A recombinant enzyme-activated expression vector pRAGE and expression method and related applications based thereon

Abstract

The application belongs to the technical field of bioengineering, and particularly relates to a recombinase-activated expression vector pRAGE and an expression method and related application based on the same. The application constructs an expression vector pRAGE including a Bxb1 recombinase expression frame, a 35S promoter and an attP site downstream of the 35S promoter. The plasmid can be used for expression of a gene fragment amplified by PCR in protoplasts. Compared with a conventional method of constructing a recombinant vector for gene expression, the application saves a large amount of time and cost, and is also suitable for high-throughput screening research. Therefore, the technology can be compatible with downstream applications of various protoplast expression systems, including but not limited to protein subcellular localization, protein functional site screening, protein interaction key region / position screening.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinase-activated expression vector pRAGE, an expression method based on it, and related applications. Background Technology

[0002] Site-specific recombinases are a class of enzymes that can recognize, cleave, and recombine specific DNA sites, thus enabling deletion, insertion, translocation, and inversion at those sites. In plant research, site-specific recombinases are commonly used to construct recombinant vectors for binary vectors and in gene stacking studies.

[0003] Protoplasts are crucial transient expression systems in plant research, widely used for subcellular protein localization, transcriptional regulation, and gene editing. Gene expression in protoplasts typically requires cloning the target gene into a recombinant vector. Therefore, a complete vector construction process is necessary in the early stages: PCR amplification of the gene to be detected, homologous recombination of the PCR product with a tag vector, E. coli transformation, E. coli monoclonal PCR identification and Sanger sequencing identification, E. coli culture, and plasmid extraction. This entire process usually takes 4-7 days. Besides the time cost, the high cost of recombinase reagents and plasmid extraction kits must also be considered. More importantly, for mutant sequence screening and subcellular localization studies, the constructed plasmids are often not reused, leading to a significant waste of initial costs. These issues are particularly pronounced when conducting large-scale, high-throughput experiments.

[0004] In 2019, Huang et al. (Huang X, Xue J, Wang FZ, Li JF. Enhanced protoplast assay by transfecting PCR-assembled gene expression cassettes with telomeric repeats and thiophosphate modifications. Anal Biochem. 2019; 569:39-45.) reported a subcellular localization method based on PCR products. This method requires one round of PCR amplification of the promoter, gene, and terminator separately, followed by a second round of overlap extension PCR to introduce the N-terminus of GFP into the promoter and the C-terminator into the terminator. The fragment is then purified and transformed into protoplasts for expression. While this method effectively avoids vector construction, it requires introducing the promoter and terminator at both ends of the gene to be detected each time, performing three-fragment overlap extension PCR. The difficulty of overlap extension PCR amplification increases with the number of fragments, thus posing a potential risk of amplification failure and sequence mutation. Furthermore, increasing the length of the PCR fragment requires higher concentrations to ensure transformation efficiency. Therefore, there is an urgent need for a simpler strategy to achieve the expression of PCR fragments without relying on recombinant vectors. Summary of the Invention

[0005] Given that PCR-based methods require the separate preparation of three fragments to assemble a complete gene expression cassette, there are high risks of amplification failure and mutation. This invention provides a recombinase-activated expression plasmid to assist DNA fragment expression. Only two fragments, the gene and the terminator, need to undergo overlap extension PCR to prepare a PCR product for protoplast expression. When the plasmid containing the recombinase system is co-transformed into protoplasts with this PCR fragment, the recombinase recombines the PCR fragment into a recombination site following the promoter sequence in the vector, enabling gene expression. The principle of this invention is as follows: after amplifying the gene and terminator sequence into a single fragment using overlap extension PCR, it is co-transformed into protoplasts with the helper plasmid pRAGE. The recombinase system in pRAGE recombines the gene and terminator into the 35S promoter region of the pRAGE plasmid, thus expressing the gene. This invention further simplifies the fragment expression strategy through a principle improvement.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The present invention provides a recombinase-activated expression vector pRAGE, wherein the expression vector pRAGE includes a Bxb1 recombinase expression cassette, a 35S promoter and an attP site located downstream of the promoter.

