from the sequences shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12. The fusion gene of the present invention can be obtained using conventional methods; for example, seamless cloning technology is used in some embodiments of the present invention.
[0009] In a second aspect of the invention, a recombinant expression vector is provided, comprising any of the fusion genes described in the first aspect above. For example, in one embodiment of the invention, the recombinant expression vector is a recombinant plasmid comprising any of the fusion genes described in the first aspect above and a vector selected from pET-28a and pSIP409-pgsA'. pET-28a can be used as a plasmid vector for prokaryotic expression of *Escherichia coli*; pSIP409-pgsA' can be used as an expression vector for lactic acid bacteria. In some embodiments of the invention, when the vector is pSIP409-pgsA', the erythromycin resistance gene ErmL in the recombinant plasmid is replaced with a fusion gene of aspartate β-galactose dehydrogenase and alanine racemic enzyme (asd-alr). For example, this can be achieved using IN-Fution technology. The strategy of replacing the erythromycin resistance gene ErmL in the recombinant plasmid with asd-alr aims to avoid the use of antibiotic resistance genes, thereby reducing the risk of resistance genes potentially transferring to other microorganisms in the environment and reducing the spread of antibiotic resistance. This facilitates the creation of safe genetically engineered microorganisms suitable for clinical or food-grade applications. Furthermore, the absence of antibiotic resistance genes increases public acceptance of genetically engineered products, and these modified microorganisms can stably persist in specific auxotrophic hosts without antibiotic screening, thereby reducing production costs.
[0010] In a third aspect of the invention, an engineered bacterium for the prevention and control of African swine fever is provided, comprising any of the fusion genes described in the first aspect above, and capable of expressing and producing an African swine fever virus (ASFV) antigen fusion protein on the bacterial surface. In some embodiments of the invention, the engineered bacterium is a lactic acid bacteria or Escherichia coli as the starting strain. The lactic acid bacteria are preferably Lactobacillus plantarum, more preferably alanine racemase (alr) gene-deficient Lactobacillus plantarum NC8Δalr. In some embodiments of the invention, the engineered bacterium is a recombinant Lactobacillus plantarum, which can be obtained by inserting any of the fusion genes described in the first aspect above into the expression vector pSIP409-pgsA' to form a recombinant plasmid, replacing the ErmL erythromycin resistance gene in the plasmid with asd-alr, amplifying the modified recombinant plasmid by transferring it into asd-deleted Escherichia coli χ6212, and further transferring it into alanine racemase (alr) gene-deficient Lactobacillus plantarum NC8Δalr.
[0011] In a fourth aspect of the invention, an African swine fever virus (ASFV) antigen fusion protein is provided, which is encoded by any of the fusion genes described in the first aspect or expressed by any of the engineered bacteria described in the third aspect.
[0012] In a fifth aspect of the invention, a pharmaceutical composition, pharmaceutical preparation, or feed is provided, comprising at least one ASFV antigen fusion protein as described in the fourth aspect above, or at least one engineered bacterium as described in the third aspect above. In some embodiments of the invention, the engineered bacterium is a lactic acid bacteria as the starting strain, preferably *Lactobacillus plantarum*, more preferably *Lactobacillus plantarum* NC8Δalr, which is deficient in the alanine racemase gene. In some embodiments of the invention, the engineered bacterium is capable of expressing and producing the ASFV antigen fusion protein on its surface.
[0013] For example, in some embodiments of the present invention, the pharmaceutical composition, pharmaceutical preparation or feed may contain any one or a combination of multiple ASFV antigen fusion proteins described in the fourth aspect above.
[0014] For example, in some embodiments of the present invention, the composition comprises one or more engineered bacteria as described in the third aspect above, wherein the engineered bacteria integrate a fusion gene, the fusion gene being obtained by fusing a gene encoding the adjuvant CTB with a gene encoding the p49 protein, a gene encoding the p22 protein, a gene encoding the K205R protein, a gene encoding the A137R protein, and a gene encoding the E248R protein, respectively. For example, in one embodiment, the nucleotide sequence of the fusion gene is as described in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12. For example, in one embodiment, the composition may comprise engineered bacteria (especially lactic acid bacteria) integrating any of the above-described fusion genes or a combination of engineered bacteria (especially lactic acid bacteria) respectively integrating the above-described fusion genes, such as a combination of lactic acid bacteria simultaneously integrating the fusion genes described in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.
[0015] In a sixth aspect of the invention, a live vector vaccine is provided, which uses lactic acid bacteria as a vector and contains any one or more fusion genes described in the first aspect or any one or more expression vectors described in the second aspect. Alternatively, the live vaccine vector contains any one or more engineered bacteria described in the third aspect, wherein the engineered bacteria are lactic acid bacteria as the starting strain. In embodiments of the invention, the lactic acid bacteria are preferably *Lactobacillus plantarum*, and particularly preferably *Lactobacillus plantarum* NC8Δalr, which is deficient in the alanine racemase gene. In some embodiments of the invention, the fusion...
[0016] The gene is obtained by fusing the gene encoding the adjuvant CTB with genes encoding P49 protein, P22 protein, K205R protein, A137R protein, and E248R protein, respectively. In some embodiments of the present invention, the expression vector recombinant plasmid comprises any of the fusion genes described in the first aspect above and a vector of pSIP409-pgsA', wherein the erythromycin resistance gene ErmL in the recombinant plasmid is replaced with asd-alr. In some preferred embodiments of the present invention, the live vector vaccine comprises at least one recombinant *Lactobacillus plantarum*, preferably a combination of multiple recombinant *Lactobacillus plantarum*, for example, the recombinant *Lactobacillus plantarum* contained in the live vector vaccine integrates any one of the fusion genes described in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or a combination of recombinant *Lactobacillus plantarum* integrating any one of the aforementioned fusion genes, particularly a combination of recombinant *Lactobacillus plantarum* integrating the fusion genes described in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 respectively. In some embodiments of the present invention, the live vector vaccine is administered orally. The target of administration is an animal, particularly a pig.
[0017] In a seventh aspect of the invention, a method for obtaining the ASFV antigen fusion protein described in the fourth aspect is provided, comprising: constructing the fusion gene described in the first aspect; inserting the fusion gene into an expression vector to form a recombinant expression vector; the recombinant expression vector may be, for example, as described in the second aspect; transforming the recombinant expression vector into host cells, the host cells being selected from lactic acid bacteria, Escherichia coli, or other microbial cells suitable for protein expression; culturing the transformed host cells to promote the expression of the fusion gene and produce the ASFV antigen fusion protein. Furthermore, the method may further comprise the steps of collecting the ASFV antigen fusion protein from the cultured host cells and isolating and purifying the ASFV antigen fusion protein. In some embodiments of the invention, the purified ASFV antigen fusion protein can be obtained by affinity chromatography, for example, using His-tag.
[0018] In an eighth aspect of the invention, the use of the fusion gene described in the first aspect, the recombinant expression vector described in the second aspect, the engineered bacteria described in the third aspect, the African swine fever virus antigen fusion protein described in the fourth aspect, the pharmaceutical composition, pharmaceutical preparation, or feed described in the fifth aspect, or the live vector vaccine described in the sixth aspect, in the preparation of biological agents, pharmaceuticals, or feeds for the prevention and / or treatment of African swine fever is provided. The biological agent is a vaccine, particularly a live vector vaccine.
[0019] In a ninth aspect of the invention, a method for preventing and treating African swine fever is provided, comprising administering an effective dose of the engineered bacteria described in the third aspect above or the live vector vaccine described in the sixth aspect above to African swine fever-susceptible animals (particularly pigs). The effective dose is sufficient to induce an immune response in the subject, thereby preventing and / or treating African swine fever. The method may be administered by injection, oral administration, or other suitable routes of administration. The specific dosage and frequency of administration are determined by a veterinarian or professional based on the subject's health status, age, weight, and disease severity.
[0020] Compared to existing technologies, the advantages of this invention include: This invention constructs a fusion gene, selecting five antigenic proteins closely related to ASFV infection (p49, p22, K205R, A137R, and E248R, respectively), fusing their encoding genes with the cholera toxin B subunit (CTB), and constructing multiple recombinant *Lactobacillus plantarum* strains using a specific lactic acid bacteria expression vector pSIP409-pgsA'. These recombinant *Lactobacillus plantarum* strains can express and produce specific ASFV fusion antigens that can be anchored on the strain surface. These recombinant *Lactobacillus plantarum* strains can be prepared into live vector vaccines, which can effectively induce and enhance the host's immune response through oral administration or other methods. They also exhibit good biosafety and environmental friendliness, and provide effective prevention against ASFV through mucosal immunity, cellular immunity, and humoral immunity. Furthermore, the responses induced by these recombinant lactic acid bacteria are biased towards the Th1 type, especially the combined strains, which have a stronger ability to induce Th1-type immune responses. Th1 cells can secrete a variety of immune cytokines, such as interferon, which can promote CTL (cytotoxic T lymphocyte) responses, thereby killing viruses. This suggests that recombinant Lactobacillus plantarum expressing ASFV antigen has the potential to kill ASFV.
[0021] Specifically, this invention, by displaying ASFV antigens on the surface of these recombinant *Lactobacillus plantarum*, can directly deliver antigens to the host's immune system, particularly by using CTB as an adjuvant to enhance the host's immune response to these antigens. This method can induce an immune response at the mucosal level, and is particularly effective against pathogens transmitted via the mucosal route. The recombinant *Lactobacillus plantarum* of this invention is selected using non-antibiotic resistance markers, such as the asd-alr fusion gene, reducing the risk of antibiotic resistance gene transmission in the environment and enhancing biosafety. As a mucosal delivery vector, the recombinant *Lactobacillus plantarum* of this invention can effectively deliver antigens to the mucosal immune system, promoting the generation of mucosal immune responses, which is particularly important for preventing pathogens transmitted through the respiratory and digestive tracts. The recombinant *Lactobacillus plantarum* of this invention can promote a bidirectional response of cellular and humoral immunity in the host, increasing the production of specific antibodies, such as IgA and IgG, thereby enhancing the overall defense against pathogens. Furthermore, the combined use of recombinant *Lactobacillus plantarum* expressing different ASFV antigens as described in this invention can produce a combined immune effect, significantly inducing the host's immune response; the multi-strain strategy has a better immunoprotective effect than a single strain. Furthermore, the fusion gene of the present invention can simplify the later purification and detection process of the fusion protein by adding a His-tag, which can facilitate the production and quality control of vaccines. Attached Figure Description
[0022] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. Hereinafter, embodiments of the invention will be described in detail with reference to the accompanying drawings, wherein:
[0023] Figure 1 Western blot analysis was performed on the protein expression of five recombinant Escherichia coli strains: M: 180 kDa protein maker; 1: pET-28a strain; 2: pET-28a-A137R strain; 3: pET-28a-E248R strain; 4: pET-28a-P22 strain; 5: pET-28a-P49 strain; and 6: pET-28a-K205R strain.
