Brassica rapa downy mildew detection method based on crispr / cas12a and related materials and applications thereof

Abstract

The application discloses a CRISPR / Cas12a-based Chinese cabbage downy mildew detection method and related materials and applications thereof, and specifically discloses a Cas12a guide RNA molecule for cutting a rDNA-ITS sequence of a Peronospora sp., wherein the guide RNA molecule comprises a targeting sequence and a structure sequence, the nucleic acid sequence of the targeting sequence is the 4th to the 24th of sequence 1, and the nucleic acid sequence of the structure is the 25th to the 44th of sequence 1. The guide RNA molecule and detection primers designed for the target are used for performing cas12a-RPA detection on a to-be-detected sample, and the result shows that whether the sample contains a target genome can be quickly and directly detected, and the method can be used in industrial and agricultural production.

Description

Technical Field

[0001] This invention specifically relates to a method for detecting downy mildew in Chinese cabbage based on CRISPR / Cas12a, as well as related materials and applications. Background Technology

[0002] Chinese cabbage (Brassica rapa L.ssp.pekinensis) is one of the most important economic vegetable crops in my country.

[0003] Downy mildew is caused by the parasitic fungus *Peronospora parasitica* (Pers.) Fr., a vivipary oomycete belonging to the subphylum Oomycetes, order Peronosporales, family Peronosporaceae, and genus *Peronospora*. It is an obligate parasite and a significant disease that seriously harms the yield and quality of Chinese cabbage. Downy mildew has a high incidence rate, affecting Chinese cabbage throughout its entire growth cycle. On true leaves, it manifests as polygonal or irregular yellow lesions on the upper surface, limited by leaf veins. In humid conditions, a white mold layer can develop on the lower surface of the leaves. When numerous lesions merge, they can cause large areas of leaf death. In epidemic years, it can lead to a significant reduction in Chinese cabbage yield. Downy mildew is a crucial factor restricting the safe production of Chinese cabbage. Because downy mildew fungi are extremely small, they are easily overlooked in the early stages, and once they occur, they are difficult to treat. Therefore, there is an urgent need to establish a rapid and efficient field pathogen detection technology for the early control of Chinese cabbage diseases.

[0004] Rapid field diagnosis of pathogens affecting Chinese cabbage is crucial for the prediction and control of these diseases. Existing nucleic acid detection methods include polymerase chain reaction (PCR), multiplex PCR, droplet digital PCR (ddPCR), and real-time fluorescence quantitative PCR (qPCR). These methods are widely used for pathogen detection due to their high specificity and sensitivity, but they rely on expensive equipment and are limited by laboratory operation. Loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) can be performed at room temperature without relying on equipment, but their detection sensitivity is relatively low. Gene chip detection methods offer high throughput, but their detection sensitivity is low and they are expensive. Detection of pathogens using immunoassay methods relies on the preparation and screening of pathogen-specific antibodies.

[0005] In recent years, the rapidly developing CRISPR / Cas genome editing technology has been widely applied in crop genome editing and nucleic acid detection. Currently, the most widely used are class II CRISPR / Cas systems, including type II Cas9, type V Cas12, and type VI Cas13. In these systems, specific crRNA sequences can be designed to identify the corresponding nucleic acid sequences. Utilizing the principle that guide RNA specifically binds to the target sequence in its presence, thereby activating the trans-cleavage activity of the Cas protein, researchers have developed a series of detection platforms such as SHERLOCK, HOLMES, and DETECTR. The discovery of the trans-cleavage activity of the Cas protein has provided a new direction for detection technology. Summary of the Invention

[0006] The problem solved by this invention is how to identify downy mildew in Chinese cabbage.

[0007] To address the above problems, the present invention provides an RNA molecule.

[0008] The RNA molecule is a guide RNA molecule that can bind to Cas12a. The guide RNA molecule includes a target region and a scaffold region. The nucleic acid sequence of the target region is from position 4 to position 24 of sequence 1, and the nucleic acid sequence of the scaffold region is from position 25 to position 44 of sequence 1.

[0009] In the guide RNA molecule, the scaffold region is located at the 5' end, and the targeting region is located at the 3' end.

[0010] In this application, the scaffold region is a component of the Cas12a gRNA (Cas12a guide RNA) of this disclosure, which contains a segment recognized by the Cas12a protein. The scaffold region may contain a nucleotide sequence of a naturally occurring stem-loop sequence recognized by the Cas12a protein, or it may contain an engineered nucleotide sequence forming a segment recognized by the Cas12a protein. See, for example, Zetsche et al., 2015, Cell 163:759-771.

[0011] In the above text, the nucleic acid sequence of the guide RNA molecule may be the 4th to 44th positions of sequence 1.

[0012] In the above text, the nucleic acid sequence of the guide RNA molecule may also be sequence 1.

[0013] To address the aforementioned problems, the present invention also provides biomaterials.

[0014] The biomaterial includes any of the following:

[0015] A1) The genes of the aforementioned RNA molecules;

[0016] A2), an expression cassette containing the gene described in A1).

[0017] In the aforementioned biological materials, regarding the gene described in A1), those skilled in the art can easily mutate the nucleotide sequence of the guide RNA gene of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the guide RNA gene isolated in the present invention, as long as they can produce the guide RNA of the present invention, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0018] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0019] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0020] In the aforementioned biological materials, the expression cassette described in A2) refers to DNA capable of expressing the gene in host cells. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. The promoter may be a T7 promoter. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters.

[0021] In the above text, the nucleotide sequence of the encoding gene described in A1) may be the 26th to 66th positions of sequence 10.

[0022] In the above text, the nucleotide sequence of the expression cassette described in A2) may be sequence 10.

[0023] To address the above problems, the present invention also provides a method for preparing guide RNA molecules.

[0024] The guide RNA molecule is the guide RNA molecule described above, and the method includes the step of transcribing the biological material described above.

[0025] In the above text, the transcription process can be in vitro. The in vitro transcription can be performed using an in vitro transcription kit. The in vitro transcription kit can be NEB's HiScribe. TM T7HighYieldRNA Synthesis Kit in vitro.

[0026] The preparation method described above also includes a purification step. This purification step is performed using a purification kit. The purification kit can be the company's RNAClean & Concentrator-25 kit.

[0027] To address the aforementioned problems, the present invention also provides a kit for detecting downy mildew in Chinese cabbage.

[0028] The world includes the guide RNA molecule and Cas12a protein prepared as described above or by the methods described above.

[0029] In the kit, the molar ratio of the guide RNA molecule to the Cas12a protein can be 1:1.

[0030] The kit is used to detect samples taken from Chinese cabbage that exhibit symptoms of white mold growth on the underside of the leaves.

[0031] The kit described above also includes a detection probe, which is either ssDNAprobe 1 or ssDNAprobe 2. ssDNAprobe 1 is a single-stranded DNA with the nucleotide sequence of sequence 7, and ssDNAprobe 2 is a single-stranded DNA with the nucleotide sequence of sequence 8.

[0032] In the kit, the molar ratio of the guide RNA molecule, the Cas12a protein, and the detection probe can be 1:1:10.

[0033] A method for detecting downy mildew in Chinese cabbage includes using Cas12a protein, the aforementioned guide RNA molecule, fluorescently labeled reporter DNA, and the test reactant, and determining the result based on the color development of the fluorescent reporter group.

[0034] The test reactant can be a PCR amplification product. The PCR amplification product can be a product amplified using primer pair RPA-Downy-ITS. The fluorescently labeled reporter DNA can be a detection probe. The detection probe can be ssDNAprobe 1 or ssDNAprobe 2.

[0035] In the above text, the Cas12a protein may be... Lba Cas12a(Cpf1).

[0036] The kit described above also includes in vitro reagents for cleaving the Cas12a protein. These in vitro reagents may be NEBuffer r2.1 Reaction Buffer.

[0037] In the above description, the concentration of Cas12a protein in the mixed reaction system can be 50 nM. The concentration of guide RNA molecules can be 50 nM. The detection probe concentration is 500 nM. The proportion of the amplification product of the sample to be tested in the total reaction system can be 1 / 10.

[0038] The primer pair RPA-Downy-ITS-F consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein the RPA-Downy-ITS-F sequence is sequence 5 and the RPA-Downy-ITS-R sequence is sequence 6.

[0039] The kit described above also includes a detection probe, ssDNAprobe 3, which is a single-stranded DNA with a nucleotide sequence of sequence 9.

[0040] In the kit, the molar ratio of the guide RNA molecule, the Cas12a protein, and the detection probe can be 1:1:10.

[0041] The above-mentioned kit further includes a colloidal gold test strip for detecting downy mildew in Chinese cabbage, characterized in that one end of the ssDNAprobe 3 is labeled with fluorescein and the other end is labeled with biotin, the test strip includes a conjugate pad, a detection line and a control line, the conjugate pad is coated with colloidal gold-labeled streptavidin, the detection line is coated with biotin-labeled protein, and the control line is coated with fluorescein antibody.