[0008] The present invention also provides a method for expression of recombinase activation, the method comprising the following steps:

[0009] 1) A PCR product containing an attB sequence was introduced into the N-terminus of the gene to be expressed by PCR primer amplification to obtain the gene-terminator PCR product.

[0010] When the amplified template contains a suitable terminator for the gene to be expressed, the PCR product of the gene to be expressed and the terminator can be obtained directly by performing the amplification operation.

[0011] When the amplified template does not contain a terminator suitable for the gene to be expressed, a terminator is introduced at the C-terminus of the gene to be expressed by overlapping extension PCR to obtain the PCR product of gene to be expressed and terminator.

[0012] 2) After co-transforming protoplasts with the PCR product of the gene-terminator obtained in step 1) and the above pRAGE plasmid, recombinase expression causes the attP site of the pRAGE plasmid to recombine with the attB site of the gene to be expressed, thereby expressing the gene to be expressed.

[0013] In this invention, the adapter sequences in step 1) are as shown in SEQ ID No. 1 and SEQ ID No. 2; SEQ ID No. 1 is gacggcggtctccgtcgtcaggatcatccgggc; and SEQ ID No. 2 is tgtttgaacgatcggggaaattctctaga. In practice, when it is necessary to introduce tags such as EGFP and Flag at the C-terminus, the adapter sequence of GSP R (Gene-specific primer R, referring to the R-terminal primer for amplifying the gene to be expressed, which also introduces a homologous arm that can recombine with the tag protein sequence) should be changed to the homologous sequence at the N-terminus of the tag sequence, while ensuring that the gene and the tag are located in the same protein coding frame to avoid frameshift.

[0014] In this invention, the amplification primer sequences for the PCR operation in step 1) are shown in SEQ ID No. 3 and SEQ ID No. 4; SEQ ID No. 3 is tcggccggcttgtcgacgacggcggtctccgtcgtca; and SEQ ID No. 4 is aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc. In actual operation, if other terminators are used, the NOS R primers can be replaced with the corresponding amplification primers.

[0015] This invention provides the application of the above-described expression vector pRAGE and expression method in protein subcellular localization.

[0016] This invention also provides the application of the above-described expression vector pRAGE and expression method in the screening of protein functional sites.

[0017] The present invention also provides the application of the above expression vector pRAGE and the above expression method in the screening of key regions / sites of protein interaction.

[0018] This invention provides a recombinase-activated expression plasmid pRAGE. The plasmid includes a Bxb1 recombinase expression cassette, a 35S promoter, and an attP site downstream of it (specific structure shown in figure). Figure 1 (As shown). This invention also provides a method for expressing PCR products without relying on recombinant vectors. This method first prepares PCR products containing genes and terminators through double-fragment overlapping extension PCR, and then co-transforms protoplasts with the helper plasmid pRAGE. Cells utilize the recombinase system of the pRAGE plasmid for site-specific recombination, generating complete gene expression cassettes and activating gene expression within the fragments. The universal primers and adapters involved in this invention facilitate high-throughput expression of multiple genes.

[0019] The beneficial effects of this invention are as follows: This invention utilizes a recombinase system to activate PCR product expression, simplifying the PCR expression technology of protoplasts. This technology is compatible with various downstream applications, such as subcellular localization, screening of protein functional sites, and screening of key regions / sites of protein-protein interactions. Attached Figure Description

[0020] Figure 1 The principle of expressing PCR-derived gene fragments using recombinase-activated expression vectors;

[0021] Figure 2 Results of expressing BTX reporter system using recombinase-activated expression vector;

[0022] Figure 3 The results of expressing the EGFP gene using a recombinase-activated expression vector;

[0023] Figure 4 The principle of using recombinase-activated expression vectors for subcellular localization studies;

[0024] Figure 5 Subcellular localization results of HOX3 gene expression using recombinase-activated expression vector. Detailed Implementation

[0025] The present application will be further explained below with reference to the embodiments. Before introducing the specific embodiments, the experimental background of some embodiments is briefly described below.