[0024] Figure 2Western blot analysis was performed on the protein expression of five novel functional lactic acid bacteria strains: M: 180 kDa protein maker; 1: NC8Δ-pSIP409-pgsA' strain; 2: NC8Δ-pSIP409-pgsA'-E248R strain; 3: NC8Δ-pSIP409-pgsA'-P22 strain; 4: NC8Δ-pSIP409-pgsA'-A137R strain; 5: NC8Δ-pSIP409-pgsA'-K205R strain; and 6: NC8Δ-pSIP409-pgsA'-P49 strain.
[0025] Figure 3 Growth curve of the novel functional lactic acid bacteria described in this invention.
[0026] Figure 4 The activation level of DCs in PPs is shown.
[0027] Figure 5 B220 in PPs is shown + IgA + Changes in cell number.
[0028] Figure 6 The changes in the number of B220+IgA+ cells in MLN are shown.
[0029] Figure 7 The CD4 content in MLNs of mice after triple immunization is shown. + IFN-γ + T cell expression levels.
[0030] Figure 8 The image shows CD4 in Spleen mice after triple immunization. + IFN-γ + T cell expression levels.
[0031] Figure 9 The expression level of CD8+IFN-γ+ T cells in MLNs of mice after triple immunization was shown.
[0032] Figure 10 The image shows CD8 in Spleen mice after triple immunization. + IFN-γ + T cell expression levels.
[0033] Figure 11 The CD4 content in MLNs of mice after triple immunization is shown. + IL-4 + T cell expression levels.
[0034] Figure 12 The image shows CD4 in Spleen mice after triple immunization.+ IL-4 + T cell expression levels.
[0035] Figure 13 The image shows B220 in the duodenum (two columns on the left) and ileum (two columns on the right). + IgA + Cell count.
[0036] Figure 14 The specific SIgA content after three immunizations is shown.
[0037] Figure 15 The levels of specific IgG in mouse serum were shown.
[0038] Figure 16 The levels of specific IgG2a in mouse serum are shown.
[0039] Figure 17 The levels of specific IgG1 in mouse serum are shown.
[0040] Figure 18 The ratio of IgG1 to gG2a is shown.
[0041] Figure 19 The secretion level of the cytokine IFN-γ in mouse peripheral blood was shown.
[0042] Figure 20 The secretion level of the cytokine IL-4 in mouse peripheral blood was shown.
[0043] Figure 21 The secretion level of the cytokine IL-2 in mouse peripheral blood is shown.
[0044] Figure 22 This shows the transcriptional level of the cytokine IFN-γ in the spleen.
[0045] Figure 23 The transcriptional level of the cytokine IL-4 in the spleen was shown.
[0046] Figure 24 The transcriptional level of the cytokine IL-2 in the spleen is shown.
[0047] Figure 25 The transcriptional level of IFN-γ in MLN is shown.
[0048] Figure 26 The transcriptional level of IL-4 in MLN is shown.
[0049] Figure 27 The transcriptional level of IL-2 in MLN is shown. Detailed Implementation
[0050] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. The reagents or raw materials used in this invention are readily available through conventional means, and unless otherwise specified, they are used in accordance with conventional methods or product instructions. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0051] Example 1 Construction of a novel functional lactic acid bacteria expressing five ASFV fusion proteins anchored on the cell wall surface
[0052] In this embodiment, five novel functional lactic acid bacteria strains were constructed using CTB as an adjuvant: NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R. Western blot and immunofluorescence were used to verify the expression of the target proteins in these five strains. Simultaneously, five prokaryotic expression strains, pET-28a-P49, pET-28a-P22, pET-28a-K205R, pET-28a-A137R, and pET-28a-E248R, were constructed, and successful protein expression and purification were verified, preparing for subsequent experiments.
[0053] I. Materials: E. coli χ6212 (asd gene-deficient Escherichia coli), alar gene-deficient Lactobacillus plantarum NC8 / Δalr, E. coli prokaryotic expression plasmid vector pET-28a (Kar), and lactic acid bacteria expression vector pSIP409-pgsA' (alr) were stored at the Jilin Provincial Engineering Research Center for Animal Microecological Preparations. Plasmids containing the target gene pUC18 / 19-P49, pUC18 / 19-P22, pUC18 / 19-K205R, pUC18 / 19-A137R, and pUC18 / 19-E248R were synthesized by Genscript Biotech Co., Ltd., and the E. coli prokaryotic expression strain BL-21 was provided by Thermo Scientific. XbaI, HindIII restriction endonuclease, Prime STAR Max Premix 2×, DL2000 DNA Marker, and DL10000 DNA Marker were all purchased from TaKaRa; D-alanine was manufactured by Merck Life Sciences Sigmaaldrich; ECL chemiluminescence solution (34077) was provided by Thermo Scientific; mouse anti-6×His monoclonal antibody was manufactured by Sangon Biotech; lysozyme was provided by Beijing Solarbio Science & Technology Co., Ltd.; NC membrane and BeyoBlue... TM Coomassie Brilliant Blue Ultrafast Staining Solution and Phosphate Buffered Sodium (PBS) were both manufactured by Beyotime Biotechnology Co., Ltd.
[0054] The ProFlex PCR system was provided by Merck Life Sciences Sigmaaldrich; the UV-Vis spectrophotometer (L5S) and electrophoresis apparatus (041BR 02682) were both manufactured by Bio-Rad; the ultrasonic-microwave co-extraction system was manufactured by Nanjing Gengchen Scientific Instruments Co., Ltd.; and the electroporator and ultrasensitive multi-functional imager (Amersham Imager 600RGB) were provided by GE. LB medium: NaCl 5.0g, tryptone 5.0g, yeast extract 2.5g, and deionized water (ddH2O) 500mL. For solid LB medium, 3.0g of agar was added to 200mL of medium, and then the medium was autoclaved at 115℃ for 20min. MRS medium: Beef extract (Lab-Lemco Powder) 15.0g, tryptone 15.0g, glucose (C6H2O)... 12 O6) 30.0g, Sodium acetate (CH3COONa) 7.5g, Yeast extract 0.1g, Tween-80 2.0g, Potassium hydrogen phosphate (KH2PO4) 4.0g, Triamine citrate (C6H)14 4.0 g of N2O7, 0.4 g of magnesium sulfate heptahydrate (MgSO4·7H2O), 7.5 g of manganese sulfate (MnSO4·H2O), and 1.5 L of distilled water (ddH2O). Solid MRS medium was prepared by adding 1.5 g of agar to 100 mL of medium, and then sterilized in an autoclave at 115 °C for 20 min.
[0055] 80% Glycerin: 80 mL glycerin, 20 mL ddH2O. Place in a pressure cooker, set the temperature to 121℃ and the time to 15 min. TES Solution: 800 μL 10×TE Buffer, 10.6 mg lysozyme, 2.7 g sucrose, 32 μL RNase A, and 7.2 mL deionized water (ddH2O). Mix well and store at -20℃ for later use.
[0056] 50×TAE electrophoresis buffer: Na₂EDTA·2H₂O 37.2g, glacial acetic acid 57.1mL, Tris 242g, ddH₂O 800mL. Dissolve thoroughly and bring the volume to 1L. Electrophoresis agarose gel: 1×TAE 100mL, agarose 1.0g. Place the above mixture in an Erlenmeyer flask, then microwave to dissolve. After cooling slightly, add 10μL of GV-II gel and mix well.
[0057] Western blot electrophoresis buffer: 1) 5×SDS electrophoresis buffer: Tris 15.1g, Glycine 94.0g, 10% SDS 50mL, ddH2O 500mL. Stir well and bring the volume to 1L, store at room temperature for later use. 2) Transfer buffer: Tris 5.8g, SDS 0.37g, Glycine 2.9g, CH3OH 200mL, and ddH2O 800mL. 3) TBST buffer: NaCl 8.8g, 1MT Tris-HCl (pH=8.0) 20mL, Tween-20 0.5mL, ddH2O 1000mL. 4) Blocking buffer: Skim milk powder 5g, TBST buffer 100mL. Stir well and let dissolve completely, then store at 4℃.
[0058] Construction of novel functional plant-based lactic acid bacteria
[0059] (I) Synthesis of the target gene: The CTB sequence and the p49, p22, K205R, A137R, and E248R sequences of ASFV-SY18 were synthesized, as shown in SEQ ID NO:1 to SEQ ID NO:6, respectively. The target gene was synthesized, as shown in SEQ ID NO:8 to SEQ ID NO:12, respectively. The target gene was ligated to the vector using a seamless cloning method.
[0060] 1. Obtaining the Antibiotic-Free Vector and Target Gene: Antibiotic-free vector fragments and target gene fragments were obtained through seamless cloning. Using seamless cloning primers for both the vector and the target gene, the vector fragment was obtained from the 409ata recombinant plasmid. The target gene fragments of the recombinant plasmids pSIP409-pgsA'-P49(alr), pSIP409-pgsA'-P22(alr), pSIP409-pgsA'-K205R(alr), pSIP409-pgsA'-A137R(alr), and pSIP409-pgsA'-E248R(alr) were obtained using common primers for the target gene. The names and sequences of the seamless cloning primers are as follows:
[0061] For the 409ata vector plasmid, the primers used are 409ata-F (sequence AATTCTATGAGTCGCTTTTTT) and 409ata-R (sequence CAACCAGCCGAATAATCCTTCTCGCTCACTGACTCGCTGC). For the recombinant plasmid, the common primers include MF (sequence AGCGACTCATAGAATTATTTCCTC) and MR (sequence ACCGAGCGCAGCGAGTCAGTGAGCGAGAAGGATTAT).
[0062] PCR amplification of the antibiotic-free vector fragment was performed using the following PCR system: 1.0 μL of the 409ata vector plasmid, 1.5 μL each of the two primers 409ata-F and 409ata-R, 25.0 μL of Prime STAR Max Premix (2-fold concentrated), and 21.0 μL of distilled water (ddH2O), bringing the total volume to 50.0 μL. The PCR amplification conditions for the 409ata vector were: 98℃, 10 s; (98℃, 10 s; 55℃, 5 s; 72℃, 40 s) × 30 cycles; 72℃, 5 min. The PCR amplification system for seamless cloning of the target gene fragment consisted of 1.0 μL of the 409ata vector plasmid, 1.5 μL each of primers 409ata-F and 409ata-R, 25.0 μL of Prime STAR MaxPremix (2×), and 21.0 μL of deionized water (ddH2O), for a total volume of 50.0 μL. The PCR systems for the five plasmids were identical, and the PCR programs were as follows: For templates pUC18 / 19-P49 and pUC18 / 19-P22, the amplification conditions were: 98℃, 10s; (98℃, 10s; 58℃, 30s; 72℃, 3min) × 30 cycles; 72℃, 5min. For template pUC18 / 19-K205R, the amplification conditions were: 98℃, 10s; (98℃, 10s; 60℃, 25s; 72℃, 1min) × 35 cycles; 72℃, 5min. For template pUC18 / 19-A137R, the amplification conditions were: 98℃, 10s; (98℃, 10s; 60℃, 15s; 72℃, 1min) × 35 cycles; 72℃, 5min. For template pUC18 / 19-E248R... PCR amplification conditions were: 98℃, 10s; (98℃, 10s; 60℃, 23s; 72℃, 1min) × 35 cycles; 72℃, 5min.
