Use of reagent for promoting expression of bombyx mori bmmwh2 gene in breeding of bombyx mori variety resistant to bmnpv or in preparation of medicine

Abstract

The application discloses application of a reagent for promoting expression of a Bombyx mori BmWh2 gene in breeding of BmNPV-resistant Bombyx mori varieties or preparation of medicines, and full-length sequence of a key gene BmWh2 of BmNPV virus resistance is screened, BmWh2 is induced to be down-regulated expression by BmNPV virus, and knocking out BmWh2 in BmE cells significantly promotes proliferation of BmNPV, and incrementally expressing BmWh2 at a cell level significantly inhibits proliferation of BmNPV, and the mortality of the transgenic Bombyx mori with incrementally expressed BmWh2 after being infected by BmNPV is significantly reduced, so that BmWh2 is a key gene affecting virus resistance of the Bombyx mori, and can provide a theoretical basis and a target gene for cultivation of a transgenic resistant variety of the Bombyx mori.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of reagents that promote the expression of the BmWh2 gene in silkworms in the selection of BmNPV-resistant silkworm varieties or in the preparation of drugs. Background Technology

[0002] The silkworm is an important economic insect, and silk is a crucial raw material for the silk industry. In many rural areas of my country, sericulture is a pillar industry of the local economy and a major source of income for farmers, generating billions of yuan in revenue for silkworm farmers annually. However, silkworms face serious disease threats. Nucleopolyhedrovirus disease is one of the most common and damaging silkworm diseases, caused by nucleopolyhedrovirus (BmNPV). This disease is highly contagious and difficult to control.

[0003] Because BmNPV poses a serious threat to sericulture, researchers have long sought to identify key genes affecting silkworm resistance to viruses, and then use molecular biotechnology to enhance silkworm resistance. Cloning and identifying the full-length sequences of key genes influencing silkworm virus resistance is of significant theoretical and practical value for elucidating the mechanisms of silkworm resistance to viruses and for breeding resistant varieties for application in sericulture. Summary of the Invention

[0004] In view of this, one objective of the present invention is to provide an application of a reagent that promotes the expression of the silkworm BmWh2 gene in the preparation of anti-BmNPV drugs; another objective of the present invention is to provide an application of a reagent that promotes the expression of the silkworm BmWh2 gene in the breeding of BmNPV-resistant silkworm varieties.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] 1. Application of reagents that promote the expression of the BmWh2 gene in silkworms in the breeding of BmNPV resistant silkworm varieties.

[0007] 2. Application of reagents that promote the expression of the BmWh2 gene in silkworms in the preparation of anti-BmNPV drugs.

[0008] Preferably, the reagent for promoting the expression of the silkworm BmWh2 gene is a targeting vector containing the BmWh2 gene, such as the pAcGP67 series vector, the pFastBac series vector, or the pIZ / V5-His series vector.

[0009] Preferably, the nucleotide sequence of the silkworm BmWh2 gene is shown in SEQ ID No. 15.

[0010] In a further preferred embodiment of the present invention, the reagent for promoting the expression of the silkworm BmWh2 gene is the piggyBac[hr3-A4P-BmWh2-SV40-3×p3 DsRed afm] injection vector; the preparation method of the injection vector is as follows: firstly, the BmWh2 gene shown in SEQ ID No. 14 is ligated into the pSL1180[HR3-A4-DsRed-SV40] vector containing the Hr3 enhancer, the silkworm actin Actin 4 promoter, and the SV40 termination signal sequence through the BamHI and NotI restriction sites to obtain the 1180-hr3-A4P-BmWh2-SV40 transition vector; then, the pBac[3×p3-DsRed af] vector and the transition vector are digested with Asc I, the target band is recovered, ligated and transformed, and positive clones are screened to obtain the piggyBac[hr3-A4P-BmWh2-SV40-3×p3 DsRed afm] injection vector.

[0011] The preferred method of this invention for breeding BmNPV-resistant silkworm varieties includes the following steps: mixing the prepared injection vector and the helper plasmid pHA3PIG and microinjecting it into non-diapause silkworm eggs, hatching and culturing, and screening to obtain positive silkworm individuals.