[0042] In the above text, the colloidal gold labeled streptavidin colloidal gold can have a diameter of 15 nm.

[0043] The colloidal gold-labeled streptavidin mentioned above was purchased from Bio-Sen Corporation, catalog number bs-0437P-Gold.

[0044] In the above text, the biotin-labeled protein can be biotin-labeled bovine serum albumin. The bovine serum albumin can be purchased from Sangon Biotech (Shanghai) Co., Ltd., catalog number A600332-0100.

[0045] In the above text, the control line of the test strip is coated with Biotin / BSA. The Biotin / BSA, also known as biotin-labeled BSA, was purchased from Beijing Solarbio Science & Technology Co., Ltd., catalog number SHB063-1ml.

[0046] The biotin-labeled protein may be a biotin-labeled carrier protein. The carrier protein may be a protein that can serve as a carrier, such as bovine serum albumin, hemocyanin, human serum albumin, ovalbumin, mouse serum albumin, thyroglobulin, or rabbit serum albumin.

[0047] In the above text, the volume of the colloidal gold-labeled streptavidin coating is 3 μL.

[0048] In the above text, the concentration of biotin-labeled bovine serum albumin coating was 0.5 mg / mL.

[0049] In the above text, the concentration of the fluorescein antibody coating is 1 mg / mL.

[0050] In any of the kits described above, the kit further includes primer pair RPA-Downy-ITS-F, which consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein RPA-Downy-ITS-F is a single-stranded DNA with nucleotide sequence of sequence 5, and RPA-Downy-ITS-R is a single-stranded DNA with nucleotide sequence of sequence 6.

[0051] To address the aforementioned problems, the present invention also provides a method for detecting the pathogen causing downy mildew in Chinese cabbage.

[0052] The method includes amplifying the DNA of the sample to be tested using primer pair RPA-Downy-ITS-F to obtain the amplification product of the sample to be tested; reacting the Cas12a protein, the RNA molecule as described in claim 1, the amplification product of the sample to be tested, and a detection probe; and determining whether the sample contains the pathogen of downy mildew of Chinese cabbage by detecting the cleavage of the detection probe; wherein the primer pair RPA-Downy-ITS-F consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein RPA-Downy-ITS-F is a single-stranded DNA with nucleotide sequence sequence 5, and RPA-Downy-ITS-R is a single-stranded DNA with nucleotide sequence sequence 6;

[0053] The detection probe is either ssDNAprobe 1 or ssDNAprobe 2, wherein ssDNAprobe 1 is a single-stranded DNA with nucleotide sequence 7, and ssDNAprobe 2 is a single-stranded DNA with nucleotide sequence 8.

[0054] The pathogen causing downy mildew in Chinese cabbage is *Peronospora parasitica* (Pers.) Fr. The test sample can be taken from Chinese cabbage exhibiting symptoms of white mold growth on the underside of the leaves.

[0055] To address the aforementioned problems, the present invention also provides a colloidal gold test strip for detecting downy mildew in Chinese cabbage.

[0056] The colloidal gold test paper is the colloidal gold test paper according to claim 7 or 8.

[0057] A method for detecting downy mildew in Chinese cabbage includes reacting Cas12a protein, the aforementioned guide RNA molecule, fluorescently labeled reporter DNA, and a test reactant to obtain a mixed reactant, detecting the mixed reactant using the aforementioned colloidal gold test strip for detecting downy mildew in Chinese cabbage, and determining the result based on the color development of the test strip.

[0058] The test reactant can be a PCR amplification product. The PCR amplification product can be a product amplified using primer pair RPA-Downy-ITS. The fluorescently labeled reporter DNA can be a detection probe. The detection probe can be ssDNAprobe 3.

[0059] If the T test line on the test strip shows color but the C test line does not show color, then the reactant being tested contains downy mildew of Chinese cabbage.

[0060] If the T test line on the test strip shows color and the C test line shows color, then the reactant being tested contains downy mildew of Chinese cabbage.

[0061] If the T test line on the test strip does not show color, but the C test line shows color, then the test sample does not contain downy mildew of Chinese cabbage.

[0062] If the T test line on the test strip does not develop color, or the C test line does not develop color, then the test is invalid.

[0063] A method for detecting downy mildew in Chinese cabbage, comprising: amplifying the DNA of a test sample using primer pair RPA-Downy-ITS-F to obtain the amplification product of the test sample; mixing Cas12a protein, the aforementioned guide RNA molecule, the amplification product of the test sample, and a detection probe (ssDNA probe 3) for a reaction; detecting the amplification product of the test sample using the aforementioned colloidal gold test strip for detecting downy mildew in Chinese cabbage; and determining whether the sample DNA contains downy mildew DNA based on the detection results.

[0064] In the above description, the concentration of Cas12a protein in the mixed reaction system can be 50 nM. The concentration of guide RNA molecules can be 50 nM. The detection probe concentration is 500 nM. The proportion of the amplification product of the sample to be tested in the total reaction system can be 1 / 10.

[0065] The primer pair RPA-Downy-ITS-F consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein the RPA-Downy-ITS-F sequence is sequence 5 and the RPA-Downy-ITS-R sequence is sequence 6.

[0066] The method for preparing the colloidal gold test strip for detecting downy mildew of Chinese cabbage described above includes spraying 0.5 mg / mL of Biotin / BSA antibody onto the detection line, spraying 1 mg / mL of anti-FITC antibody onto the control line, spraying 3 μL of SA-AuNPs onto the colloidal gold pad, assembling the test strip, and obtaining the colloidal gold test strip for detecting downy mildew of Chinese cabbage.

[0067] The above-described RNA molecules, the above-described biological materials, any of the above-described kits, or the above-described test strips may be used in any of the following ways:

[0068] P1. Application in the detection of downy mildew;

[0069] P2. Application in the preparation and detection of downy mildew products.

[0070] The downy mildew mentioned refers to downy mildew of Chinese cabbage.

[0071] Beneficial effects

[0072] In this invention, addressing the problems of existing technologies, we established a visualized on-site Cas-BrRPA detection platform based on the real-time quantitative PCR method for detecting pathogens and the trans-cleavage activity of CRISPR / Cas12a, using this method as a standard. Building upon this, we will combine colloidal gold flow immunochromatographic strips to establish a field detection platform, Cas-AIRPA. The purpose of this invention is to establish a complete, efficient, rapid, and specific detection system for downy mildew in Chinese cabbage.

[0073] This invention discloses a CRISPR / Cas12a-based method for detecting downy mildew in Chinese cabbage, along with related materials and applications. Specifically, it discloses a Cas12a guide RNA molecule for cleaving the rDNA-ITS sequence of downy mildew. The guide RNA molecule includes a target sequence and a structural sequence. The nucleic acid sequence of the target sequence is positions 4-22 of sequence 1, and the nucleic acid sequence of the structural sequence is positions 23-42 of sequence 1. Using the guide RNA molecule and target-designed detection primers, Cas12a-RPA detection was performed on the sample. The results show that the presence of the target genome in the sample can be detected rapidly and intuitively, and this method can be used in industrial and agricultural production. Attached Figure Description

[0074] Figure 1 This is a schematic diagram of the Cas-BrRPA platform testing process.

[0075] Figure 2 This is a schematic diagram of the Cas-AIRPA platform testing process.

[0076] Figure 3 This is a schematic diagram illustrating the principle of test strip detection.

[0077] Figure 4 Structural optimization of crRNA for downy mildew.

[0078] Figure 5 A diagram illustrating the specificity of CRISPR / Cas12a in detecting downy mildew nucleic acid.

[0079] Figure 6 A validation diagram showing the highest sensitivity of CRISPR / Cas12a in detecting downy mildew nucleic acid.

[0080] Figure 7 This is a visualization of the detection results for downy mildew.

[0081] Figure 8 The graph shows the minimum detection line for the test strips used to detect downy mildew.

[0082] Figure 9 To plot the standard curve for downy mildew and the minimum detection line for quantitative fluorescence detection of downy mildew.

[0083] Figure 10 Filter the chart for the positions of lines C and T.

[0084] Figure 11 This is a screening chart for colloidal gold concentration and probe concentration.

[0085] Figure 12 Concentration screening charts for the T-line and C-line.

[0086] Figure 13 This is a graph showing the lowest detection line for the downy mildew test strip.

[0087] Figure 14 The image shows the results of quantitative fluorescence detection of downy mildew. Detailed Implementation

[0088] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0089] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0090] The following examples use SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference (please change according to the actual situation).