[0063] 2. Production of receptive states
[0064] 1) Preparation of E. coli χ6212 competent cells: (1) Activate the preserved E. coli χ6212 competent cells one day in advance: Add 5 μg / mL DAP to solid LB medium, then use a sterile pipette tip to dip the bacterial solution for streaking culture, and put the pipette tip, 1.5 mL EP tube, ddH2O and 10% glycerol required for the experiment into the refrigerator for pre-cooling; (2) Pick the activated E. coli χ6212 competent cells and inoculate them into 5 mL of liquid medium containing 5 μg / mL DAP, and incubate overnight in a shaker at 37℃; (3) Take 1 mL of the overnight incubated bacterial solution and put it into 100 mL of LB medium, then add 1 mL of DAP, and incubate in a shaker until the OD is above 0.9, then stop the culture; (4) Place the medium in (3) on ice and let it stand for 20 min, then centrifuge at 2600g. (5) Discard the supernatant after centrifugation, wash the precipitate with an equal volume of autoclaved ddH2O, and centrifuge at 4000 rpm at 4℃ for 10 min; (6) Discard the supernatant, wash the precipitate with an equal volume of autoclaved 10% glycerol, and centrifuge at 4000 rpm at 4℃ for 10 min; (7) Repeat the above steps; (8) Blow the bacterial cells evenly with 2 mL of pre-cooled 10% glycerol and incubate on ice for 10 min; (9) Dispense the mixed precipitate into portions and store at -80℃.
[0065] 2) Preparation of NC8 / Δalr competent cells: (1) Activate the preserved NC8 / Δalr competent cells one day in advance: streak on MRS solid culture plates (containing a final concentration of D-alanine of 0.2 mg / mL) for 16-18 h. Pre-cool the pipette tips, 1.5 mL EP tubes, ddH2O and 10% glycerol required for the experiment; (2) Inoculate the activated single colony into MRS medium (containing a final concentration of D-alanine of 0.2 mg / mL and 2% Gly) and continue to culture for 7-8 h; (3) Subculture: add 200 μL of activated bacterial solution to 5 mL of MRS liquid medium (containing 0.2 mg / mL D-alanine and 2% Gly) and culture in an anaerobic incubator at 37 °C for 4-5 h; (4) Place the cultured bacterial solution on ice for 20 min and run at 5000 rpm. (5) Wash the precipitate with 4 mL of pre-cooled washing buffer (pH=7.4) and centrifuge at 5000 rpm at 4℃ for 20 min; (6) Repeat the above steps; (7) Resuspend the precipitate in 400 μL of electrolysis buffer (pH=7.4); (8) Aliquot the mixed precipitate and store at -80℃.
[0066] 3. Ligation of the target gene and vector: Ligate the target gene and vector according to the instructions of the seamless cloning kit. The seamless cloning system consists of: 3 μL of 409ata vector plasmid, 2 μL of the target fragment, 2 μL of 5×CE II buffer, 1 μL of Express II, and 2 μL of deionized water (ddH2O), for a total volume of 10.0 μL. Incubate in a 37°C metal bath for 30 min.
[0067] 4. Transformation: The steps for transforming into E. coli χ6212 competent cells are as follows: (1) Add 5 μL of seamless clone ligation product to 100 μL of competent cells, mix well, and place in a pre-cooled electroporation cup. Let stand on ice for 20 min. (2) Wipe the electroporation cup dry, place it in an electroporation apparatus, and electroporate according to the procedure for electroporating lactic acid bacteria. (3) Add 600 μL of antibiotic-free LB medium to the electroporation cup, transfer the liquid in the electroporation cup to a 1.5 mL EP tube, and place it in a shaker at 37°C for 1 h. (4) Centrifuge the bacterial culture cultured in the shaker at 37°C, discard a small amount of supernatant, mix the remaining liquid, spread it evenly on an LB plate, and place it in a 37°C incubator for culture. (5) If the transformation is successful, single colonies visible to the naked eye can be observed the next day. (6) Culture the single colonies after culture, then extract the plasmid, and transfer the correctly identified plasmid into lactic acid bacteria.
[0068] 5. Identification: 1) Enzyme digestion identification: Plasmids were extracted from E. coli χ6212 and recombinant plasmids pSIP409-pgsA'-P49(alr), pSIP409-pgsA'-P22(alr), pSIP409-pgsA'-K205R(alr), pSIP409-pgsA'-A137R(alr), and pSIP409-pgsA'-E248R(alr) were digested for identification. The enzyme digestion verification system used 16.0 μL of NC8 / pSIP409-pgsA'-(alr) recombinant plasmid, 1.0 μL each of XbaI enzyme and HindIII enzyme, and 2.0 μL of 10×M buffer, for a total volume of 20.0 μL. After digestion in a metal bath at 37℃ for 2 h, electrophoresis was performed for verification. 2) PCR identification:
[0069] Plasmids were extracted from E. coli χ6212, and the recombinant plasmids pSIP409-pgsA'-P49(alr), pSIP409-pgsA'-P22(alr), pSIP409-pgsA'-K205R(alr), pSIP409-pgsA'-A137R(alr) and pSIP409-pgsA'-E248R(alr) were identified by PCR. PCR primers: For the template DNA pSIP409-pgsA'-P49(alr), the primers used were: P49-F: sequence TCTAGAAATGTACCATGATTACGCT, P49-R: sequence ATTTGCCATACTAATTGCAGCAATAGCATGTGGAGTCTTG. For the template DNA pSIP409-pgsA'-P22(alr), the primers used are: P22-F: sequence TCTAGAAATGCGTAGTTCA, P22-R: sequence TTTGCCATACTAATTGCAGCAATAGCATGTGGC. For the template DNA pSIP409-pgsA'-K205R(alr), the primers used are: K205R-F: sequence TCTAGAAATGGTTGAACCACGTG, K205R-R: sequence ATTTGCCATACTAATTGCAGCAATAGCATGTGGC. For the template DNA pSIP409-pgsA'-A137R(alr), the primers used are: A137R-F: sequence TCTAGAAATGGAAGCTGTTTTGACT, A137R-R: sequence ATTTGCCATTGAAATTGCAGCAATAGCATGTGGCGTCTTA. For the template DNA pSIP409-pgsA'-E248R(alr), the primers used include: E248R-F: sequence TCTAGAATGGGTGGTAGTACTTCA, E248R-R: sequence ATTTGCCATACTAATTGCAGCAATAGCATGTGGCGT.
[0070] PCR validation system: Five pSIP409-pgsA'(alr) plasmids were used, 1.0 μL of each. The total volume of the upstream primers was 1.5 μL. The total volume of the downstream primers was 1.5 μL. The volume of Prime STAR Max Premix (2×) was 25.0 μL. The volume of deionized water (ddH2O) was 21.0 μL. The total volume of the entire PCR system was 50.0 μL.
[0071] 6. Transformation of recombinant plasmid into NC8 / Δalr: Transform the ligation product into competent lactic acid bacteria cells. The steps are as follows: (1) Add 3-4 μL of recombinant plasmid to 100 μL of NC8 competent cells and mix gently; (2) Place the mixture in an electroporation cup, let it stand on ice for 5 min, and then electroporate it; (3) Place the preheated antibiotic-free MRS liquid medium into the electroporation cup, mix well, transfer it to a new 2.0 mL EP tube, add 150 μL of pre-cooled and sterile sucrose solution (0.5 mol / L), and incubate in a 30℃ water bath for 3 h; (4) Centrifuge the liquid in step (3), discard a small amount of supernatant, mix the remaining liquid, spread it evenly on an antibiotic-free MRS solid culture plate, and then culture it; (5) Place the cultured single colony in MRS for culture, and then extract the plasmid for identification.
[0072] 7. Identification of recombinant plasmids in NC8 competent cells: The enzyme digestion and PCR identification procedures are the same as those in 5. Because the cell wall of lactic acid bacteria is very thick, it needs to be processed before the plasmid can be extracted. The pretreatment method is as follows: (1) Pour the lactic acid bacteria into a 2.0 mL EP tube in a clean bench and centrifuge at 12000 rpm for 1 min; (2) Put 1 mL of lysozyme with a concentration of 60 mg / mL into each EP tube and incubate in a 37℃ water bath for 30 min. Then centrifuge and discard the supernatant; (3) Wash the precipitate twice with 500 μL of 5% glucose; (4) Then perform the operation according to the OMEGA extraction kit and perform PCR identification on the extracted plasmid. Five new functional lactic acid bacteria strains were prepared using the above method and named as follows: NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R.
[0073] II. Construction and Identification of pET-28a Expression Vector
[0074] 1. Obtaining the pET-28a expression vector and target gene: The pET-28a vector was obtained through seamless cloning. Then, the vector fragment was obtained from the recombinant plasmid of pET-28a using seamless cloning primers. Primers for the target gene of the recombinant plasmid were designed using Primer 5.2 software, resulting in seamless cloning primers for the recombinant plasmids pET-28a-P49, pET-28a-P22, pET-28a-K205R, pET-28a-A137R, and pET-28a-E248R.