[0026] Example 1

[0027] Recombinase-activated expression cells express BTX reporter system to produce betaine.

[0028] In this embodiment, the PCR product of the BTX reporter system was first prepared through two PCR reactions. This PCR product was then co-transformed into protoplasts with a pRAGE helper plasmid. Finally, the autofluorescence of betaine was observed using a fluorescence microscope.

[0029] The specific implementation process is briefly described below:

[0030] (I) First round of PCR amplification

[0031] The BTX reporter gene was amplified using the following primers, with adapter sequences introduced at both ends. The PCR reaction used the following primer pairs:

[0032] RASLBTX F:

[0033] 5'-gacggcggtctccgtcgtcaggatcatccgggcATGAAGATGATGAATGGTGAAGATG-3', SEQID No.5;

[0034] RASLBTX R:

[0035] 5'-cgatcggggaaattctctagattaAGCAGATGTGAACTTGTATGATC-3', SEQ ID No. 6;

[0036] Amplify the NOS terminator using the following primers:

[0037] NOS F: 5'-gaatttccccgatcgttcaaacatttg-3', SEQ ID No. 7;

[0038] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4.

[0039] The PCR reaction system and PCR amplification procedure are shown in Table 1 and Table 2.

[0040] Table 1 PCR reaction system

[0041] PhantaMaxSuper-FidelityDNAPolymerase 1μL 2×PhantaMaxBuffer 10μL dNTPMix 0.5μL upstream primer 0.8μL Downstream primer 0.8μL Template DNA 1μL Add double-distilled water to make up to the required level. 20μL

[0042] Table 2 PCR amplification program

[0043]

[0044]

[0045] The PCR products obtained from the amplification were then recovered using an enhanced agarose gel DNA recovery kit.

[0046] (II) Second round of PCR amplification

[0047] Using the two amplification products from the first round of PCR as templates, amplification was performed using the following primer pairs:

[0048] RAGE F: 5'-tcggccggcttgtcgacgacggcggtctccgtcgtca-3', SEQ ID No. 3;

[0049] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4.

[0050] The PCR reaction system and PCR amplification procedure are shown in Tables 3 and 4.

[0051] Table 3 PCR reaction system

[0052] PhantaMaxSuper-FidelityDNAPolymerase 5μL 2×PhantaMaxBuffer 50μL dNTPMix 2μL upstream primer 4μL Downstream primer 4μL Template DNA 1+1μL Add double-distilled water to make up to the required level. 100μL

[0053] Table 4 PCR amplification program

[0054]

[0055] The PCR products obtained from the amplification were recovered using a standard DNA product purification kit.

[0056] (III) Protoplast Transformation

[0057] PCR plasmids were extracted using an endotoxin-free plasmid extraction kit. The PCR fragment RASL-BTX was added to 100 μL of the extracted protoplasts, gently swirled to mix, and incubated in the dark for 10 minutes. Protoplast transformation solution was then added, gently swirled to mix, and incubated in the dark for 30 minutes. The reaction was terminated by adding W5 solution, and the transformation solution was discarded by centrifugation. The transformed protoplasts were resuspended in W5 solution.

[0058] (iv) Observation of Expression Results

[0059] After the transformed protoplasts were incubated overnight at room temperature, the cells were observed under an optical microscope equipped with a fluorescence system. Figure 2 As observed, yellow protoplasts were seen under bright field, and the autofluorescence of betaine was visible under a fluorescence microscope.

[0060] Example 2

[0061] Recombinase-activated expression cells express EGFP protein

[0062] In this embodiment, the PCR product of EGFP was first prepared through two PCR reactions. Then, this PCR product was co-transformed into protoplasts with a pRAGE helper plasmid. Finally, the expression of EGFP was observed using a fluorescence microscope.