[0012] The beneficial effects of this invention are as follows: The full-length sequence of BmWh2, a key gene affecting silkworm resistance, was cloned. BmWh2 expression was downregulated by BmNPV, suggesting its potential involvement in the interaction between BmNPV and silkworms. The function of this gene was studied through gene editing and incremental expression. A BmWh2 gRNA knockout vector was designed and constructed, and co-transfected with a Cas9-expressing plasmid into BmE cells, significantly promoting BmNPV proliferation. Using the full-length CDS sequence of BmWh2 as a target, a transient transfection incremental expression vector was constructed, revealing that incremental expression of this gene at the cellular level significantly inhibited BmNPV proliferation. Furthermore, a transgenic incremental expression vector was constructed, and transgenic positive individuals were obtained through embryo microinjection. Transgenic silkworms with incremental expression of this gene showed significantly enhanced resistance to BmNPV. Therefore, the BmWh2 gene has significant value in the research and application of transgenic disease-resistant breeding of silkworms. Attached Figure Description

[0013] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0014] Figure 1 To detect the periodic expression of the BmWh2 gene using RT-PCR;

[0015] 1-16 represent the following stages: egg stage 4 days, egg stage 6 days, egg stage 8 days, larva stage, first instar molting stage, second instar emerging stage, second instar molting stage, third instar emerging stage, third instar molting stage, fourth instar emerging stage, fourth instar molting stage, fifth instar emerging stage, pupa stage 2 days, pupa stage 4 days, pupa stage 6 days, moth stage. The Wh2 gene was amplified 30 times, and the internal control TIF-4A was amplified 27 times.

[0016] Figure 2 The expression of the BmWh2 gene in tissues was detected by qPCR (using cDNA from various tissues of 5th instar 3-day-old silkworm larvae as templates).

[0017] Figure 3 To detect the expression level of BmWh2 after BmNPV infection.

[0018] Figure 4 To promote BmNPV proliferation by gene editing BmWh2 in BmE cells;

[0019] Among them, A. Detection of BmWh2 gene editing in BmE cells; B. Observation of BmNPV viral fluorescence 72h after infection; C. Detection of BmNPV viral content by qPCR 48h after infection.

[0020] Figure 5 Incremental expression of BmWh2 in BmE cells significantly inhibited BmNPV proliferation;

[0021] Among them, A. qPCR detection of BmWh2 gene expression level 48h after transfection; B. Observation of BmNPV viral fluorescence 72h after viral infection; C. qPCR detection of BmNPV viral content 48h after viral infection.

[0022] Figure 6 Transgenic silkworms expressing BmWh2 showed significantly increased resistance to BmNPV;

[0023] Among them, A. qPCR detection of BmWh2 gene expression level in 4th instar silkworms; B. Statistical analysis of mortality rate after transgenic silkworms were infected with BmNPV; C. qPCR detection of virus content in transgenic silkworms 48 hours after infection with BmNPV. Detailed Implementation

[0024] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0025] Example 1. Cloning the full-length sequence of the BmWh2 gene

[0026] (1) First, specific primers were designed based on the silkworm genome sequence: the forward primer BmWh2-F for the full length of BmWh2: 5'-ATGGAACTTGTGGACAAA-3' (SEQ ID No. 1), and the reverse primer BmWh2-R: 5'-TTATCTAGTCGACTTGAGTTT-3' (SEQ ID No. 2). Using whole silkworm cDNA from the 3rd day of the 5th instar as a template, PCR reaction conditions were performed as follows: 94℃ pre-denaturation for 4 minutes, followed by 94℃ denaturation for 40 seconds, 55℃ annealing for 40 seconds, and 72℃ extension for 1 min 50 seconds, for a total of 30 cycles, with a final extension at 72℃ for 10 minutes. The PCR product was identified and recovered by agarose gel electrophoresis, and then ligated into the pMD19-T vector. The ligation reaction was carried out overnight at 16℃ using T4 DNA ligase. The ligation was then transformed into DH5α competent cells, and positive clones were obtained and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results showed that we successfully cloned the full-length sequence of the BmWh2 gene, which is 2106 bp in length (SEQ ID No. 3).