[0075] Seamless cloning primer names and sequences: The sequences of primers PF and PR are AAGCTTGCGGCCGCACTC and GGATCCGCGACCCATTTG, respectively. The A137 primer pairs include A137-F, with the sequence AGCAAATGGGTCGCGGATCCATGGAAGCTGTTTTGACTAAGTTAGATC, and A137-R, with the sequence TCGAGTGCGGCCGCAAGCTTACCTTCCTTAATGTTCATCTTGCC. The sequences of the E248 primer pairs are E248-F: AGCAAATGGGTCGCGGATCCATGGGTGGTAGTACTTCAAAAAATAGTT and E248-R: TCGAGTGCGGCCGCAAGCTTTGAAACTGCAGCATTCTTCAAAA. The sequences of the K205 primer pair are K205-F: AGCAAATGGGTCGCGGATCCATGGTTGAACCACGTGAACAATT and K205-R: TCGAGTGCGGCCGCAAGCTTCTTCTTCATCATTTCCTTAACCATTT. The sequences of the P22 primer pair are P22-F: AGCAAATGGGTCGCGGATCCATGCGTAGTTCAAAAAAGATTAATAATAAA and P22-R: TCGAGTGCGGCCGCAAGCTTTGCATGTTTATGGTTACGTGGC. Finally, the sequences of the P49 primer pair are P49-F: AGCAAATGGGTCGCGGATCCATGTACCATGATTACGCTTCAAAGTT and P49-R: TCGAGTGCGGCCGCAAGCTTTAATGATGGACTAATTGAACTAATACAACA. PCR amplification of the seamless clone antibiotic-free vector was performed. The PCR system consisted of: pET-28a vector: 1.0 μL, PF primers: 1.5 μL, PR primers: 1.5 μL, Prime STAR Max Premix (2×): 15.0 μL, deionized water (ddH2O): 11.0 μL, and a total volume of 30.0 μL. The PCR amplification conditions for pET-28a vector were: 98℃, 10 s; (98℃, 10 s; 61℃, 30 s; 72℃, 3 min) × 35 cycles; 72℃, 5 min.PCR amplification of seamless cloned target fragment system: plasmid containing target gene: 1.0 μL, corresponding upstream primer: 1.5 μL, corresponding downstream primer: 1.5 μL, Prime STAR Max Premix (2×): 15.0 μL, deionized water (ddH2O): 11.0 μL, total volume: 30.0 μL. The PCR systems for the five plasmids were the same, but the PCR programs differed as follows: To obtain p49 containing a homologous arm, the template pUCP19-P49 was amplified under the following conditions: 98℃, 10s; (98℃, 10s; 65℃, 30s; 72℃, 1min) × 35 cycles; 72℃, 5min. To obtain p22 containing a homologous arm, the template pUCP19-P22 was amplified under the following conditions: 98℃, 10s; (98℃, 10s; 55℃, 20s; 72℃, 1min) × 35 cycles; 72℃, 5min. To obtain K205R containing a homologous arm, the template pUCP19-K205R was amplified under the following conditions. The PCR amplification conditions were: 98℃, 10s; (98℃, 10s; 55℃, 25s; 72℃, 1min) × 35 cycles; 72℃, 5min. To obtain A137R containing homologous arms, the PCR amplification conditions for template pUCP19-A137R were: 98℃, 10s; (98℃, 10s; 55℃, 15s; 72℃, 1min) × 35 cycles; 72℃, 5min. To obtain E248R containing homologous arms, the PCR amplification conditions for template pUCP19-E248R were: 98℃, 10s; (98℃, 10s; 70℃, 23s; 72℃, 1min) × 35 cycles; 72℃, 5min.
[0076] 2. Transformation and Identification
[0077] 1) Transformation: The target gene and vector fragment were ligated using a seamless cloning kit. The seamless cloning system consisted of: 3 μL 409ata vector, 2 μL target fragment, 2 μL 5×CE II Buffer, 1 μL Express II, 2 μL deionized water (ddH2O), and a total volume of 10.0 μL. Ligation was performed in a 37°C metal bath for 30 min. The transformation of the ligation product into DH-5α competent cells was carried out as follows: DH-5α competent cells containing 5 μL of the target gene and vector ligation product were slowly aerated in a clean bench and incubated on ice for 30 min; then, they were placed in a preheated 42°C water bath for 90 s; then, they were incubated on ice for 5 min; finally, 500 μL of LB medium was added, and the mixture was incubated in a shaker at 37°C for 1 h; an appropriate amount of bacterial culture was cultured, and plasmids were extracted from the bacterial culture for identification, under the same conditions as described above.
[0078] 2) PCR identification reaction system: 0.5 μL upstream primer, 0.5 μL downstream primer, 1.0 μL plasmid. Max DNA Polymerase 5 μL, ddH2O 3.0 μL, total 10.0 μL. PCR amplification of recombinant plasmids pET-28a-P49, pET-28a-P22, pET-28a-K205R, pET-28a-A137R, and pET-28a-E248R was performed under the following conditions: 98℃, 10 s; (98℃, 10 s; 56℃, 5 s; 72℃, 8 s) × 30 cycles; amplification at 72℃ for 5 min. 3) Transformation: The correctly identified plasmid was transformed into BL-21 cells. The transformation steps are as follows: 10 μL of the ligation product was added to BL-21 competent cells in a clean bench, and the mixture was slowly blown to mix. The cells were then placed on ice for 20 min. The cells were then placed in a 42℃ water bath for 90 s. The cells were then placed on ice for 5 min. Finally, 800 μL of LB medium was added, and the cells were incubated on a shaker at 37℃ for 1 h. An appropriate amount of bacterial culture was taken for further culture, and the plasmid was extracted from the bacterial culture for identification. The identification method was the same as that used for identifying E. coli χ6212.
[0079] 3. Prokaryotic expression and purification of five ASFV antigen proteins
[0080] 1) Protein sample preparation and purification: Five recombinant pET-28a strains containing ASFV antigen protein were sonicated to obtain the target protein. The five frozen recombinant pET-28a strains were activated, passaged again, and cultured in a shaker at 37°C for 3 h. Then, IPTG (isopropyl-β-D-thiogalactoside) inducible peptide was added to a final concentration of 1 mM and cultured. After centrifugation, the precipitate was fully resuspended with 25 mL of PBS and sonicated for 30 min. A portion of the precipitate was mixed with 500 μL of PBS, and 200 μL of the mixed bacterial solution was mixed with 5×SDS buffer. After boiling denaturation, Western blotting was performed. The other portion of the precipitate was washed twice with 2 M urea and then dissolved in 8 M urea solution. The protein was then crudely purified according to the Thermo Fisher His fusion protein purification column instructions. Finally, the protein was refolded using a dialysis bag.
[0081] III. Verification of the expression of proteins from five novel functional lactic acid bacteria strains
[0082] Protein sample preparation: Five novel functional lactic acid bacteria strains, NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R, were subjected to ultrasonic disruption to obtain the target proteins.
[0083] Five strains of frozen lactic acid bacteria were activated and inoculated with MRS medium at a ratio of 1:100. After 3 hours of culture, the lactic acid bacteria reached their optimal state. 12.5 μL of SppIP (sake lactobacillus inducible peptide) was added to 5 mL of medium for induction culture. The culture was then sonicated for 30 min, and the precipitate was collected by centrifugation. A portion of the precipitate was mixed with 500 μL of PBS. 200 μL of the mixed bacterial culture was then mixed with 5×SDS buffer. After mixing, the culture was placed in a 100℃ water bath for complete denaturation and then stored in a refrigerator.
[0084] IV. Immunofluorescence Validation of the Expression of Fusion Proteins from 5 Novel Functional Lactic Acid Bacteria Strains: Five frozen lactic acid bacteria strains were activated and cultured in fresh MRS medium. After 3 hours of culture, when the lactic acid bacteria reached their optimal state, SppIP inducible peptide at a final concentration of 50 ng / mL was added, and the culture was continued overnight. The bacteria were washed three times with PBS, and the precipitate was collected. The precipitate was resuspended in PBS containing 1% BSA and placed in a shaker at 4°C for 1 hour, followed by two washes with PBS. The anti-mouse His-tagged monoclonal antibody was diluted 1:2000, and 300 μL of the diluted solution was used to resuspend the precipitate. The precipitate was then incubated overnight on a shaker at 4°C. The precipitate was washed twice with PBS, and the remaining precipitate was resuspended in an appropriate amount of FITC-labeled anti-mouse secondary antibody diluted 1:4000 and incubated on a shaker at 4°C for 2 hours. The precipitate was washed twice with PBS, and an appropriate amount of bacterial culture was dropped onto an adhesive slide, air-dried, and observed under an upright microscope.
[0085] VI. Results (I) Construction of a novel functional plant lactic acid bacteria vaccine
[0086] 1. Obtaining antibiotic-free vector and target gene: The target gene and the vector fragment on the 409ata plasmid were amplified by PCR, and the products were detected by gel electrophoresis. The vector fragment was visible at 5000 bp, and the target gene bands were visible at 6158 bp, 5583 bp, 5411 bp, 5255 bp, and 5459 bp.
[0087] 2. Identification of recombinant plasmids in E. coli χ6212
[0088] (1) Enzyme digestion identification: The recombinant plasmids pSIP409-pgsA'-P49, pSIP409-pgsA'-E248R, pSIP409-pgsA'-P22, pSIP409-pgsA'-A137R and pSIP409-pgsA'-K205R were digested with enzymes for verification, and all of them yielded bands that were consistent with the expected size.
[0089] (2) PCR identification: The recombinant plasmids pSIP409-pgsA'-P49, pSIP409-pgsA'-E248R, pSIP409-pgsA'-P22, pSIP409-pgsA'-A137R, and pSIP409-pgsA'-K205R were used for PCR verification. Clear bands were obtained at 1707bp, 1137bp, 959bp, 804bp, and 1008bp, respectively.
[0090] 3. Identification of recombinant plasmids in NC8 / Δalr: To determine whether the recombinant plasmid has been transformed into NC8Δalr, the recombinant plasmid in NC8 / Δalr was amplified by primer PCR, and the product was detected by gel electrophoresis. The target gene bands were visible at 1707bp, 1137bp, 959bp, 804bp, and 1008bp.
[0091] (II) Prokaryotic expression and purification of five ASFV antigen proteins
[0092] 1. Obtaining the recombinant plasmid vector and target fragment: The target gene fragment and the pET-28a vector fragment were amplified using primers. The vector fragment was visible at 6161 bp, and the target gene bands were visible at 1707 bp, 1137 bp, 959 bp, 804 bp, and 1008 bp. 2. Recombinant plasmid identification results: PCR verification was performed on the recombinant plasmids pET-28a-P49, pET-28a-E248R, pET-28a-P22, pET-28a-A137R, and pET-28a-K205R, and clear bands of the expected size were obtained. 3. Induction of recombinant Escherichia coli expression: Five recombinant Escherichia coli strains were sonicated and then validated by Western blot. Incubation with HRP-labeled anti-mouse 6×His monoclonal antibody revealed protein bands of the expected sizes: pET-28a-P49 (56 kDa), pET-28a-P22 (24 kDa), pET-28a-K205R (26 kDa), pET-28a-A137R (17.5 kDa), and pET-28a-E248R (31 kDa). Results are shown in the figure below. Figure 1 .
[0093] (III) Western blot verification of protein expression in the novel functional type of *Lactobacillus plantarum*: The novel functional type of lactic acid bacteria was sonicated and incubated with HRP-labeled anti-mouse 6×His monoclonal antibody. Protein bands of the expected sizes were observed: NC8Δ-pSIP409-pgsA', NC8Δ-pSIP409-pgsA'-P49 (63.5 kDa), NC8Δ-pSIP409-pgsA'-P22 (40 kDa), NC8Δ-pSIP409-pgsA'-K205R (37.8 kDa), NC8Δ-pSIP409-pgsA'-A137R (32.5 kDa), and NC8Δ-pSIP409-pgsA'-E248R (42.5 kDa). Results are shown in [Figure number missing]. Figure 2 .