[0063] The specific implementation process is briefly described below:

[0064] (I) First round of PCR amplification

[0065] The EGFP gene was amplified using the following primers, with adapter sequences introduced at both ends. The PCR reaction used the following primer pairs:

[0066] RASLGFP F:

[0067] 5'-gacggcggtctccgtcgtcaggatcatccgggcatggtgagcaagggcgaggag-3', SEQ IDNo.8;

[0068] RASLGFP R:

[0069] 5'-tgtttgaacgatcggggaaattctctagattacttgtacagctcgtccatgcc-3', SEQ IDNo.9;

[0070] Amplify the NOS terminator using the following primers:

[0071] NOS F: 5'-gaatttccccgatcgttcaaacatttg-3', SEQ ID No. 7;

[0072] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4.

[0073] The PCR reaction system and PCR amplification procedure are shown in Tables 5 and 6.

[0074] Table 5 PCR reaction system

[0075] PhantaMaxSuper-FidelityDNAPolymerase 1μL 2×PhantaMaxBuffer 10μL dNTPMix 0.5μL upstream primer 0.8μL Downstream primer 0.8μL Template DNA 1μL Add double-distilled water to make up to the required level. 20μL

[0076] Table 6 PCR Amplification Procedure

[0077]

[0078] The PCR products obtained from the amplification were then recovered using an enhanced agarose gel DNA recovery kit.

[0079] (II) Second round of PCR amplification

[0080] Using the two amplification products from the first round of PCR as templates, amplification was performed using the following primer pairs:

[0081] RAGE F: 5'-tcggccggcttgtcgacgacggcggtctccgtcgtca-3', SEQ ID No. 3;

[0082] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4.

[0083] The PCR reaction system and PCR amplification procedure are shown in Tables 7 and 8.

[0084] Table 7 PCR reaction system

[0085]

[0086]

[0087] Table 8 PCR Amplification Procedure

[0088]

[0089] The PCR products obtained from the amplification were recovered using a standard DNA product purification kit.

[0090] (III) Protoplast Transformation

[0091] Add the pRAGE plasmid and PCR fragment RASL-EGFP to 100 μL of extracted and isolated protoplasts, gently tap to mix, and incubate in the dark for 10 minutes. Then add protoplast transformation solution, gently tap to mix, and incubate in the dark for 30 minutes. Stop the reaction by adding W5 solution, centrifuge to discard the transformation solution, and resuspend the transformed protoplasts in W5 solution.

[0092] (iv) Observation of Expression Results

[0093] After the transformed protoplasts were incubated overnight at room temperature, the cells were observed under an optical microscope equipped with a fluorescence system. Figure 3 As observed, the fluorescent protein EGFP was successfully expressed in protoplasts.

[0094] Example 3

[0095] Subcellular localization of HOX3 protein was studied using recombinase-activated expression.

[0096] In this embodiment, the PCR product of HOX3 was first prepared through two PCR reactions, and then the PCR product was co-transformed with a pRAGE helper plasmid into protoplasts (e.g., Figure 4 (As shown). Finally, the subcellular localization of HOX3 protein was observed using fluorescence microscopy.

[0097] The specific implementation process is briefly described below:

[0098] (I) First round of PCR amplification

[0099] The HOX3 gene was amplified using the following primers, with adapter sequences introduced at both ends. The PCR reaction used the following primer pairs:

[0100] RASLHOX3 F:

[0101] 5'-gacggcggtctccgtcgtcaggatcatccgggcATGGAGGCCGAATTCATGGATTG-3', SEQ ID No. 10;

[0102] RASLHOX3 R:

[0103] 5'-tcctcgcccttgctcaccatAGAACTAGGACCATTCAAAGCAGCC-3', SEQ ID No. 11;

[0104] Amplify the EGFP-NOS terminator sequence using the following primers:

[0105] EGFP-NOS F: 5'-atggtgagcaagggcgaggag-3', SEQ ID No. 8;

[0106] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4.

[0107] The PCR reaction system and PCR amplification procedure are shown in Tables 9 and 10.