[0091] Experimental materials, reagents and methods

[0092] Experimental materials

[0093] The pathogen causing downy mildew in Chinese cabbage, *Peronospora parasitica* (Pers.) Fr., is described in the following literature: "Evaluating multiple resistance to major diseases in a core set of inbred lines of *Brassica rapa atseedling stage*". This biological material was obtained from the Chinese cabbage research group at the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences. The public can obtain this biological material from the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences. This biological material is only for repeating experiments of this invention and should not be used for other purposes.

[0094] The cabbage used in this experiment was grown at the farm of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0095] Experimental reagents

[0096] Table 1 Experimental Reagents

[0097]

[0098]

[0099] Experimental instruments

[0100] Table 2 Experimental Instruments

[0101] Real-time quantitative PCR system 7500 Real-time PCR System Thermo Fisher Scientific LUYOR fluorescence excitation source 3415CV American Luyang Mili-Q Ultrapure Water System Smart-Q15 He Tai Analytical balance BSA323S Sartorius pH meter Pb-10 Sartorius Digital display constant temperature magnetic stirrer T6-SH-HZ85-2 Tianjin Liyuan Environmental Protection Technology Co., Ltd. Film scraping instrument HM3030 Shanghai Jieyi Biotechnology Co., Ltd. Automatic chopping machine ZQ2002 Shanghai Jieyi Biotechnology Co., Ltd.

[0102] Designed nucleic acid sequence

[0103] Table 3 Nucleic Acid Sequences

[0104]

[0105]

[0106] The nucleotide sequence of the D1-1 transcribed RNA is: 5'-gggUAAUUUCUACUAAGUGUAGAUCACGUGAACCGUAUUAACAA-3', corresponding to sequence 1 in the sequence listing: 5'-gggTAATTTCTACTAAGTGTAGATCACGTGAACCGTATTAACAA-3'. In sequence 1, T represents U.

[0107] The nucleotide sequence of the D1-2 transcribed RNA is: 5'-gggAAUUUCUACUGUUGUAGAUCACGUGAACCGUAUUAACAA-3', corresponding to sequence 2 in the sequence listing: 5'-gggAATTTCTACTGTTGTAGATCACGTGAACCGTATTAACAA-3'. In sequence 2, T represents U.

[0108] The nucleotide sequence of the D2-1 transcribed RNA is: 5'-gggUAAUUUCUACUAAGUGUAGAUGUGAAGUAGUGAAAAUUUUA-3', corresponding to sequence 3 in the sequence listing: 5'-gggTAATTTCTACTAAGTGTAGATGTGAAGTAGTGAAAATTTTA-3'. In sequence 3, T represents U.

[0109] The nucleotide sequence of the D2-2 transcribed RNA is: 5'-gggAAUUUCUACUGUUGUAGAUGUGAAGUAGUGAAAAUUUUA-3', corresponding to sequence 4 in the sequence listing: 5'-gggAATTTCTACTGTTGTAGATGTGAAGTAGTGAAAATTTTA-3'. In sequence 4, T represents U.

[0110] Example 1: Establishment of CRISPR / Cas12a detection system - design and optimization of crRNA structure

[0111] Design of perennial crRNA

[0112] The GenBank accession number for *Peronospora spp.* in NCBI is JF975613. Based on the *Peronospora spp.* rDNA-ITS sequence, crRNAs were designed. Two crRNAs were designed for *Peronospora spp.* in this experiment, named DcrRNA1 and DcrRNA2 respectively (see Table 3 for details). Two commonly used scaffold structures are: scaffold 1: UAAUUUCUACUAAGUGUAGAU; scaffold 2: AAUUUCUACUGUUGUAGAU. Bioengineering synthesized two oligonucleotide chains containing the T7 promoter sequence (gaaattaatacgactcactataggg) + scaffold structure + *Peronospora spp.* target site crRNA sequence. Two crRNA sequences and two scaffold structures were combined to form a total of four crRNA structures, named: D1-1 (DcrRNA1+scaffold1), D1-2 (DcrRNA1+scaffold2), D2-1 (DcrRNA2+scaffold1), and D2-2 (DcrRNA2+scaffold2) [as shown in Table 3]. The stability of the four crRNA structures was then predicted on the RNAfold web server website, and the free energy of the four crRNA structures was calculated on the RNAFolding Form V2.3 website to predict the optimal crRNA structure for detecting downy mildew. The prediction results showed that ( Figure 4 The secondary structure of crRNA from D1-1 is the most stable. The closer the colorimetric value is to red, the more stable the secondary structure of the RNA. The dG value represents the energy of the secondary structure of the RNA; the lower the energy value, the more stable the structure (dG). D1-1 =-6.30; dG D1-2 = -5.80; dG D2-1 =-6.00; dG D2-2 =-5.50). In in vitro experiments, the four synthesized crRNA structures were transcribed and purified, and the optimal crRNA structure was verified by measuring the Rn value of the CRISPR / Cas12 detection system. RNAfold web server URL: (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), RNAFolding Form V2.3 URL: http: / / www.unafold.org / mfold / applications / rna-folding-form-v2.php

[0113] Downy mildew crRNA transcription and purification

[0114] Two oligonucleotide chains (D1-1-F / R, D1-2-F / R, D2-1-F / R, and D2-2-F / R) synthesized bioengineering were centrifuged at 4,000 rpm for 60 seconds. DNase / RNase-Free water was added to a concentration of 100 μM, and the mixture was vortexed and set aside. In a DNase / RNase-Free PCR tube, 10 μL of each of the upstream and downstream primers were added and mixed thoroughly. The tube was placed on a PCR instrument and incubated at 95°C for 3 min, followed by cycles of 90°C for 30 sec, 85°C for 30 sec, 80°C for 30 sec, 75°C for 30 sec, 70°C for 30 sec, 65°C for 30 sec, 60°C for 30 sec, 55°C for 30 sec, 50°C for 30 sec, 45°C for 30 sec, and 40°C for 30 sec to obtain dsDNA. The concentration was measured by adding DNase / RNase-Free water to adjust the concentration to no higher than 1 μg / μL. Next, use NEB's HiScribe TM In vitro transcription was performed using the T7 High Yield RNA Synthesis Kit, followed by purification of the crRNA sequence using the NEB RNAClean & Concentrator-25 kit. The purified sequence concentration was adjusted to 1 μg / μL, and then further diluted to 200 ng / μL to obtain D1-1 transcribed RNA, D1-2 transcribed RNA, D2-1 transcribed RNA, and D2-2 transcribed RNA (as shown in Table 3). These were then aliquoted and stored at -80°C.

[0115] Preparation of Chinese cabbage containing clubroot fungus (Chinese cabbage with clubroot disease):

[0116] The Chinese cabbage containing clubroot fungus was a sample collected by our laboratory during an investigation of clubroot-affected Chinese cabbage in the Changyang Chinese cabbage production area of ​​Hubei Province. The clubroot disease in Chinese cabbage (also referred to as clubroot disease in this application) is caused by Plasmodiophora brassicae Woronin (which is described in the following literature: Evaluating multiple resistance to major diseases in a core set of inbred lines of Brassica rapa at the seedling stage). The Chinese cabbage in question is the variety FJ (FJ is described in the following literature: Evaluating multiple resistance to major diseases in a core set of inbred lines of Brassica rapa at the seedling stage, and is referred to as FJ or Fnjie in that literature).

[0117] Grading criteria for clubroot disease in Chinese cabbage:

[0118] Grading criteria for clubroot disease:

[0119] Grade 0, no attached root swelling;

[0120] Grade 1: Root swellings are attached to the lateral roots of Chinese cabbage, and their number is less than 25% of the total root system;

[0121] Grade 2: There are attached root swellings on the main root of the Chinese cabbage, accounting for more than 25% but less than 50% of the lateral roots;

[0122] Grade 3: There are attached root swellings on the main root of the Chinese cabbage, which account for 50% to 75% of the total root system;

[0123] Grade 4: There are attached root swellings on the main root of the Chinese cabbage, accounting for more than 75% of the total root system.

[0124] For details, please refer to the following reference: Reina. Exploration of prevention and control techniques for clubroot disease in Chinese cabbage [J]. Agricultural Technology and Equipment, 2019, (02): 16-17+20.

[0125] The DNA from Chinese cabbage with different clubroot disease conditions extracted using the CTAB method was amplified by PCR using primers (DNA-Club-ITS-F: CGGAGTGGTCGAACTTCATT; DNA-Club-ITS-R: GTTACCATACCCAGGGCGAT). The PCR reaction system included: 10× PCR buffer (containing Mg...). 2+ 2 μL, 2.5 mmol·L-1 dNTPmix 1.8μL, 5U·μL -1 Taq enzyme 0.2 μL (all reagents were provided by TaKaRa), gel extraction and sequencing were performed. The sequencing results (rDNA-ITS sequences) are shown below:

[0126] CGGAGTGGTCGAACTTCATTAAATTTGGGCTCTTAGAAGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGCGTCGTCGTCGGCGCCGCCTACAGGAGCTGGTCCTTCCAGCACGGTCATCGCCCGGGAAGCCTTAGCAGCCGGAAACGGTGCTGAACGCGA CTTTGTAAAAAACAACGAGTCAGCTTGAATGCTAGTGTGGCGCGCGCCATGCGACACTGTTAAATTGCGGGGACCCCCTGAAGCTTTGTCTTACCAAGTGCTTTGTGCGCGAAAGCGCCAGCATGGCCGAGCCAATCGCCCTGGGTATGGTAAC (Sequence 11).