[0094] (iv) Immunofluorescence verification of the expression of fusion proteins of 5 novel functional lactic acid bacteria: The novel functional Lactobacillus plantarum NC8Δ-pSIP409-pgsA', NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R and NC8Δ-pSIP409-pgsA'-E248R were incubated with FITC-labeled mouse anti-His monoclonal antibody. Under a fluorescence microscope, the bacilli were observed to be green and fluorescent, thus verifying that the proteins of the 5 novel functional lactic acid bacteria were successfully anchored on the surface of the lactic acid bacteria cell wall.
[0095] In this embodiment, five novel functional lactic acid bacteria strains, NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R, were successfully prepared. The accuracy of the introduced genes was verified by double enzyme digestion, PCR, and sequencing. Furthermore, the accuracy of protein expression in these five novel functional lactic acid bacteria strains was verified. Western blot experiments confirmed that all five strains containing the His-tagged protein could express proteins of the expected size. Immunofluorescence assays confirmed that the anti-His antibody could bind to the surface of undisturbed live bacteria, indicating that the construction strategy of this embodiment successfully anchored the fusion protein of the His tag and ASFV antigen onto the surface of the cell wall of the novel functional lactic acid bacteria. To further evaluate the immunogenicity of the novel functional lactic acid bacteria, this embodiment also constructed five prokaryotic strains expressing p49, p22, K205R, A137R, and E248R, and successfully expressed and purified the above five ASFV antigen proteins.
[0096] Example 2 Study on the immunomodulatory efficacy of 5 new functional lactic acid bacteria strains
[0097] This embodiment uses a nutritional auxotrophic lactic acid bacteria to express the ASFV antigen protein. This novel functional lactic acid bacteria does not have resistance genes and will not cause harm to the environment. This embodiment is divided into 8 groups: PBS group, empty vector group, NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-K205R group, NC8Δ-pSIP409-pgsA'-A137R group, NC8Δ-pSIP409-pgsA'-E248R group, and a compound lactic acid bacteria group. Each group is fed 1×10⁻⁶ per feeding. 9 The bacterial count of CFU was measured, and the mice were then immunized three times to evaluate the effect of lactic acid bacteria immunity.
[0098] I. Materials: Test strains: Novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R constructed in Example 1. Test animals: 50 SPF-grade 4-week-old BALB / c mice purchased from Beijing Mouse Technology Co., Ltd. Experimental reagents: RPMI 1640 medium (Merck Life Sciences Sigmaaldrich), mouse IFN-γ ELISA kit, mouse IL-4 ELISA kit, and mouse IL-2 ELISA kit were purchased from Sangon Biotech Co., Ltd.; 96-well plates, DAPI staining solution, anti-fluorescence quenching mounting solution (containing PI), Liquid Blocker Super PAP Pen (immunohistochemistry pen, red), Triton X-100 (ST795), and PMSF were purchased from Beyotime Biotechnology Co., Ltd.; GolgiPlug Protein Trnsp Inhb (555029) was purchased from BD Biosciences, USA. Experimental instruments: Flow cytometer (BD LSR Fortessa). TM The microscope was purchased from BDBiosciences, USA; the upright fluorescence microscope (DM4B) was purchased from Shanghai Batuo Instrument Co., Ltd.; and the fully automated tissue homogenization system was purchased from Shanghai Jingxin Industrial Co., Ltd.
[0099] Preparation of reagents required for the experiment: 1) Antigen coating solution: 3.18g sodium carbonate (Na2CO3), 5.86g sodium bicarbonate (NaHCO3), 2L deionized water (ddH2O). 2) PBST: 2L deionized water (ddH2O), 1 packet of PBS powder, 1mL Tween-20. 3) Stop solution (2M H2SO4): 5.45mL 98% H2SO4, 44.55mL deionized water (ddH2O).
[0100] II. Experimental Methods
[0101] (I) Grouping and Immunization Protocols of Laboratory Animals
[0102] 1. Immunization Grouping: This experiment was divided into 8 groups. Mice were randomly divided into the following groups: PBS group, pSIP409-pgsA' (empty vector) group, NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-K205R group, NC8Δ-pSIP409-pgsA'-A137R group, NC8Δ-pSIP409-pgsA'-E248R group, and compound lactic acid bacteria group. Five mice were in each group. The OD value of the lactic acid bacteria was measured at 24 hours, and the growth curve of the lactic acid bacteria was plotted. Figure 3 Based on the growth curve of lactic acid bacteria, the culture solution was adjusted to contain 1×10⁻⁶ bacteria per 200 μL. 9 The live bacteria count of CFU was 1×10⁻⁶ per mouse per group. 9 The number of live bacteria in CFU.
[0103] Animal grouping and immunization regimen: Animals were divided into 8 groups, with 5 animals in each group. Different reagents and dosages were administered orally to each group: the PBS group received 200 μL of PBS solution orally; the NC8Δ-pSIP409-pgsA' (empty vector) group received 1.0 × 10⁻⁶ pgsA' solution orally. 9 CFU containing the empty vector strain NC8Δ-pSIP409-pgsA'200 μL; NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-K205R group, NC8Δ-pSIP409-pgsA'-A137R group, and NC8Δ-pSIP409-pgsA'-E248R group were orally administered with 1.0 × 10 9200 μL of the corresponding strain of CFU. The compound lactic acid bacteria group was orally administered a compound lactic acid bacteria containing NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R at a dose of 1.0 × 10⁻⁶. 9 CFU / 200μL. 2. Immunization schedule: Primary immunization is performed on days 1, 2 and 3, booster immunization is performed on days 11, 12 and 13, and the third immunization is performed on days 21, 22 and 23. Immunization level is tested 7 days after the third immunization.
[0104] (II) Flow Cytometry
[0105] 1. Detection of expression levels of maturation marker molecules on the surface of DCs in PPs: 1) Divide into tubes: Place 1.5 × 10⁻⁶ molecules into each 1.5 mL EP tube. 6 -2.0×10 6 1) PP cell suspension, then wash once with 1 mL PBS, centrifuge and discard the PBS, leaving 100 μL of PBS, then add antibody; 2) Antibody: Add 10 μL of diluted antibody, incubate at 4℃ for 20 min in the dark (anti-mouse CD80-PerCP-Cy5.5 mAb, anti-mouse CD86-PE mAb, anti-mouse CD11C-APC mAb are all diluted 40 times); 3) After adding 1.5 mL of PBS, centrifuge at 2000 rpm at 4℃ for 5 min, discard the supernatant, add PBS to 300-400 μL for instrumentation.
[0106] 2. Detection of B-cell expression levels of PPs: 1) Divide into tubes: Place 1.5 × 10⁻⁶ PPs into each 1.5 mL EP tube. 6 -2.0×10 61) PP cell suspension, then wash once with 1 mL PBS, centrifuge and discard the PBS, leaving 100 μL of PBS for antibody addition; 2) Antibody addition: Add 10 μL of Anti-mouse B220-PE mAb diluted 30 times, incubate at 4℃ in the dark for 20 min; 3) Add 1 mL PBS and centrifuge at 2000 rpm at 4℃ for 5 min; 4) Fixation: 500 μL of fixative in black bottle / tube, incubate at 4℃ in the dark for 40-50 min; 5) Washing: Centrifuge in white bottle with 1× washing buffer (diluted with Wahaha water) at 4℃ and 400g for 6 min, then discard the supernatant; 6) Wash again, repeat the previous step; 7) Intracellular staining: Add 10 μL of Anti-mouse IgA-FITC mAb diluted 30 times and incubate at 4℃ in the dark for 20 min; 8) Washing: Add 1 mL PBS and centrifuge at 400g... After centrifuging at 4℃ for 6 min, discard the supernatant and add PBS to 100 μL of the liquid to bring the total volume to 300-400 μL before loading the solution onto the machine.
[0107] 3. Flow cytometry detection of specific Th1 and Th2 cells: 1) In a clean bench, mouse spleens, MLNs, and PPs were placed into 1.5 EP tubes containing 1 mL PBS. Each tissue was then homogenized with 1.5 mL PBS (containing 2% serum) and centrifuged at 2000 rpm for 5 min at 4°C. 2) The spleen cell suspension was lysed with a suitable amount of homemade erythrocyte lysis buffer for 5 min. The presence of lysed erythrocytes after centrifugation was used to determine if the above steps were necessary. 3) Cells from each tissue were resuspended in 1 mL PBS and centrifuged at 2000 rpm for 5 min at 4°C. 1 mL of complete culture medium was then added and mixed thoroughly. 4) Cell counting: Cells were counted by dilution according to cell quantity. 10 μL of the original cell culture was placed into the corresponding dilution tube, and 10 μL of the cell dilution was used for counting. The result was calculated as 1.5 × 10⁻⁶. 6 5) Plating: Place 1.5 × 10⁻⁶ cells into a 48-well plate. 6 / hole-2.0×10 6 / The cell volume of each well is increased by adding protein to a final concentration of 5 μg / mL. Then, the liquid volume is increased to 500 μL per well. After incubation at 37°C for 2.5 h, 1 μL of protein inhibitor is added per well, and the cells are incubated for another 3.5 h. 6) The cultured cells are collected into 1.5 mL EP tubes and centrifuged. The supernatant is discarded, and the cells are washed with 1 mL PBS. After centrifugation, the supernatant is discarded again, and 100 μL of liquid is reserved for antibody staining. 7) Antibody staining: 10 μL of diluted antibody is added and the mixture is placed in a 4°C refrigerator in the dark for 20 min (Anti-mouse CD3-AF700 mAb, anti-mouse CD4-PerCP-Cy5.5 mAb, and anti-mouse CD8-FITC mAb are all diluted 40 times). 8) 1 mL After PBS, centrifuge at 2000 rpm for 5 min at 4℃, and discard the supernatant after centrifugation; 9) Fixation: Add 500 μL of black bottle fixative to each tube and place in a 4℃ refrigerator in the dark for 40-50 min; 10) Washing: Add 1 mL of 1× white bottle washing buffer (diluted with Wahaha water) to each tube, then centrifuge at 400g for 6 min at 4℃ and discard the supernatant; 11) Wash again: Repeat the previous step; 12) Intracellular staining: Add 10 μL of diluted antibody to each tube, mix well and place in a 4℃ refrigerator in the dark for 20 min (anti-mouse IFN-γ-PE mAb and anti-mouse IL-4-APC mAb are both diluted 30 times); 13) Washing: Wash once with 1 mL of PBS, centrifuge at 400g for 6 min at 4℃ and discard the supernatant, leaving 100 μL of cell slurry; 14) Add PBS to 300-400 μL for loading.