[0027] Example 2. Detection of BmWh2 expression pattern

[0028] (1) Using cDNA from the four-day-old egg stage, six-day-old egg stage, eight-day-old egg stage, ant-like silkworm stage, first instar molting stage, second instar molting stage, second instar molting stage, third instar molting stage, third instar molting stage, fourth instar molting stage, fifth instar molting stage, two-day-old pupa stage, four-day-old pupa stage, six-day-old pupa stage, and moth stage as templates, specific primers for the BmWh2 gene were used: Wh2qRT-F: 5'-TCGCTGCTAAAGACGCTCG-3' (SEQ ID No. 4) and Wh2qRT-R: 5'-AAGCCAGTCCACTAATCTCCC-3' (SEQ ID No. 4). No. 5) RT-PCR detection was performed. The PCR amplification conditions were: 94℃ pre-denaturation for 4 minutes, followed by 94℃ denaturation for 40 seconds, 60℃ annealing for 40 seconds, and 72℃ extension for 10 seconds, for a total of 30 cycles, with a final extension at 72℃ for 10 minutes. The silkworm housekeeping gene TIF-4A was used as an internal control. RT-PCR detection was performed using its specific primers TIF-4AqRT-F: 5'-GAATGGACCCTGGGACACTT-3' (SEQ ID No. 6) and TIF-4AqRT-R: 5'-CTGACTGGGCTTGAGCGATA-3' (SEQ ID No. 7). The PCR amplification conditions were: 94℃ pre-denaturation for 4 minutes, followed by 94℃ denaturation for 40 seconds, 60℃ annealing for 40 seconds, and 72℃ extension for 10 seconds, for a total of 27 cycles, with a final extension at 72℃ for 10 minutes. The RT-PCR results are attached. Figure 1 As shown, BmWh2 is expressed at all developmental stages of the silkworm.

[0029] (2) Using cDNA from the head, epidermis, midgut, fat body, hemocytes, silk glands, martensitic bodies, trachea, testes, and ovaries of 5th instar 3-day-old silkworm larvae as templates, qPCR was performed using specific primers Wh2qRT-F / R for BmWh2 and TIF-4AqRT-F / R for the internal reference gene TIF-4A. The procedures were performed according to the instrument and kit instructions. The qPCR results are attached. Figure 2 As shown, BmWh2 is expressed in all tissues of silkworms.

[0030] (3) RNA was extracted from BmE cells at 0, 3, 6, 9, 12, and 24 h after infection with BmNPV and reverse-engineered into cDNA. qPCR was performed using specific primers for the BmWh2 gene (Wh2qRT-F / R) and the internal reference gene TIF-4A (TIF-4AqRT-F / R). The qPCR results are attached. Figure 3 As shown, BmNPV induces downregulation of BmWh2 expression, suggesting that BmWh2 may be involved in the interaction between BmNPV and silkworm.

[0031] Example 3. Gene editing of BmWh2 promotes BmNPV proliferation

[0032] (1) Using the GAAGAGGCAGCCCGTGGATCTGG (SEQ ID No. 8) sequence of BmWh2 as the gene editing target site, the gene editing target site was constructed into the U6-gRNA of the knockout base vector pB-Modified{IE2-Zeocin-Ser1PA}{U6-gRNA}{hr3-hsp70-Cas9-SV40} (abbreviated as pB-CRISPR) of Chinese invention patent application number 202010378925.5 to obtain the single-target sgRNA vector P10-SgWh2 (Wh2KO) of the present invention. P10-SgWh2 was transfected into BmE cells, and DNA was extracted 48 h later. PCR was performed using the knockout site detection primers wh2-kojc-F: 5'-CTCAGTACACGCACGACC-3' (SEQ ID No. 9) and wh2-kojc-R: 5'-GTGGCAACACGACAAGG-3' (SEQ ID No. 10). The PCR reaction conditions were: 94℃ pre-denaturation for 4 minutes, followed by 94℃ denaturation for 40 seconds, 52℃ annealing for 40 seconds, and 72℃ extension for 40 seconds, for a total of 30 cycles, with a final extension at 72℃ for 10 minutes. The PCR products were identified and recovered by agarose gel electrophoresis, and then ligated into the pMD19-T vector. The ligation reaction was carried out overnight at 16℃ using T4 DNA ligase. The cells were then transformed into DH5α competent cells, and 10 positive clones were randomly selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Of the 8 successfully sequenced samples, 6 clones showed deletion mutations, and 2 did not, resulting in a gene editing efficiency of approximately 75%. (See appendix) Figure 4 A).

[0033] (2) P10-SgWh2 and control P10 empty plasmid (i.e., pB-CRISPR) were transfected into BmE cells. 48 h later, the cells were infected with BmNPV-GFP virus labeled with green fluorescence. DNA was extracted 48 h after infection and qPCR was performed using specific primers for the BmNPV virus GP41 gene: GP41qRT-F: 5'-CGTAGTAGTAGTAATCGCCGC-3' (SEQ ID No. 11) and GP41qRT-R: 5'-AGTCGAGTCGCGTCGCTTT-3' (SEQ ID No. 12). The silkworm housekeeping gene BmGAPDH was used as an internal control, with specific detection primers BmGAPDHqRT-F: 5'-CCGCGTCCCTGTTGCTAAT-3' (SEQ ID No. 13) and BmGAPDHqRT-R: 5'-CTGCCTCCTTGACCTTTTGC-3' (SEQ ID No. 12). (No. 14) Follow the instructions for the instrument and reagent kit. The qPCR test results are attached. Figure 4As shown in Figure C, the viral load in the Wh2KO group was significantly higher than that in the control group.