[0127] BLAST alignment showed that the above sequence was partially identical to the DNA-ITS sequence of Plasmodiophorabrassicae Woronin (GenBank accession number: AF231027.1), indicating that all different grades of clubroot-infected Chinese cabbage used in this application contained Plasmodiophorabrassicae Woronin. All clubroot-infected Chinese cabbage used in this invention were tested and found to be caused by Plasmodiophorabrassicae Woronin.

[0128] The Chinese cabbage infected with Verticillium wilt was grown in our laboratory at the Vegetable Research Institute Farm of Beijing Academy of Agricultural and Forestry Sciences. Verticillium wilt (also referred to as Verticillium wilt in this application) is caused by Verticillium dahliae Kleb (Verticillium dahliae is described in the following literature: Evaluating multiple resistance to major diseases in a core set of inbred lines of Brassica rapa at seedling stage). The Chinese cabbage in question is the variety Chun Yue Huang (Chun Yue Huang is described in the following literature: Wang Zhichen. New miniature Chinese cabbage variety Chun Yue Huang [J]. Gansu Agricultural Science and Technology, 2011(03):53-54., where it is called Chun Yue Huang).

[0129] Standards for Identifying the Disease Severity of Verticillium Wilt in Chinese Cabbage

[0130] Seedling disease grading standards:

[0131] Grade 0, the entire plant is disease-free;

[0132] Grade 1: Only the cotyledons turn yellow; the true leaves show no symptoms.

[0133] Grade 2: Cotyledons wither and die; 1-2 true leaves turn yellow.

[0134] Level 3: 3-4 true leaves turn yellow, while the heart leaf remains intact;

[0135] Level 4: The entire plant withers and clumps together, and the whole plant dies.

[0136] For details, please refer to: Han Ruijuan, Geng Lihua, Wang Weihong, et al. Pathogen identification of Verticillium wilt in Chinese cabbage in Beijing area [J]. Journal of Horticulture, 2012, 39(03):477-484. DOI:10.16420 / j.issn.0513-353x.2012.03.001.

[0137] DNA from Chinese cabbage with different Verticillium wilt diseases extracted using the CTAB method was amplified by PCR using primer sequences (DNA-Wilt-ITS-F: CGAGGGGATCATTACCGAGT; DNA-Wilt-ITS-R: AAACGACGCTCGGACAGG). The PCR reaction system included: 10× PCR buffer (containing Mg). 2+ 2 μL, 2.5 mmol·L -1 dNTPmix 1.8μL, 5U·μL -10.2 μL Taq enzyme (all reagents provided by TaKaRa), 2 μL template DNA, and 1.2 μL each of primers ITS1 and ITS4 (1000 μmol·L⁻¹). -1 The total volume was adjusted to 20 μL using ddH2O. The gel was then excised and the DNA was recovered for sequencing. The sequencing results (rDNA-ITS sequences) are shown below:

[0138] CGGAGGGATCATTACCGAGTATCTACTCATAACCCTTTGTGAACCATATTGTTGCTTCGGCGGCTCGTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTGTTTATACCAACG[ATACTTCTGAGTGTTCTTAGCGAACTATTAAAACTTTTAAC AACGGATCTCTTGGCTCTAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAAT]CATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTT (Sequence 12).

[0139] BLAST alignment showed that the above sequence was partially identical to the DNA-ITS sequence of *Verticillium dahliae Kleb* (GenBank accession number: JN564038), indicating that all different grades of *Verticillium dahliae*-infected Chinese cabbage used in this application contained *Verticillium dahliae Kleb*. All *Verticillium dahliae*-infected Chinese cabbage used in this invention were tested and confirmed to be caused by *Verticillium dahliae Kleb*.

[0140] The Chinese cabbage infected with black rot was grown in our laboratory at the Vegetable Research Institute Farm of the Beijing Academy of Agricultural and Forestry Sciences. Black rot in Chinese cabbage (also referred to as black rot in this application) is caused by *Xanthomonas campestris* pv. Campestris (Pammel) Dowson, a pathogen of *Brassica rapa* (described in the following literature: "Evaluating multiple resistance to major diseases in a core set of inbred lines of *Brassica rapa* at the seedling stage"). The Chinese cabbage in question is the CR Lichun variety (described in the following literature: "Evaluating multiple resistance to major diseases in a core set of inbred lines of *Brassica rapa* at the seedling stage," where it is referred to as CR-C or Crli Chun).

[0141] Black rot disease grading standards:

[0142] Disease severity grading criteria:

[0143] Level 0: No disease;

[0144] Grade 0.1: There is a small lesion on the leaf;

[0145] Grade 0.5: There are several small lesions on the leaves, or one large lesion on the leaves;

[0146] Grade 1: The diseased area on the leaf accounts for 1 / 4 of the leaf area;

[0147] Grade 2: The diseased area on the leaf accounts for 1 / 2 of the leaf area;

[0148] Grade 3: The diseased area on the leaf accounts for 3 / 4 of the leaf area;

[0149] Level 4: The diseased area covers more than 3 / 4 of the leaf area to the entire leaf.

[0150] DNA from Chinese cabbage with different black rot conditions extracted using the CTAB method was amplified by PCR using primers (DNA-Black-ITS-F: GATCGTCGCCTGTTCAGC; DNA-Black-ITS-R: ACGCATGCTTTCCCACTGT). The DNA was then excised from the gel and sequenced. The sequencing results (rDNA-ITS sequences) are shown below:

[0151] GATCGTCGCCTGTTCAGCGCGCACGCTGCGCCGGCACCAACCGAGCGCAAGTGCCGTACGCCGCAGAGCGATGCGGTAGGTGTTGCGCAGGATTTCCACTGTTACAGCGTGGCCGATTTCCAGCGCCGTCGCCGGCG CGGCGGGCCCACCTGGCGCGATCTCTCTCCTGCGTATGCATTCGCCCGCGTCACCCACGCTGCCGACTGGCCACGCGGTGCAGATCTGCAATGCGAGCAGGCACTGGCCGCACAGTGGGAAAGCATGCGT (Sequence 13).

[0152] BLAST alignment showed that the above sequence was partially identical to the DNA-ITS sequence of *Xanthomonas campestris* pv. *Campestris (Pammel) Dowson* (GenBank accession number: NZ_CP025750), indicating that all different grades of black rot-affected Chinese cabbage in this application contained *Xanthomonas campestris* pv. *Campestris (Pammel) Dowson*. All the black rot-affected Chinese cabbages used in this invention were tested and found to be caused by *Xanthomonas campestris* pv. *Campestris (Pammel) Dowson*.

[0153] The Chinese cabbage affected by downy mildew was grown in our laboratory at the Vegetable Research Institute Farm of the Beijing Academy of Agricultural and Forestry Sciences. Downy mildew in Chinese cabbage (also referred to as downy mildew in this application) is caused by *Peronospora parasitica* (Pers.) Fr. (*Peronospora parasitica* is described in the following literature: "Evaluating multiple resistance to major diseases in a core set of inbred lines of *Brassica rapa* at seedling stage"). The Chinese cabbage mentioned is variety R032 (also known as Jiaozhou two-leaf cabbage, described in the following literature: "Research and Utilization of Chinese Cabbage Germplasm Resources in my country," where it is named Jiaozhou two-leaf).

[0154] Downy mildew disease severity grading standards:

[0155] Level 0: No symptoms of infection;

[0156] Grade 1: Sparse brown spots on inoculated leaves, which do not spread;

[0157] Grade 3: The leaves have many lesions, most of which are sunken, and there is no mold layer on the underside of the leaves;

[0158] Level 5: Leaf lesions spread in all directions, and a small amount of mold grows on the underside of the leaves;

[0159] Level 7: The lesions cover more than 1 / 2 but less than 2 / 3 of the leaf surface and have a large amount of mold.

[0160] Level 9: The lesions cover more than 2 / 3 of the leaf surface and have a large amount of mold.