[0108] The corresponding antigen proteins for each group: The PBS group and the NC8Δ-pSIP409-pgsA' group did not receive any antigen proteins. The NC8Δ-pSIP409-pgsA'-P49 group received 5 μg / mL of p49 protein, the NC8Δ-pSIP409-pgsA'-P22 group received 5 μg / mL of p22 protein, the NC8Δ-pSIP409-pgsA'-A137R group received 5 μg / mL of A137R protein, the NC8Δ-pSIP409-pgsA'-K205R group received 5 μg / mL of K205R protein, and the NC8Δ-pSIP409-pgsA'-E248R group received 5 μg / mL of E248R protein. The complex lactic acid bacteria group received a mixed combination of antigen proteins, each at a concentration of 5 μg / mL, including p49, p22, A137R, K205R, and E248R proteins.
[0109] (III) Immunofluorescence observation of B cell expression in the small intestine
[0110] Detection of B cell expression in the small intestine and ileum of mice after the third immunization: 1) Tissue sampling and fixation: Small intestine and ileum tissues were collected from mice after the third immunization. Appropriately sized small intestine tissues were taken using sterile scissors and fixed in 4% paraformaldehyde solution for at least 48 hours. 2) Paraffin embedding and sectioning: The fixed small intestine and ileum tissues were rinsed, then dehydrated using an alcohol gradient and cleared twice with xylene. Finally, they were placed in paraffin 1, paraffin 2, and paraffin 3 containers at 58℃ for 30 minutes each, then embedded, and finally sectioned using a tissue sectioner and stored for later use. 3) Immunofluorescence:
[0111] Paraffin-embedded tissue sections were dewaxed in an 80°C oven for 20 minutes, followed by staining, dehydration, clearing, and mounting. The detailed steps are as follows: dewaxing with xylene I and xylene II for 7 minutes each → soaking in 100% ethanol for 5 minutes → soaking in 90% ethanol I and II for 5 minutes each → soaking in 70% ethanol for 5 minutes → finally washing twice with water → antigen retrieval was performed by boiling a staining box containing 1× antigen retrieval solution in a water bath for 20 minutes → after cooling, the antigen-retrieved pathological sections were washed three times in PBS → the sections were dried, and the desired tissue was circled with an immunohistochemical pen, then the sections containing 5%... Cover the tissue with BSA and 0.3% Triton-100 blocking solution, place in a humidified chamber at 4°C in the dark for 1 hour → wipe the blocking solution dry with kitchen paper, then incubate with a mixture of B220-FITC (200×) and IgA-PE (200×) to completely cover the tissue, place in a humidified chamber at 4°C in the dark for 12 hours → recover excess antibody, wash the tissue slides three times in PBS, then cover the tissue with DAPI staining solution at room temperature in the dark for 10 minutes, wash three more times in PBS, wipe dry with kitchen paper, finally add anti-fluorescence quenching agent to each tissue slide and cover with a coverslip, after which the tissue slides can be observed under a fluorescence microscope.
[0112] (iv) Detection of expression levels of mouse-specific SIgA, IgG and related cytokines
[0113] 1. Detection of the expression level of specific SIgA against ASFV antigen in mouse feces: Feces were collected from mice at day 0, 7 days after the first immunization, the second immunization, and the third immunization. The collected feces were weighed, and PBS solution containing 1% PMSF was added. The feces were then crushed with a pipette tip and placed in a 4°C refrigerator for 2 hours. After that, centrifugation was performed at 2000 rpm at 4°C for 5 minutes. The supernatant of the feces was labeled and stored in a -80°C refrigerator. The method is as follows: 1) Coating antigen: Add 100 μL of antigen coating solution with a concentration of 2 μg / mL to each well of a 96-well plate, shake well, and then cover with sealing film and place in a refrigerator at 4°C overnight to prevent evaporation; 2) Washing: Discard the coating solution, then wash 3 times with a plate washer, gently shaking for 5 min each time, and then blot dry the remaining PBST; 3) Blocking: Add 100 μL of 2% BSA to each well and block for 2 h; 4) Washing: Discard the blocking solution, then wash thoroughly with a plate washer, and finally blot dry the PBST in the wells; 5) Adding fecal supernatant to be tested: Add 100 μL of fecal supernatant to each well, and then place in a constant temperature incubator at 37°C for 2 h. 6) Washing: Discard the sample, then wash 3 times with a plate washer, and finally blot dry the PBST in the wells; 7) Add HRP-labeled rabbit anti-mouse IgA: Dilute the secondary antibody 1:4000 and add 100 μL to each well, then place it in a 37℃ incubator for 1 h; 8) Washing: Wash again and blot dry the liquid in the wells; 9) TMB color development: Add 100 μL of TMB color development solution to each well, and place the 96-well plate in a 37℃ incubator for 10 min; 10) H2SO4 to terminate the reaction: Add 50 μL of 2M H2SO4 to each well of the 96-well plate, and then obtain the OD450nm value; 11) Data analysis: Use the Two-way ANOVA method of GraphPad Prism 8.0.0 to plot the data and analyze the differences between the 8 experimental groups.
[0114] 2. Detection of ASFV-specific immunoglobulin (IgG, IgG1, and IgG2a) levels in mouse peripheral blood: Serum was collected from mice at day 0, 7 days after the first, second, and third immunizations. The serum was incubated at 37°C for 2 hours, followed by centrifugation at 2000 rpm for 20 minutes at 4°C. The collected serum was used to detect the levels of ASFV p49, p22, K205R, A137R, and E248R-specific antibodies IgG and their subtypes IgG1 and IgG2a in the peripheral blood of mice after immunization. The remaining procedures were the same as above. The secondary antibody used was HRP-labeled rabbit anti-mouse IgG, IgG1, and IgG2a.
[0115] 3. Detection of the expression levels of relevant cytokines in mouse serum: Serum samples were collected from mice at day 0, 7 days after the first, second, and third immunizations. The expression levels of cytokines were observed according to the instructions of the mouse ELISA kit.
[0116] (V) q-PCR detection of transcriptional levels of related cytokines: The transcriptional levels of IL-4, IL-2 and IFN-γ in the spleen and MLN of mice 7 days after the third immunization were detected by relative quantitative q-PCR. The primers used for quantitative PCR were as follows: IL-4 primers were IL-4-F (TGAATGACTGGAGGAGCTGAGACC) and IL-4-R (CGGAGTGGCGACATCGTACATAAC); IL-2 primers were IL-2-F (TGAGCAGGATGGAGAATTACAG) and IL-2-R (CAGAGGTCCAAGTTCATCTTCT); IFN-γ primers were IFN-γ-F (CTTGAAAGACAATCAGGCCATC) and IFN-γ-R (CTTGGCAATACTCATGAATGCA); ACT-β primers were ACT-β-F (CTACCTCATGAAGATCCTGACC) and ACT-β-R (CACAGCTTCTCTTTGATGTCAC). Tissue sample collection and processing: 1) Place an appropriate amount (approximately 50mg-100mg) of MLN and Spleen into an RNase-free EP tube; 2) Add 1mL of Trizol to the tube, then grind it in a grinder; 3) Transfer the ground tissue to a new RNase-free EP tube and centrifuge at 2000rpm at 4℃ for 20min. Transfer the supernatant to a new RNase-free EP tube, add 500μL of chloroform, mix thoroughly, and incubate on ice for 10min; 4) Centrifuge the RNase-free EP tube from step 3) at 4℃, 12000rpm for 15min; 5) Transfer the aqueous phase of the upper RNA layer to a new RNase-free EP tube, add 300μL of isopropanol, mix thoroughly, incubate at room temperature for 15min, and then centrifuge; 6) precipitate the precipitate with 1mL of... 7) Mix 75% ethanol by inverting and then centrifuge; 8) After centrifugation, discard as much liquid as possible remaining in 1.5 mL of RNase-free EP, and then air dry (about 5 min); 9) Add an appropriate amount of RNase-free deionized water according to the amount of precipitate in each tube, and then use a microplate reader to detect its RNA concentration and quality; 10) Finally, process the qualified RNA according to the reverse transcription reagent and fluorescence quantitative kit from TaKaRa.
[0117] III. Results (I) Effects of oral administration of novel functional lactic acid bacteria on dendritic cell (DC) activation in mouse prostates: First, the effects of oral administration of novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-E248R, and compound lactic acid bacteria on dendritic cell activation were evaluated. Seven days after the third immunization, the expression of activation markers on the surface of DCs in the prostates of mice fed with lactic acid bacteria was evaluated. The results showed... Figure 4 All groups of lactic acid bacteria immunization mice significantly induced DC activation. Compared with the PBS group, the NC8Δ-pSIP409-pgsA'-P49 group (P<0.01), NC8Δ-pSIP409-pgsA'-P22 group (P<0.05), NC8Δ-pSIP409-pgsA'-K205R group (P<0.01), NC8Δ-pSIP409-pgsA'-A137R group (P<0.01), NC8Δ-pSIP409-pgsA'-E248R group (P<0.05), and the compound lactic acid bacteria group (P<0.001) showed significantly lower CD11c levels. + CD80 + Cell counts increased significantly. Compared with the PBS group, the CD11c levels in the NC8Δ-pSIP409-pgsA'-P49 group (P<0.01), NC8Δ-pSIP409-pgsA'-P22 group (P<0.01), NC8Δ-pSIP409-pgsA'-K205R group (P<0.01), NC8Δ-pSIP409-pgsA'-A137R group (P<0.01), NC8Δ-pSIP409-pgsA'-E248R group (P<0.01), and the compound lactic acid bacteria group (P<0.001) were significantly increased. + CD86 + Cells increased significantly. In summary, the experiments showed that the novel functional lactic acid bacteria can significantly increase the expression of the dendritic cell co-stimulatory molecules CD80 / CD86 in Peyer's patch, and also indicate that the novel functional lactic acid bacteria can effectively stimulate the activation of dendritic cells in mouse Peyer's patch.
[0118] (II) Effects of oral administration of five novel functional lactic acid bacteria on B cell activation: The effects of oral administration of five novel functional lactic acid bacteria strains (NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-E248R) and a compound lactic acid bacteria on B cell activation in mouse PPs and MLNs were evaluated. PPs and MLNs of mice were collected 7 days after the third immunization, and the activation level of B cells was evaluated by flow cytometry. The results of B cell activation in PPs are shown below. Figure 5 The results of B cell activation in MLN are as follows: Figure 6 .
[0119] Effects of novel functional lactic acid bacteria on B cell activation in mouse PPs: Compared with the PBS group, oral administration of a single strain of novel functional lactic acid bacteria significantly increased B220 in mice. + IgA + The proportion of cells (P<0.01) was significantly higher in the mice oral administration of compound lactic acid bacteria compared to the PBS group (P<0.001). Furthermore, compared to the pSIP409-pgsA' group, the new functional lactic acid bacteria significantly induced the activation of B cells in mouse PPs.