[0034] (3) Observe fluorescence 72 hours after viral infection, as shown in the attached figure. Figure 4 As shown in Figure B, the viral fluorescence in the Wh2KO group was significantly stronger than that in the control group, indicating that knocking out BmWh2 promoted the proliferation of BmNPV, and that BmNPV-induced downregulation of BmWh2 expression was beneficial to viral proliferation.

[0035] Example 4. Incremental expression of BmWh2 at the cellular level inhibits BmNPV

[0036] (1) Since the BmWh2 sequence contains BamHI and NotI restriction sites, these two sites were removed by codon optimization and a Flag tag was added. The BamHI and NotI restriction site sequences were added to the N and C ends, respectively, and the DNA sequence Wh2F (SEQ ID No.15) was artificially synthesized.

[0037] (2) The Wh2F plasmid was double-digested with BamHI and NotI, identified and recovered by agarose gel electrophoresis, yielding the BmWh2 digested fragment. Simultaneously, the pSL1180[HR3-A4-DsRed-SV40] vector (see Chinese Invention Patent Application No. CN117016497A) containing the Hr3 enhancer, the silkworm actin Actin 4 promoter (A4P), and the SV40 termination signal sequence was double-digested with BamHI and NotI, identified and recovered by agarose gel electrophoresis, yielding the 1180-hr3-A4P-SV40 digested fragment. The BmWh2 digested fragment was ligated and transformed with the 1180-hr3-A4P-SV40 digested fragment, and positive clones were screened to obtain the 1180-hr3-A4P-BmWh2-SV40 vector (abbreviated as Wh2OE).

[0038] (3) The empty vector plasmids Wh2OE and control pSL1180[HR3-A4-DsRed-SV40] were transfected into BmE cells, respectively. RNA was extracted 48 h after transfection and reverse transcribed into cDNA. qPCR was performed using the specific primers Wh2qRT-F / R for BmWh2 and TIF-4AqRT-F / R for the internal reference gene TIF-4A. The results are shown in the attached figure. Figure 5 As shown in Figure A, the incremental expression of BmWh2 was successful.

[0039] (4) 48 hours post-transfection, the virus was infected with BmNPV-GFP virus labeled with green fluorescence. DNA was extracted 48 hours after infection and qPCR was performed using the specific primer GP41qRT-F / R for the BmNPV virus GP41 gene. The silkworm housekeeping gene BmGAPDH was used as an internal control, with the specific primer BmGAPDHqRT-F / R. The procedure was performed according to the instrument and kit instructions. The qPCR results are attached. Figure 5 As shown in Figure C, the viral load in transfected Wh2OE cells was significantly lower than that in the control.

[0040] (5) Observe fluorescence 72 hours after viral infection, as shown in the attached figure. Figure 5 As shown in Figure B, the viral fluorescence in cells transfected with Wh2OE was significantly weaker than that in the control, indicating that increased expression of BmWh2 significantly inhibited the proliferation of BmNPV.

[0041] Example 5. Preparation and detection of transgenic silkworms with incremental expression of BmWh2

[0042] (1) The pBac[3×p3-DsRedaf] vector (see Chinese invention patent application number CN202010691455.8) and 1180-hr3-A4P-BmWh2-SV40 were digested with Asc I enzyme, the target band was recovered and ligated for transformation, and positive clones were screened to obtain the piggyBac[hr3-A4P-BmWh2-SV40-3×p3 DsRed afm] injection vector (abbreviated as pb-Wh2oe).

[0043] (2) After soaking the DZ variety silkworm eggs in acid (hydrochloric acid specific gravity 1.073, temperature 46℃, time 5 minutes) to relieve diapause, place them in a dark environment at 15℃ and 85% humidity for about 30 days until hatching. Collect the silkworms and raise them in a standard environment (temperature: 25℃, humidity: 80%). After the silkworms emerge as moths, mate the male and female silkworm moths for 4 hours. The silkworm eggs laid after the mating are non-diapause silkworm eggs, which are used for the next step of microinjection.