[0161] DNA from Chinese cabbage with different downy mildew symptoms extracted using the CTAB method was amplified by PCR using primers (DNA-Downy-ITS-F: GAACCTGCGGAAGGATCA; DNA-Downy-ITS-R: AATTCGCCAGCGTTCTTCATC). The DNA was then excised from the gel and sequenced. The sequencing results (rDNA-ITS sequences) are shown below:

[0162] GAACCTGCGGAAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACCGTATTAACAATTATAATTGGGGGTGATCTTAATGGAGGCTACTAGTCATTTTGGCTGGAGGGCTACTATCGAGTGAACCTTATCATGGCGAAAAACTAGACTTTTGTTTGGTGAAGTAGTGAAAATTTTAAACCTTACTTAAATACTGATTAT ACTGTGGGGACGAAAGTCTCTACTTTTATTCTAGATAACAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAATT (Sequence 14).

[0163] BLAST alignment showed that the above sequence was partially identical to the rDNA-ITS sequence of *Peronospora parasitica* (Pers.) Fr. (GenBank accession number: JF975613), indicating that all Chinese cabbages with different grades of downy mildew in this application contained *Peronospora parasitica* (Pers.) Fr. All downy mildew-infected Chinese cabbages used in this invention were tested and found to be caused by *Peronospora parasitica* (Pers.) Fr.

[0164] Preparation of leaves from cabbage infected with downy mildew (or cabbage infected with downy mildew):

[0165] DNA extraction from leaves of *Brassica napus* infected with downy mildew (either *Brassica napus* or *Brassica napus* var. *downy mildew*):

[0166] Referring to the DNA extraction method in Wang Mengyu's literature (Reference: CRISPR / Cas12a-based biosensing platform for the on-site detection of single-base mutants in gene-edited rice), we prepared the formulation of lysis buffer and buffer, which can obtain high-purity and high-concentration nucleic acid DNA within 5 minutes without the need for any instruments, as detailed below:

[0167] (1) Take about 100mg of the leaves of Chinese cabbage (downy mildew Chinese cabbage or downy mildew-infected Chinese cabbage) inoculated with downy mildew and put them in a centrifuge tube. After freezing with liquid nitrogen, crush the Chinese cabbage leaves with a glass rod.

[0168] (2) Add 800 μL of DNA extraction buffer to a centrifuge tube and stir with a glass rod for 1 min;

[0169] (3) Connect the filter column to the screw connector, adsorption column and collection tube in sequence. After installation, pour the supernatant in the centrifuge tube into the filter column. Install the screw connector and syringe above the filter column. Press the syringe to generate air pressure so that the supernatant passes through the filter column and adsorption column and finally enters the collection tube. Discard the filtrate and reinstall the collection tube (at this time the DNA is on the silica membrane of the adsorption column).

[0170] (4) Continue to add 400 μL of buffer I to the filter column, press the syringe, discard the filtrate, and reinstall the collection tube;

[0171] (5) Add 200 μL of buffer II to the filter column again, press the syringe, discard the filtrate, discard the filter column, and reinstall the collection tube.

[0172] Transfer the adsorption column to a new EP tube, add 60 μL of ddH2O, press the syringe to collect the genomic DNA solution, and store at -20°C.

[0173] The components and formulation of the DNA extraction buffer are as follows:

[0174] DNA extraction buffer: 295.4g guanidine thiocyanate (final concentration 5M), 3.0285g Tris (50mM), 2.9225g EDTA (20mM), 6.5mL Triton X-100 (21.3mM), adjust the pH to 6.4, and bring the volume to 500mL with deionized water.

[0175] The filter column, spiral connector, adsorption column, and collection tube were purchased from Hangzhou Laifeng Biotechnology Co., Ltd., and the syringe was purchased from Jiangsu Zhiyu Medical Equipment Co., Ltd.

[0176] The components and formulation of buffer I are as follows:

[0177] DNA Buffer I: 295.4g guanidine thiocyanate (5M), 3.0285g Tris (50mM), adjust pH to 6.4, and bring volume to 500mL with deionized water.

[0178] The components and formulation of Buffer II are as follows:

[0179] DNA Buffer II: 0.6057g Tris (10mM), 2.922g NaCl (100mM), adjust pH to 8.0, and bring volume to 500mL with deionized water.

[0180] Preparation of downy mildew fungus:

[0181] Preparation of downy mildew spores:

[0182] Our laboratory has been propagating downy mildew on live Chinese cabbage (R032 two-leaf Chinese cabbage variety). We put the cabbage leaves containing downy mildew into water, brush off the mold layer on the cabbage leaves, centrifuge at 12,000 rpm for 5 minutes to collect the precipitate and obtain downy mildew spores.

[0183] Extraction of Downy mildew DNA

[0184] (1) Collect downy mildew cells, then add 800 μL CTAB buffer lysis buffer, vortex for 1 min, and lyse at 65℃ for 30 min;

[0185] (2) Next, add 800 μL of DNA extraction buffer, invert and mix well to extract downy mildew, centrifuge for 10 min, and aspirate 600 μL of supernatant into a new centrifuge tube.

[0186] (3) Add 400 μL of isopropanol to the supernatant, mix by inverting, place at -20℃ for 30 min, centrifuge for 5 min and discard the supernatant.

[0187] (4) Add 700 μL of 75% alcohol, mix by inverting, centrifuge for 2 min, and discard the supernatant;

[0188] (5) Repeat step (4) once;

[0189] (6) Add 50 μL of ddH2O to obtain the extracted downy mildew DNA. Store at -20℃ after extraction.

[0190] RPA primer design for the downy mildew rDNA-ITS sequence:

[0191] Based on the RPA isothermal amplification primer design requirements, a pair of primers with a length of 30-35 bp and an amplification product within 150-500 bp, containing two crRNA sites, were designed on the rDNA-ITS sequence of *Peronospora chinensis*. The primer names are: RPA-Downy-ITS-F and RPA-Downy-ITS-R (as shown in Table 3).

[0192] RPA fragment amplification of the downy mildew rDNA-ITS sequence (RPA isothermal amplification of target nucleic acid):

[0193] Using the extracted genomic DNA as a template, isothermal amplification was performed using the designed RPA primers for *Peronospora chinensis*, as shown in the reaction system below:

[0194] Table 4

[0195]

[0196] After adding the reagents in sequence, let it stand at room temperature for 15 minutes to allow the reaction to proceed. Once the reaction is complete, adjust the double-stranded DNA concentration (OD = 260 / 280) to 200 ng / μL to obtain the RPA amplification product.

[0197] Cas-BrRPA Visualization Platform Detection

[0198] Design ssDNA reporter probes

[0199] Based on the signal types of reporter and quencher groups that can be detected by the 7500 Real-time PCR system, and the characteristic of CRISPR / Cas12a indiscriminately trans-cutting ssDNA, ssDNA probe2 (5'6-FAM-TTTTTTTT-TAMRA3' reporter probe) was designed for detecting bacterial fluorescence intensity using a quantitative fluorescence instrument. For visual detection of bacterial fluorescence intensity using the naked eye, ssDNAprobe1 (5'6-FAM-TTTTTTTT-BHQ13' reporter probe) was designed based on the luminescence colors of the reporter and quencher groups. For test strip detection of pathogens, since the C and T lines were labeled with anti-FITC antibody and Biotin / BAS respectively during test strip preparation, ssDNAprobe3 was designed using FITC and Biotin labeling, as: 5'6-FITC-TTTTTTTT-Biotin 3' reporter probe. After the probe is synthesized, the dry powder in brown tubes is stored in the dark, centrifuged at 12,000 rpm for 5 min, diluted to 10 μM working solution, and frozen at -20℃ for later use.

[0200] ssDNAprobe2 was diluted to a concentration of 10 μM with DNase / RNase-Free water and used in the following experiments.

[0201] Screening of crRNA structures in the CRISPR / Cas12a visualization detection system using quantitative fluorescence instruments:

[0202] The testing system is as follows:

[0203] Table 5

[0204]

[0205]

[0206] Chinese cabbage with first-level downy mildew disease: Chinese cabbage that meets the grading standards for downy mildew disease is classified as Chinese cabbage with first-level downy mildew disease.

[0207] Chinese cabbage with second-level downy mildew disease: Chinese cabbage that meets the grading standards for downy mildew disease is classified as Chinese cabbage with second-level downy mildew disease.

[0208] Leaves of Chinese cabbage with primary and secondary downy mildew were taken, and RPA amplification products of Chinese cabbage with primary and secondary downy mildew were prepared according to the above method.

[0209] Visualization of D1-1 transcribed RNA using CRISPR / Cas12a:

[0210] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Mix Lba Cas12a(Cpf1)(1X), NEBuffer r2.1 Reaction Buffer(10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA in Table 5) thoroughly and incubate at room temperature for 10 min to allow Cas12a and crRNA to fully assemble.

[0211] 2) Add the remaining three reagents and mix well.