[0120] Effects of novel functional lactic acid bacteria on B cell activation in mouse MLN: Compared with the PBS group, the levels of B cell activation induced in each experimental group were similar to those induced in PPs. Compared with the PBS group, oral administration of NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R significantly increased B220 in mice. + IgA + The proportion of cells (P<0.01), and feeding mice with compound lactic acid bacteria significantly increased B220. + IgA + The proportion of cells (P<0.001) was significantly lower in each experimental group compared to the pSIP409-pgsA' group. The new functional lactic acid bacteria could significantly induce the activation level of B cells in mouse MLN. Therefore, the experiment showed that oral administration of compound lactic acid bacteria to mice can better induce B cell activation.
[0121] (III) Effects of oral administration of novel functional lactic acid bacteria on the secretion level of specific cytokines in mice
[0122] Evaluation of the effects of oral administration of novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-E248R and compound lactic acid bacteria on CD4+ levels in mouse MLN and spleen. + IFN-γ + CD8 + IFN-γ + CD4 + IL-4 + Effects on T cells. Seven days after the third immunization, the MLN and spleen of mice were collected, and the secretion of specific cytokines was evaluated by flow cytometry. The results showed that the novel functional lactic acid bacteria significantly increased CD4 counts in mice. + IFN-γ + CD8 + IFN-γ + CD4 + IL-4 + T cell expression was found, and compound lactic acid bacteria were found to better induce CD4 expression. + IFN-γ + CD8 + IFN-γ + CD4 + IL-4 + T cell activation.
[0123] Novel functional lactic acid bacteria affect CD4 in mouse MLN + IFN-γ + The effect of T cells is discussed in [see section 1]. Figure 7 CD4 in each experimental group + IFN-γ + The proportion of T cells was significantly increased compared to the PBS group. Oral administration of the novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P22 to mice significantly increased CD4 counts compared to the PBS group. + IFN-γ + The proportion of T cells (P<0.05). Furthermore, oral administration of novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-E248R to mice significantly increased CD4+. + IFN-γ +The proportion of T cells (P<0.01). Compared with the PBS group, feeding mice with compound lactic acid bacteria significantly promoted CD4 cell growth. + IFN-γ + The proportion of T cells (P<0.001) in each experimental group compared with the pSIP409-pgsA' group, and the CD4+ level in MLN. + IFN-γ + The proportion of T cells also increased significantly.
[0124] Novel functional lactic acid bacteria affect CD4 levels in mouse Spleen cells. + IFN-γ + The effect of T cells is discussed in [see section 1]. Figure 8 Compared with the PBS group, CD4 levels in each experimental group were significantly lower. + IFN-γ + The proportion of T cells was significantly increased in the compound lactic acid bacteria group, and compared with the PBS group, the CD4 count was significantly higher in the compound lactic acid bacteria group. + IFN-γ + The proportion of T cells was the highest (P<0.001). Mice fed NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-K205R alone significantly increased CD4 counts compared to the PBS group. + IFN-γ + The proportion of T cells (P<0.01) was significantly increased in mice fed NC8Δ-pSIP409-pgsA'-P22 and NC8Δ-pSIP409-pgsA'-E248 compared to the PBS group, and CD4 count was also significantly increased. + IFN-γ + The proportion of T cells (P<0.05), compared with the pSIP409-pgsA' group, the CD4 count in Spleen cells was significantly lower in each experimental group. + IFN-γ + The proportion of T cells also increased significantly.
[0125] Novel functional lactic acid bacteria affect CD8 in mouse MLN + IFN-γ + The effect of T cells is discussed in [see section 1]. Figure 9 Compared with the PBS group, CD8 in each experimental group + IFN-γ + The proportion of T cells was significantly increased, and compared with the PBS group, feeding mice with lactic acid bacteria NC8Δ-pSIP409-pgsA'-E248R could stimulate CD8+ in the mice. + IFN-γ +T cell activation (P<0.05) was significantly enhanced in mice by single-dose administration of NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-K205R compared to the PBS group, promoting CD8 activation (P<0.05). + IFN-γ + T cell activation (P<0.01), compared with the PBS group, CD8 in the compound lactic acid bacteria group was significantly lower. + IFN-γ + The proportion of T cells was the highest (P<0.001). Compared with the pSIP409-pgsA' group, the proportion of CD8+ cells in MLN was significantly higher in each experimental group. + IFN-γ + The proportion of T cells also increased significantly, indicating that the compound lactic acid bacteria can effectively stimulate CD8+ in mice. + IFN-γ + T cell activation.
[0126] Novel functional lactic acid bacteria affect CD8 levels in mouse Spleen cells. + IFN-γ + The effect of T cells is discussed in [see section 1]. Figure 10 Compared with the PBS group, CD8 in each experimental group + IFN-γ + The proportion of T cells was significantly increased. Mice fed alone with NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-K205R showed a significant increase in CD8+ compared to the PBS group. + IFN-γ + The proportion of T cells (P<0.01) was significantly higher in mice fed NC8Δ-pSIP409-pgsA'-E248R compared to the PBS group, which also promoted CD8 cell growth. + IFN-γ + The proportion of T cells (P<0.05). However, feeding mice with compound lactic acid bacteria significantly increased CD8+. + IFN-γ + T cell percentage (P<0.001).
[0127] Novel functional lactic acid bacteria affect CD4 in mouse MLN + IL-4 + The effect of T cells is discussed in [see section 1]. Figure 11 Compared with the PBS group, CD4 levels in each experimental group were significantly lower. + IL-4 +The proportion of T cells was significantly increased. Mice fed a single dose of the novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-K205R showed a significant increase in CD4 count compared to the PBS group. + IL-4 + The proportion of T cells (P<0.01) was significantly increased in mice after single-dose administration of NC8Δ-pSIP409-pgsA'-P22 and NC8Δ-pSIP409-pgsA'-E248R compared to the PBS group. + IL-4 + The proportion of T cells (P<0.05). However, feeding mice with compound lactic acid bacteria significantly increased CD8+. + IFN-γ + The proportion of T cells (P<0.001).
[0128] Novel functional lactic acid bacteria affect CD4 levels in mouse Spleen cells. + IL-4 + The effect of T cells is discussed in [see section 1]. Figure 12 Compared with the PBS group, oral administration of a single novel functional lactic acid bacteria significantly increased CD4 count. + IL-4 + Compared with the PBS group, oral administration of NC8Δ-pSIP409-pgsA'-P49 and NC8Δ-pSIP409-pgsA'-A137R significantly induced CD4+ in mice. + IL-4 + The proportion of T cells (P<0.01). Compared with the PBS group, mice fed NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-E248R, and NC8Δ-pSIP409-pgsA'-K205R alone increased CD4+. + IL-4 + The proportion of T cells (P<0.05) and the induction of CD4 in mice by feeding them with compound lactic acid bacteria + IL-4 + The proportion of T was significantly different from that in the PBS group (P<0.001).
[0129] (IV) Effects of Five Novel Functional Lactic Acid Bacteria on B Cell Activation in Mouse Intestine: To investigate the effects of five novel functional *Lactobacillus plantarum* strains on B cell activation in the small intestine of mice, immunofluorescence was used to detect B cell expression in the small intestine (duodenum and ileum) of mice 7 days after the third immunization. The B cell expression in the mouse duodenum is shown in [the table below]. Figure 13The expression of B cells in the ileum of mice is shown in [the figure]. Figure 13 .
[0130] Anti-mouse B220-PE mAb, Anti-mouse IgA-FITC mAb, and DAPI were used to stain the surface marker molecules and nuclei of B cells, respectively, to induce B220 in the duodenum and ileum of mice. + IgA + The cells appear yellow under an immunofluorescence microscope. Pathological sections of the small intestine (duodenum and ileum) of mice, under a fluorescence microscope, show B220 in the small intestine of the PBS group and the pSIP409-pgsA' group. + IgA + The number of double-positive cells was very low, and compared with the PBS group and the pSIP409-pgsA' group, the B220 in the small intestine of the compound lactic acid bacteria group was significantly lower. + IgA + The highest number of double-positive cells was observed, followed by a slightly higher number of B220 cells in the small intestine of mice fed only the novel functional lactic acid bacteria group. + IgA + Double-positive cells. Overall, there were many B220 cells in each experimental group. + IgA + The presence of double-positive cells indicates that feeding mice with compound lactic acid bacteria can induce B cell activation, and oral administration of compound lactic acid bacteria to mice can better induce B cell activation.
[0131] (V) Effects of five novel functional lactic acid bacteria strains on specific immunoglobulins and related cytokines
[0132] 1. Effects of novel functional lactic acid bacteria on fecal-specific SIgA expression levels: ELISA was used to detect the expression levels of specific SIgA antibodies in fecal supernatants and serum-specific IgG antibodies in mice orally immunized with novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-K205R, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-E248R and compound lactic acid bacteria on day 0, 7 days after the first, second, and third immunizations.
[0133] SIgA antibodies were mainly expressed in the supernatant of mouse feces. The expression of anti-ASFV specific SIgA antibodies in the supernatant of mouse feces was detected on day 0 after immunization, 7 days after the first immunization, the second immunization, and the third immunization. The results are as follows: Figure 14On day 0, there was no significant difference in the expression level of anti-ASFV specific SIgA in the fecal supernatant of each experimental group. Seven days after the first immunization, mice orally fed with the novel functional lactic acid bacteria NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-K205R and the compound lactic acid bacteria showed significantly different levels of anti-ASFV specific SIgA expression in their fecal supernatant compared with mice in the PBS group (P<0.05). Seven days after the second immunization, the expression levels of anti-ASFV specific SIgA in the NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-A137R group, NC8Δ-pSIP409-pgsA'-K205R group, and the compound lactic acid bacteria group were significantly increased compared with the PBS group (P<0.01). Compared with the PBS group, the expression level of anti-ASFV specific SIgA in the fecal supernatant of the NC8Δ-pSIP409-pgsA'-K205R group was significantly increased (P<0.05). Seven days after the third immunization, the expression level of SIgA in the fecal supernatant of mice in the oral administration of the new functional lactic acid bacteria group continued to increase. Compared with the PBS group, the mixed feeding of the new functional lactic acid bacteria significantly increased the expression level of anti-ASFV specific SIgA (P<0.001). Compared with the PBS group, the SIgA expression level in the fecal supernatant of mice in the NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-A137R group, and NC8Δ-pSIP409-pgsA'-K205R group was significantly increased (P<0.01). Furthermore, the SIgA expression level in the NC8Δ-pSIP409-pgsA'-E248R group was significantly different from that in the PBS group (P<0.05). Moreover, 7 days after the first, second, and third immunizations, the SIgA expression level in the fecal supernatant of mice in each experimental group was significantly different from that in the pSIP409-pgsA' group.