[0108] Table 9 PCR Reaction System

[0109] PhantaMaxSuper-FidelityDNAPolymerase 1μL 2×PhantaMaxBuffer 10μL dNTPMix 0.5μL upstream primer 0.8μL Downstream primer 0.8μL Template DNA 1μL Add double-distilled water to make up to the required level. 20μL

[0110] Table 10 PCR Amplification Procedure

[0111]

[0112] The PCR products obtained from the amplification were then recovered using an enhanced agarose gel DNA recovery kit.

[0113] (II) The second round of PCR amplification uses the two amplification products from the first round of PCR as templates and is performed using the following primer pairs:

[0114] RAGE F: 5'-tcggccggcttgtcgacgacggcggtctccgtcgtca-3', SEQ ID No. 3;

[0115] NOS R: 5'-aaaacgacggccagtgaattgatctagtaacatagatgacaccgcgc-3', SEQ ID No. 4. The PCR reaction system and PCR amplification program are shown in Tables 11 and 12.

[0116] Table 11 PCR reaction system

[0117] PhantaMaxSuper-FidelityDNAPolymerase 5μL 2×PhantaMaxBuffer 50μL dNTPMix 2μL upstream primer 4μL Downstream primer 4μL Template DNA 1+1μL Add double-distilled water to make up to the required level. 100μL

[0118] Table 12 PCR Amplification Procedure

[0119]

[0120]

[0121] The PCR products obtained from the amplification were recovered using a standard DNA product purification kit.

[0122] (III) Protoplast Transformation

[0123] Add the pRAGE plasmid and PCR fragment RASL-HOX3 to 100 μL of extracted and isolated protoplasts, gently tumble to mix, and incubate in the dark for 10 minutes. Then add protoplast transformation solution, gently tumble to mix, and incubate in the dark for 30 minutes. Stop the reaction by adding W5 solution, centrifuge to discard the transformation solution, and resuspend the transformed protoplasts in W5 solution.

[0124] (iv) Observation of Expression Results

[0125] After the transformed protoplasts were incubated overnight at room temperature, the cells were observed under an optical microscope equipped with a fluorescence system. Figure 5As observed, the HOX3 protein is located in the cell nucleus.

[0126] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A recombinase-activated expression vector pRAGE, characterized in that, The expression vector pRAGE includes a Bxb1 recombinase expression cassette, a 35S promoter, and an attP site located downstream of the promoter. The sequence of the expression vector pRAGE is shown in SEQ ID No.

12.

2. A method for expression of recombinase activation, characterized in that, The expression method includes the following steps: 1) A PCR product containing an attB sequence was introduced into the N-terminus of the gene to be expressed by PCR primer amplification to obtain the gene-terminator PCR product. 2) After co-transforming protoplasts with the PCR product of the gene-terminator obtained in step 1) and the expression vector pRAGE described in claim 1, recombinase expression causes the attP site of the expression vector pRAGE to recombine with the attB site of the gene to be expressed, thereby expressing the gene to be expressed.

3. The expression method according to claim 2, characterized in that, In step 1), When the template for amplification contains a suitable terminator for the gene to be expressed, the PCR product of the gene to be expressed and the terminator can be obtained directly by performing the amplification operation. When the template being amplified does not contain a terminator suitable for the gene to be expressed, a terminator is introduced at the C-terminus of the gene to be expressed by overlapping extension PCR, resulting in a PCR product of gene to be expressed and terminator.

4. The expression method according to claim 2, characterized in that, The connector sequence in step 1) is shown in SEQ ID No. 1 and SEQ ID No.

2.

5. The expression method according to claim 2, characterized in that, The amplification primer sequences for the PCR operation in step 1) are shown in SEQ ID No. 3 and SEQ ID No.

4.

6. The application of the expression vector pRAGE according to claim 1 and the expression method according to any one of claims 2 to 5 in protein subcellular localization.

7. The application of the expression vector pRAGE according to claim 1 and the expression method according to any one of claims 2 to 5 in the screening of protein functional sites.

8. The application of the expression vector pRAGE according to claim 1 and the expression method according to any one of claims 2 to 5 in the screening of key regions / sites of protein interaction.

Images