[0212] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of D1-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0213] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), and the RPA amplification product of Chinese cabbage with primary downy mildew disease was used as the primary disease; the RPA amplification product of Chinese cabbage with secondary downy mildew disease was used as the secondary disease.

[0214] Visualization of D1-2 transcribed RNA using CRISPR / Cas12a:

[0215] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Mix Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-2 transcribed RNA (crRNA in Table 5) thoroughly and incubate at room temperature for 10 min to allow Cas12a and crRNA to fully assemble.

[0216] 2) Add the remaining three reagents and mix well.

[0217] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of D1-2 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0218] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), and the RPA amplification product of Chinese cabbage with primary downy mildew disease was used as the RPA amplification product for primary disease; the RPA amplification product of Chinese cabbage with secondary downy mildew disease was used as the RPA amplification product for secondary disease.

[0219] Visualization of D2-1 transcribed RNA using CRISPR / Cas12a:

[0220] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Mix Lba Cas12a(Cpf1)(1X), NEBuffer r2.1Reaction Buffer(10X), DNase / RNase-Free water and D2-1 transcribed RNA thoroughly and incubate at room temperature for 10 min to allow Cas12a and crRNA to fully assemble.

[0221] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and RPA product) and mix well.

[0222] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of D2-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0223] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), and the RPA amplification product of Chinese cabbage with primary downy mildew disease was used as the RPA amplification product for primary disease; the RPA amplification product of Chinese cabbage with secondary downy mildew disease was used as the RPA amplification product for secondary disease.

[0224] Visualization of D2-2 transcribed RNA using CRISPR / Cas12a:

[0225] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Mix Lba Cas12a(Cpf1)(1X), NEBuffer r2.1Reaction Buffer(10X), DNase / RNase-Free water and D2-2 transcribed RNA thoroughly and incubate at room temperature for 10 min to allow Cas12a to fully assemble with crRNA.

[0226] 2) Add the remaining three reagents and mix well (ssDNAprobe 2, ROX Reference Dye II and RPA product).

[0227] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of D2-2 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0228] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), and the RPA amplification product of Chinese cabbage with primary downy mildew disease was used as the RPA amplification product for primary disease; the RPA amplification product of Chinese cabbage with secondary downy mildew disease was used as the RPA amplification product for secondary disease.

[0229] The results are as follows Figure 4As shown (D1-1 is D1-1 transcribed RNA, D1-2 is D1-2 transcribed RNA, D2-1 is D2-1 transcribed RNA, D2-2 is D2-2 transcribed RNA, CK is the negative control, and primary and secondary diseases correspond to different template amplification results), two pairs of crRNAs (DcrRNA1 and DcrRNA2) were designed for downy mildew. The two commonly used scaffold structures (scaffold 1: UAAUUUCUACUAAGUGUAGAU; scaffold2: AAUUUCUACUGUUGUAGAU) were transcribed to synthesize the corresponding D1-1 (DcrRNA1+scaffold1), D1-2 (DcrRNA1+scaffold2), D2-1 (DcrRNA2+scaffold1), and D2-2 (DcrRNA2+scaffold2). The optimal crNRA and scaffold structures were screened using the Rn value, where Rn is the ratio of the fluorescence value of the reporter dye (FAM) to that of the inert reference dye (ROX II). The 7500 Real-time PCR system requires the addition of ROX II for fluorescence detection. ROX II is an inert reference dye that does not participate in the reaction itself, and its fluorescence signal value does not change with the experimental progress. The results show that ( Figure 4 The D1-1 crRNA structure is the optimal crRNA structure for detecting downy mildew, effectively distinguishing different downy mildew severity levels within 15 minutes. Both the predicted secondary structure stability of the crRNA and the detection results from the CRISPR / Cas12a detection system indicate that D1-1 is the optimal crRNA structure for detecting downy mildew.

[0230] CRISPR / Cas12a system detection specificity

[0231] Chinese cabbage with first-level clubroot disease: Chinese cabbage that meets the grading standards for clubroot disease is classified as first-level clubroot disease Chinese cabbage.

[0232] Class II clubroot diseased Chinese cabbage: Chinese cabbage that meets the grading standards for clubroot disease is classified as Class II clubroot diseased Chinese cabbage.

[0233] Chinese cabbage with first-level downy mildew disease: Chinese cabbage that meets the grading standards for downy mildew disease is classified as Chinese cabbage with first-level downy mildew disease.

[0234] Chinese cabbage with second-level downy mildew disease: Chinese cabbage that meets the grading standards for downy mildew disease is classified as Chinese cabbage with second-level downy mildew disease.

[0235] Chinese cabbage with first-level Verticillium wilt disease: Chinese cabbage that meets the grading standards for Verticillium wilt disease is classified as first-level Verticillium wilt disease Chinese cabbage.

[0236] Chinese cabbage with second-level Verticillium wilt disease: Chinese cabbage that meets the grading standards for Verticillium wilt disease is classified as second-level Verticillium wilt disease Chinese cabbage.

[0237] The experiment was divided into three groups: downy mildew group, clubroot group, and Verticillium wilt group.

[0238] Preparation of clubroot disease-level 1 disease template DNA: DNA was extracted from the roots of Chinese cabbage affected by the above-mentioned level 1 clubroot disease to obtain clubroot disease-level 1 disease template DNA.

[0239] Preparation of clubroot disease-secondary disease template DNA: Take the roots of Chinese cabbage with the above-mentioned secondary clubroot disease to obtain clubroot disease-secondary disease template DNA.

[0240] The control group template DNA was DNase / RNase-free water.

[0241] Preparation of downy mildew-level disease template DNA: DNA was extracted from the leaves of Chinese cabbage affected by the above-mentioned level 1 downy mildew disease to obtain downy mildew-level disease template DNA.

[0242] Preparation of downy mildew-secondary disease template DNA: DNA was extracted from the leaves of Chinese cabbage affected by the above-mentioned secondary downy mildew disease to obtain downy mildew-secondary disease template DNA.

[0243] Preparation of Verticillium wilt-level disease template DNA: DNA was extracted from the leaves of Chinese cabbage affected by Verticillium wilt to obtain Verticillium wilt-level disease template DNA.

[0244] Preparation of Verticillium wilt-secondary disease template DNA: DNA was extracted from the leaves of Chinese cabbage affected by the above-mentioned secondary Verticillium wilt disease to obtain Verticillium wilt-secondary disease template DNA.

[0245] Using the amplification system in Table 4, RPA amplification was performed on the obtained clubroot-primary disease template DNA, clubroot-secondary disease template DNA, downy mildew-primary disease template DNA, downy mildew-secondary disease template DNA, Verticillium wilt-primary disease template DNA, and Verticillium wilt-secondary disease template DNA, respectively, to obtain RPA amplification products for clubroot-primary disease template DNA, clubroot-secondary disease template DNA, downy mildew-primary disease template DNA, downy mildew-secondary disease template DNA, Verticillium wilt-primary disease template DNA, and Verticillium wilt-secondary disease template DNA, respectively.

[0246] The clubroot disease group is divided into clubroot disease-CK, clubroot disease-primary disease, and clubroot disease-secondary disease.

[0247] Clubroot - Level 1 disease:

[0248] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) were added to adjust the system to 20 μL with DNase / RNase-Free water, mixed thoroughly, and incubated at room temperature for 10 min.

[0249] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and RPA amplification product of clubroot disease-primary disease template DNA (RPA amplification product)) and mix well.

[0250] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of primary clubroot disease by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0251] Clubroot - a secondary disease

[0252] The only difference between this procedure and that for clubroot disease - Level 1 is that the RPA amplification product is replaced with the RPA amplification product of the clubroot disease - Level 2 template DNA. All other procedures are the same as for clubroot disease - Level 1.

[0253] clubroot disease - CK

[0254] The only difference between this procedure and that for clubroot disease - Level 1 is that the RPA amplification product is replaced with DNase / RNase-free water; the rest of the procedure is the same as for clubroot disease - Level 1.

[0255] The downy mildew group is divided into downy mildew-CK, downy mildew-primary disease, and downy mildew-secondary disease.

[0256] Downy mildew - Level 1 disease:

[0257] The only difference between this procedure and that for clubroot disease (level 1) is that the RPA amplification product is replaced with the RPA amplification product of the downy mildew (level 1) template DNA. All other procedures are the same as for clubroot disease (level 1).

[0258] Downy mildew - a secondary disease

[0259] The only difference between this procedure and that for clubroot disease (level 1) is that the RPA amplification product is replaced with the RPA amplification product of the downy mildew (level 2) template DNA. All other procedures are the same as for clubroot disease (level 1).

[0260] Downy mildew - CK

[0261] The only difference between this procedure and that for clubroot disease - Level 1 is that the RPA amplification product is replaced with DNase / RNase-free water; the rest of the procedure is the same as for clubroot disease - Level 1.