[0134] 2. Effects of novel functional lactic acid bacteria on the expression level of specific IgG in peripheral blood: Immunoglobulin G (IgG) has the ability to neutralize viruses. This example used ELISA to detect the level of specific IgG antibodies in the serum of mice orally immunized with novel functional lactic acid bacteria on day 0, after the first immunization, and 7 days after the second and third immunizations. This example also detected the expression levels of anti-ASFV specific IgG and its subtypes IgG1 and IgG2a in mouse serum. The results are as follows... Figure 15 , Figure 16 , Figure 17 and Figure 18 On day 0, there was no significant difference in anti-ASFV specific IgG levels among the experimental groups. Seven days after the first immunization, mice in the oral compound lactic acid bacteria group showed the best induced specific IgG expression levels in serum compared to the PBS group (P<0.01). The induced specific IgG expression levels in the group fed only with the novel functional lactic acid bacteria were significantly different from those in the PBS group (P<0.05). Seven days after the second immunization, mice in the oral compound lactic acid bacteria group showed the best induced IgG expression levels in serum compared to the PBS group (P<0.001). The induced IgG expression levels in the group fed only with the novel functional lactic acid bacteria were significantly different from those in the PBS group (P<0.01). Seven days after the third immunization, the induced specific IgG expression levels in the serum of mice in the oral novel functional lactic acid bacteria group continued to increase. Compared to the PBS group, mixed feeding with the novel functional lactic acid bacteria significantly increased the induced specific IgG expression levels (P<0.001). The specific IgG expression levels in the NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-K205R, and NC8Δ-pSIP409-pgsA'-E248R groups were significantly different from those in the PBS group (P<0.01). Furthermore, 7 days after the first, second, and third immunizations, the specific IgG expression levels in the serum of mice in each experimental group were significantly different from those in the pSIP409-pgsA' group. The expression levels of specific IgG subtypes IgG1 and IgG2a in mouse serum were similar to those of specific IgG. Moreover, 7 days after the third immunization, the IgG1 / IgG2a ratio in mouse serum was less than 1, indicating that the novel functional type of lactic acid bacteria induces a Th1-biased response and possesses excellent antiviral activity. Overall, compound lactic acid bacteria can increase the expression levels of specific IgG and its subtypes in mouse serum.
[0135] 3. Effects of Novel Functional Lactic Acid Bacteria on Cytokine Expression Levels in Peripheral Blood: Cytokines secreted by immune cells possess potent antiviral capabilities. Therefore, the effects of five novel functional plant-based lactic acid bacteria strains on cytokine expression in mouse peripheral blood were detected using an ELISA assay. The secretion levels of IFN-γ, IL-4, and IL-2 in mouse serum were measured 7 days after the third immunization. The results of the secretion levels of IFN-γ, IL-4, and IL-2 in mouse serum are shown below. Figure 19 , Figure 20 and Figure 21 As shown in the figure. The results indicate that all experimental groups can effectively induce the secretion levels of IFN-γ, IL-4, and IL-2.
[0136] The expression level of IFN-γ in the serum of the oral fed compound lactic acid bacteria group was significantly different from that of the PBS group (P<0.001). In addition, the expression level of IFN-γ in the serum of the NC8Δ-pSIP409-pgsA'-P22 group, NC8Δ-pSIP409-pgsA'-A137R group, NC8Δ-pSIP409-pgsA'-K205R group and NC8Δ-pSIP409-pgsA'-E248R group was significantly increased compared with the PBS group (P<0.01). The expression level of IFN-γ in the serum of the NC8Δ-pSIP409-pgsA'-P49 group was significantly different from that of the PBS group (P<0.05).
[0137] Oral feeding of compound lactic acid bacteria significantly increased serum IL-4 expression compared with the PBS group (P<0.001). The serum IL-4 expression levels in the NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-A137R group, and NC8Δ-pSIP409-pgsA'-K205R group were significantly different from those in the PBS group (P<0.01). Furthermore, the serum IL-4 expression levels in the NC8Δ-pSIP409-pgsA'-P22 group and NC8Δ-pSIP409-pgsA'-E248R group were significantly different from those in the PBS group (P<0.05).
[0138] Compared with the PBS group, the oral feeding of compound lactic acid bacteria significantly increased the expression of serum IL-2 (P<0.001). The serum IL-2 expression levels in the NC8Δ-pSIP409-pgsA'-P49 group, NC8Δ-pSIP409-pgsA'-A137R group, NC8Δ-pSIP409-pgsA'-E248R group, NC8Δ-pSIP409-pgsA'-P22 group, and NC8Δ-pSIP409-pgsA'-K205R group were significantly different from those in the PBS group (P<0.01).
[0139] (VI) Effects of Five Novel Functional Lactic Acid Bacteria on Cytokine Transcription Levels: Lactic acid bacteria can effectively induce cytokine expression. Therefore, the transcription levels of IFN-γ, IL-4, and IL-2 cytokines in mouse spleen and mesenteric lymph nodes were detected by q-PCR. The transcription levels of IFN-γ, IL-4, and IL-2 in mouse spleen were detected 7 days after the third immunization. The results of the transcription levels of IFN-γ, IL-4, and IL-2 cytokines in mouse spleen are shown below. Figure 22 , Figure 23 and Figure 24 As shown in the figure. The transcriptional levels of IFN-γ, IL-4, and IL-2 in mouse MLN are as follows. Figure 25 , Figure 26 and Figure 27 As shown.
[0140] The effects of the novel functional lactic acid bacteria on the transcriptional levels of IFN-γ, IL-4, and IL-2 in the spleen of mice were as follows: All experimental groups showed an increase in the transcriptional level of IFN-γ in the spleen. Compared with the PBS group, the compound lactic acid bacteria groups significantly increased the transcriptional level of IFN-γ in the spleen (P<0.001), and the transcriptional levels of IFN-γ in the spleen of mice in the NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-A137R, and NC8Δ-pSIP409-pgsA'-K205R groups were significantly different from those in the PBS group (P<0.01). Compared with the PBS group, the transcriptional levels of IFN-γ in the spleen of mice in the NC8Δ-pSIP409-pgsA'-P22 and NC8Δ-pSIP409-pgsA'-E248R groups were significantly increased (P<0.05). Compared with the pSIP409-pgsA' group, the transcriptional levels of IFN-γ in the spleen of mice in all experimental groups were also significantly increased. Furthermore, the transcriptional levels of IL-4 and IL-2 in the spleen of all experimental groups were similar to the transcriptional levels of IFN-γ.
[0141] The effects of novel functional lactic acid bacteria on the transcriptional levels of IFN-γ, IL-4, and IL-2 in mouse mesenteric lymph nodes are as follows: Compared with the PBS group, all experimental groups increased the transcriptional level of IFN-γ in the mesenteric lymph nodes. The transcriptional level of IFN-γ in the mesenteric lymph nodes of the compound lactic acid bacteria group was significantly different from that of the PBS group (P<0.001), and the NC8Δ-pSIP409-pgsA'-P49, NC8Δ-pSIP409-pgsA'-A137R, NC8Δ-pSIP409-pgsA'-P22, NC8Δ-pSIP409-pgsA'-E248R, and NC8Δ-pSIP409-pgsA'-K205R groups significantly increased the transcriptional level of IFN-γ in mouse mesenteric lymph nodes compared with the PBS group (P<0.01). Furthermore, compared with the pSIP409-pgsA' group, oral administration of the novel functional lactic acid bacteria significantly increased the transcriptional level of IFN-γ in the mesenteric lymph nodes of mice in all experimental groups. Compared with the PBS group and pSIP409-pgsA', the transcriptional levels of IL-4 and IL-2 in the mesenteric lymph nodes of mice in all experimental groups were similar to the transcriptional levels of IFN-γ.
[0142] IV. Summary: This example evaluated the immunomodulatory effects of the five novel functional lactic acid bacteria strains prepared previously, and further evaluated the effect of the combined formulation of the five novel functional lactic acid bacteria strains on the immunomodulatory effects in mice. The results showed that the novel functional lactic acid bacteria induced the activation of dendritic cells in the Pain lymph nodes of mice, enhanced the ability of T cells and other immune cells in the spleen and mesenteric lymph nodes to secrete cytokines, and upregulated the expression levels of cytokines in the blood. The novel functional lactic acid bacteria also promoted the generation of germinal centers at intestinal immune effector sites, inducing the host to produce specific IgG and secretory IgA. Compared with immunization with a single novel functional lactic acid bacteria strain, the strategy of combined immunization with five novel functional lactic acid bacteria strains induced a higher level of immune response, and the immune response was more inclined towards a Th1-type immune response. Th1 cells can secrete various immune cytokines such as interferon, which can promote CTL responses, thereby killing viruses. This indicates that recombinant lactic acid bacteria expressing ASFV antigens have the potential to kill ASFV.
[0143] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A live vector vaccine comprising a mixture of five engineered bacteria, each of which uses *Lactobacillus plantarum* NC8Δalr, a variant of the alanine racemase gene, as a host, and expresses one of the following fusion proteins on its surface: CTB-P49, CTB-P22, CTB-K205R, CTB-A137R, or CTB-E248R. Each fusion protein is located on the bacterial cell surface through the pgsA' anchoring domain, and its encoded nucleotide sequences are SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12, respectively. In each fusion protein, CTB is linked to antigens P49, CTB-P22, CTB-K205R, CTB-A137R or CTB-E248R by a linker, the sequence of which is SEQ ID NO:
7. The expression vector used to construct the engineered bacteria is pSIP409-pgsA', whose erythromycin resistance gene is replaced by an asd-alr auxotrophic complement marker, thus eliminating the presence of resistance selection markers.
2. The live vector vaccine as described in claim 1, wherein the live vector vaccine is administered orally.
3. The live vector vaccine according to claim 1 or 2, characterized in that, Each fusion protein has a His-tag at its C-terminus.
4. The use of the live vector vaccine according to any one of claims 1-3 in the preparation of an oral vaccine for the prevention of African swine fever virus infection.
5. The application according to claim 4, characterized in that, The oral vaccine is suitable for use according to a three-course immunization schedule, with a single oral dose of at least 1 × 10⁻⁶. 9 CFU, with at least 10 days between each session.
6. The application according to claim 4, characterized in that, The oral vaccine is used to induce mucosal-systemic combined immunity and Th1-biased immune responses in animals.
Citation Information
Patent Citations
Non-resistant lactobacillus plantarum anchoring expression vector pLPSa and preparation method thereof
CN108410900A
Methods for growing african swine fever virus in fetal porcine lung alveolar macrophage cells
CN112492875A
African swine fever virus antigen protein recombinant expression vector, recombinant plant lactobacillus as well as preparation method and application of recombinant plant lactobacillus
CN116396974A