[0044] (3) The pb-Wh2oe recombinant vector and the helper plasmid pHA3PIG were mixed and set aside. The laid silkworm eggs were arranged neatly on a clean glass slide. Two hours after laying, the mixed plasmid solution was injected into the DZ silkworm eggs using an Eppendorf microinjector, for a total of 93 eggs. After sealing with non-toxic glue, the eggs were placed in an environment of 25℃ and 80% relative humidity for about 10 days to incubate. The 56 hatched G0 generation silkworms were collected and raised on mulberry leaves until they emerged as moths. Nine G1 generation silkworm eggs were obtained through self-pollination or backcrossing of the G0 generation moths. G1 embryos were screened using an electric macrofluorescence microscope, and one positive moth ring was obtained. Subsequent generations were used to expand the transgenic silkworm system Wh2oe.

[0045] (4) Fourth-instar silkworms from transgenic Wh2oe and non-transgenic WT were used for qPCR detection of BmWh2. The results are shown in the attached figure. Figure 6 As shown in Figure A, the expression level of BmWh2 in Wh2oe was significantly higher than that in WT, indicating successful transgenic incremental expression. Fourth instar silkworms were orally fed BmNPV at a 60% lethal dose. DNA was extracted 48 hours after challenge, and qPCR was performed using specific primers GP41qRT-F / R for the GP41 gene and BmGAPDHqRT-F / R for the internal reference gene BmGAPDH. The results are shown in the attached figure. Figure 6 As shown in Figure C, the BmNPV content in Wh2oe silkworms was significantly lower than that in the control; the mortality rate was recorded up to the cocooning stage, and the results are shown in the attached figure. Figure 6 As shown in Figure B, almost all unchallenged control WT (C) silkworms survived, and the mortality rate of Wh2oe was significantly lower than that of the control WT. These results indicate that transgenic silkworms with increased expression of BmWh2 showed significantly enhanced resistance to BmNPV.

[0046] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. The application of a reagent that promotes the expression of the BmWh2 gene in silkworms in the breeding of BmNPV-resistant silkworm varieties, characterized by: The nucleotide sequence of the silkworm BmWh2 gene is shown in SEQ ID No.

15. The reagent for promoting the expression of the silkworm BmWh2 gene is the piggyBac[hr3-A4P-BmWh2-SV40-3×p3-DsRed af] injection vector. The preparation method of the injection vector is as follows: First, the BmWh2 gene shown in SEQ ID No. 15 is ligated into the pSL1180[hr3-A4P-DsRed-SV40] vector containing the hr3 enhancer, the silkworm actin Actin 4 promoter, and the SV40 termination signal sequence through the BamHI and NotI restriction sites to obtain the 1180-hr3-A4P-BmWh2-SV40 transition vector; then, the pBac[3×p3-DsRed af] vector and the transition vector are respectively injected with Asc. After digestion with enzyme I, the target band was recovered, ligated, transformed, and positive clones were screened to obtain the piggyBac[hr3-A4P-BmWh2-SV40-3×p3-DsRed af] injection vector.

2. The application of a reagent that promotes the expression of the silkworm BmWh2 gene in the preparation of anti-BmNPV drugs, characterized in that: The nucleotide sequence of the silkworm BmWh2 gene is shown in SEQ ID No.

15. The reagent for promoting the expression of the silkworm BmWh2 gene is the piggyBac[hr3-A4P-BmWh2-SV40-3×p3-DsRed af] injection vector. The preparation method of the injection vector is as follows: First, the BmWh2 gene shown in SEQ ID No. 15 is ligated into the pSL1180[hr3-A4P-DsRed-SV40] vector containing the hr3 enhancer, the silkworm actin Actin 4 promoter, and the SV40 termination signal sequence through the BamHI and NotI restriction sites to obtain the 1180-hr3-A4P-BmWh2-SV40 transition vector; then, the pBac[3×p3-DsRed af] vector and the transition vector are respectively injected with Asc. After digestion with enzyme I, the target band was recovered, ligated, transformed, and positive clones were screened to obtain the piggyBac[hr3-A4P-BmWh2-SV40-3×p3-DsRed af] injection vector.

3. The application according to claim 1, characterized in that, The method for breeding BmNPV resistant silkworm varieties includes the following steps: the prepared injection vector and pHA3PIG are mixed and microinjected into non-diapause silkworm eggs, hatched and cultured, and positive silkworm individuals are screened.

Images