[0262] The Verticillium wilt group is divided into Verticillium wilt-CK, Verticillium wilt-Level 1 disease, and Verticillium wilt-Level 2 disease.

[0263] Verticillium wilt - Level 1 disease:

[0264] The only difference between this procedure and that for clubroot disease (level 1) is that the RPA amplification product is replaced with the RPA amplification product of the Verticillium wilt (level 1) template DNA. All other procedures are the same as for clubroot disease (level 1).

[0265] Verticillium wilt - Level 2 disease

[0266] The only difference between this procedure and that for clubroot disease (level 1) is that the RPA amplification product is replaced with the RPA amplification product of the Verticillium wilt (level 2) template DNA. All other procedures are the same as for clubroot disease (level 1).

[0267] Verticillium wilt-CK

[0268] The only difference between this procedure and that for clubroot disease - Level 1 is that the RPA amplification product is replaced with DNase / RNase-free water; the rest of the procedure is the same as for clubroot disease - Level 1.

[0269] The results are as follows Figure 5 As shown ( Figure 5 In the above experiments (clumproot disease-CK, clubroot disease-primary disease, clubroot disease-secondary disease, downy mildew-CK, downy mildew-primary disease, downy mildew-secondary disease, Verticillium wilt-CK, Verticillium wilt-primary disease, and Verticillium wilt-secondary disease correspond to the above experiments respectively), when any two of the reagents from Cas12a, crRNA, and target dsDNA were added, the Rn value was significantly lower than the Rn value when all three reagents were added simultaneously. This indicates that only the formation of the Cas12a / crRNA / target dsDNA ternary complex can activate the trans-cleavage activity of Cas12a. This result demonstrates the good specificity of the CRISPR / Cas12a detection system for downy mildew.

[0270] Optimization of CRISPR / Cas12a detection system

[0271] Optimization of crRNA concentration:

[0272] The experiment was divided into four groups: 25nM crRNA group, 50nM crRNA group, 75nM crRNA group and 100nM crRNA group.

[0273] 25nM crRNA group:

[0274] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 25 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0275] 2) Add the remaining three reagents and mix well.

[0276] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 25 nM D1-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0277] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0278] 50 nM crRNA group:

[0279] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0280] 2) Add the remaining three reagents and mix well.

[0281] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 50 nM D1-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0282] In the experiments, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK). In the downy mildew-primary disease experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK). The RPA amplification product of the downy mildew-primary disease template DNA was used as the RPA amplification product as the primary disease. The RPA amplification product of the downy mildew-secondary disease template DNA was used as the RPA amplification product as the secondary disease.

[0283] 75nM crRNA group:

[0284] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 75 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0285] 2) Add the remaining three reagents and mix well.

[0286] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 75 nM D1-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0287] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0288] 100nM crRNA group:

[0289] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 100 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0290] 2) Add the remaining three reagents and mix well.

[0291] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 100 nM D1-1 transcribed RNA by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0292] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0293] The results are as follows Figure 6 As shown, Figure 6 The 25nM, 50nM, 75nM, and 100nM crRNA groups corresponded to the 25nM crRNA group, 50nM crRNA group, 75nM crRNA group, and 100nM crRNA group, respectively. The control (CK) was the negative control. The RPA amplification product of the downy mildew-primary disease template DNA was used as the RPA amplification product for primary disease, and the RPA amplification product of the downy mildew-secondary disease template DNA was used as the RPA amplification product for secondary disease. The 50nM crRNA concentration showed the best results.

[0294] Optimization of ssDNA reporter probe concentration:

[0295] The experiment was divided into five groups: 50 nM ssDNA group, 100 nM ssDNA group, 250 nM ssDNA group, 500 nM ssDNA group and 1000 nM ssDNA group.

[0296] 50 nM ssDNA group:

[0297] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0298] 2) Add the remaining three reagents to make the concentration of ssDNAprobe 2 50 nM and mix well.

[0299] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. The detection effect of 50 nM ssDNAprobe 2CRISPR / Cas12a is observed by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to that of the inert reference dye (ROX II).

[0300] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0301] 100nM ssDNA group:

[0302] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0303] 2) Add the remaining three reagents to make the concentration of ssDNAprobe 2 100nM and mix well.

[0304] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the detection effect of 100nM ssDNAprobe 2CRISPR / Cas12a by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0305] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0306] 250 nM ssDNA group:

[0307] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0308] 2) Add the remaining three reagents to make the concentration of ssDNAprobe 2 250 nM and mix well.

[0309] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the detection effect of 250 nM ssDNAprobe 2CRISPR / Cas12a by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0310] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0311] 500nM ssDNA group:

[0312] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0313] 2) Add the remaining three reagents to make the concentration of ssDNAprobe 2 500nM and mix well.

[0314] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the detection effect of 500 nM ssDNAprobe 2CRISPR / Cas12a by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0315] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0316] 1000nM ssDNA group:

[0317] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 5, using the first four reagents listed in Table 5. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA, with a concentration of 50 nM) were mixed thoroughly and incubated at room temperature for 10 min.

[0318] 2) Add the remaining three reagents to make the concentration of ssDNAprobe 2 1000 nM and mix well.

[0319] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. The detection effect of 1000 nM ssDNAprobe 2CRISPR / Cas12a is observed by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to that of the inert reference dye (ROX II).

[0320] In the experiment, DNase / RNase-Free water was used as the RPA amplification product as the negative control (CK), the RPA amplification product of downy mildew-primary disease template DNA was used as the RPA amplification product as primary disease, and the RPA amplification product of downy mildew-secondary disease template DNA was used as the RPA amplification product as secondary disease.

[0321] The results are as follows Figure 7 As shown, Figure 7 The 550nM, 100nM, 250nM, 500nM, and 1000nM ssDNA concentrations corresponded to the 50nM, 100nM, 250nM, 500nM, and 1000nM ssDNA groups, respectively. The control (CK) was the negative control. The RPA amplification product of the downy mildew-primary disease template DNA was used as the RPA amplification product for primary disease, and the RPA amplification product of the downy mildew-secondary disease template DNA was used as the RPA amplification product for secondary disease. The 500nM ssDNA concentration showed the best results.

[0322] This invention optimized the concentrations of crRNA and ssDNA reporter probes. The optimal detection concentration ratio of Cas12a:crRNA:ssDNA probe is 50 nM:50 nM:500 nM. Therefore, this concentration ratio was used in the CRISPR / Cas12a detection system for downy mildew (as shown in Table 6). The following optimal ratio was found through the above experiments (as shown in Table 6):

[0323] Table 6

[0324]

[0325] CRISPR / Cas12a system detection sensitivity

[0326] Preparation of 15 ng / μL downy mildew: The genomic DNA of downy mildew (Plasmodiophora brassicae Woronin) was prepared according to the above method for preparing downy mildew DNA, and then diluted to 15 ng / μL to obtain a concentration of 15 ng / μL downy mildew genomic DNA.

[0327] The 15 ng / μL downy mildew genomic DNA was sequentially diluted 10 times to obtain 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL of downy mildew genomic DNA, respectively.

[0328] Using the amplification system in Table 4, RPA amplification was performed on the obtained downy mildew genomic DNA at concentrations of 15 ng / μL, 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL, respectively. The resulting RPA amplification products were: 15 ng / μL, 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL.

[0329] The above method was used to obtain RPA amplification products of genomic DNA from R032 Chinese cabbage leaves that were not infected with downy mildew.

[0330] Downy mildew - 15 ng / μL:

[0331] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1)(1X), NEBufferr2.1 Reaction Buffer(10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0332] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 15 ng / μL of RPA amplification product (DNA template) of downy mildew genomic DNA) and mix well.

[0333] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 15 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0334] Downy mildew - 1.5 ng / μL:

[0335] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0336] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 1.5 ng / μL of RPA amplification product (DNA template) of downy mildew genomic DNA) and mix well.

[0337] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 1.5 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0338] Downy mildew - 0.15 ng / μL:

[0339] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) were added to adjust the system to 20 μL with DNase / RNase-Free water, mixed thoroughly, and incubated at room temperature for 10 min.

[0340] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 0.15 ng / μL of RPA amplification product (DNA template) of downy mildew genomic DNA) and mix well.

[0341] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 0.15 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0342] Downy mildew - 0.015 ng / μL:

[0343] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0344] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 0.015 ng / μL of RPA amplification product of downy mildew genomic DNA (DNA template)) and mix well.

[0345] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 0.015 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0346] Downy mildew - 0.0015 ng / μL:

[0347] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0348] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 0.0015 ng / μL of RPA amplification product (DNA template) of downy mildew genomic DNA) and mix well.

[0349] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 0.0015 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0350] Downy mildew - 0.00015 ng / μL:

[0351] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0352] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and 0.00015 ng / μL of RPA amplification product (DNA template) of downy mildew genomic DNA) and mix well.

[0353] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 min, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of 0.00015 ng / μL of perennial mycorrhizal by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0354] CK:

[0355] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0356] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and DNase / RNase-Free water (DNA template)) and mix well.

[0357] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of DNase / RNase-Free water by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0358] NC:

[0359] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 6, using the first four reagents listed in Table 6. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0360] 2) Add the remaining three reagents (ssDNAprobe 2, ROX Reference Dye II, and RPA amplification product (DNA template) of genomic DNA from R032 cabbage leaves that are not infected with downy mildew) and mix well.

[0361] 3) Immediately place the sample on a real-time quantitative PCR instrument for fluorescence detection. Incubate at 37°C for 60 minutes, collecting fluorescence signals every minute. Observe the CRISPR / Cas12a detection effect of R032 Chinese cabbage leaves that are not infected with downy mildew by statistically analyzing the Rn value (the ratio of the fluorescence value of the reporter dye (FAM) to the fluorescence value of the inert reference dye (ROX II).

[0362] In summary, using a pathogen concentration of 15 ng / μL as the initial concentration for downy mildew detection, the concentration was successively diluted 10 times to 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL. The results are as follows: Figure 9 As shown (downy mildew - 15 ng / μL, downy mildew - 1.5 ng / μL, downy mildew - 0.15 ng / μL, downy mildew - 0.015 ng / μL, downy mildew - 0.0015 ng / μL, downy mildew - 0.00015 ng / μL, CK and NC represent the above operations respectively), the lowest detection sensitivity for downy mildew is 0.015 ng / μL.

[0363] Laboratory Cas-BrRPA Visual Detection

[0364] In the visualization detection system, a blue light gel cutter or a LUYOR excitation source is used for operation. The fluorophore FAM of ssDNAprobe 1 is green, while the quencher BHQ1 does not emit any fluorescence. When the probe is intact, that is, when the distance between the two is close to a certain range (1-10 nm), FAM is excited by the excitation light but does not emit its own light; instead, it transfers energy to BHQ1, and the sample does not exhibit fluorescence. When the probe is cut, the two groups are far apart, FAM can emit green fluorescence, while BHQ1 does not fluoresce, and the sample ultimately exhibits green fluorescence.

[0365] For visual detection, the CRISPR / Cas12a detection system and operating procedures are as follows:

[0366] Table 7

[0367]

[0368] The following experiment was conducted:

[0369] 1.5x10 1 ng / μL:

[0370] 1) The reagents required for melting ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Lba Cas12a(Cpf1) (1X), NEBuffer 2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA) were incubated at room temperature for 10 min.

[0371] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). 1 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0372] 3) Observe the detection results under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0373] 1.5x10 0 ng / μL:

[0374] 1)1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0375] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). 0 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0376] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0377] 1.5x10 -1 ng / μL:

[0378] 1) The reagents required for melting ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBuffer 2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0379] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). -1 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0380] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0381] 1.5x10 -2 ng / μL:

[0382] 1)1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0383] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). -2 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0384] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0385] 1.5x10 -3 ng / μL:

[0386] 1)1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0387] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). -3 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0388] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0389] 1.5x10 -4 ng / μL:

[0390] 1)1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBuffer r2.1 Reaction Buffer (10X), DNase / RNase-Free water, and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0391] 2) Add the remaining two reagents (ssDNAprobe 1 and 1.5x10). -4 Mix thoroughly with ng / μL of RPA amplification product (DNA template) of the downy mildew genome.

[0392] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0393] CK:

[0394] 1) The reagents required for melting ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0395] 2) Add the remaining two reagents (ssDNAprobe 1 and RPA amplification product (DNA template) of genomic DNA from R032 cabbage leaves that are not infected with downy mildew) and mix well.

[0396] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0397] NC:

[0398] 1) The reagents required for melting ice are added sequentially according to the concentrations and volumes listed in Table 7, using the first four reagents listed in Table 7. Mix Lba Cas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0399] 2) Add the remaining two reagents (ssDNAprobe 1 and DNase / RNase-Free water (DNA template)) and mix well.

[0400] 3) Observe and detect under the LUYOR-3415CV fluorescent protein excitation light source (irradiate the detection system with blue light source at 5, 10, 15, 30, 45, 60, 75 and 90 min of incubation, and observe the changes in fluorescence intensity and fluorescence color of the detection sample).

[0401] The results are as follows Figure 9 As shown ( Figure 9 In the diagram, C1, C2, C3, C4, C5, C6, NC, and CK represent the aforementioned 1.5 x 10⁻⁶. 1 ng / μL, 1.5x10 0 ng / μL, 1.5x10 -1 ng / μL, 1.5x10 -2 ng / μL, 1.5x10 -3 ng / μL and 1.5x10 -4 ng / μL, NC and CK), Figure 9To visualize the fluorescence detection results of downy mildew, we irradiated the test samples with blue light at the 5th, 10th, 15th, 30th, 45th, 60th, 75th, and 90th minutes of incubation in the detection system, and observed the changes in fluorescence intensity and color. Downy mildew in the concentration range of 0.015 ng / μL to 15 ng / μL could be distinguished by naked eye. The fluorescence intensity of the CK and negative control NC stopped changing after the 15th minute. The visualization detection time for downy mildew was set at 15 minutes.

[0402] Establishment of a field downy mildew disease test strip detection system

[0403] Test strip detection principle:

[0404] The CRISPR / Cas12a system, combined with the detection method of colloidal gold test strips, is designed based on the trans-cleavage activity of Cas12a and the competitive assay principle. The principle is as follows: Streptavidin (SA-AuNPs) is labeled on the colloidal gold. Anti-FITC antibody and biotin-labeled bovine serum albumin (BSA) are deposited on the control line and test line, respectively. SA-AuNPs capture the biotin end of the probe (regardless of whether the probe is cleaved), the biotin on the biotin-BSA binds to streptavidin, and the anti-FITC antibody captures FITC. Figure 3 Figure a shows the prepared complete test strip. If the target pathogen is present in the sample ( Figure 3 In step b), a Cas12a / crRNA / analyte pathogen nucleic acid ternary complex is formed in the detection system, activating the trans-cleavage activity of Cas12a, which non-specifically cleaves the free ssDNA probe 3 (5'6-FITC-TTTTTTTT-Biotin3') within the system. The biotin end of the broken probe is captured by SA-AuNPs. As the strip continues to flow, it is captured by Biotin-BSA at the T line, where colloidal gold accumulates, resulting in color development. The FITC end of the broken probe is captured by anti-FITC antibody, but without the presence of colloidal gold, color development is not possible. This situation indicates a detection result where the probe is completely broken when the pathogen content is high. In actual reactions, when the content of the target pathogen is low, the probe may not be completely cleaved. The biotin end of the intact probe may also be captured by SA-AuNPs. The anti-FITC antibody at the C-line captures the intact FITC end of the probe, causing colloidal gold to accumulate at the C-line for color development. Conversely, the biotin end of the broken probe is captured by the biotin-BSA antibody at the T-line, causing colloidal gold to accumulate at the T-line for color development. In this case, both the C-line and T-line show color. Figure 3 c). If the sample does not contain the pathogen to be tested ( Figure 3In step d), the detection system does not form a Cas12a / crRNA / test pathogen nucleic acid ternary complex, thus failing to activate the trans-cleavage activity of Cas12a, and the ssDNAprobe 3 remains intact. The biotin end of the intact probe is captured by SA-AuNPs, and the FITC end of the intact probe is captured by the anti-FITC antibody at the C line, resulting in colloidal gold aggregation and color development at the C line.

[0405] Test strip preparation and assembly:

[0406] Preparation of colloidal gold by trisodium citrate reduction method:

[0407] Take 1 mL of 1% chloroauric acid solution and dilute with water to 100 mL, mixing thoroughly. Heat to boiling on a magnetic stirrer, stirring constantly. After boiling, quickly add approximately 2.7 mL of 1% sodium citrate solution. When the solution color no longer changes, continue heating for 10 minutes. After cooling in a water bath, dilute to 100 mL with ultrapure water, transfer to a centrifuge tube, and store at 4°C protected from light.

[0408] Colloidal gold-labeled streptavidin (SA-AuNPs) were purchased from Bio-Sens, catalog number bs-0437P-Gold-15nm, with a colloidal gold diameter of 15nm.

[0409] The sample pads were purchased from Shanghai Jieyi Biotechnology Co., Ltd., product number TY-BX116.

[0410] SA-AuNPs binding pads (colloidal gold pads) were purchased from Shanghai Jieyi Biotechnology Co., Ltd., product number TY-BX116.

[0411] Preparation of nitrocellulose membranes (NC membranes)

[0412] Anti-FITC antibody (1-2.5 mg / mL) and Biotin / BAS [also known as BSA-Biotin (1-2.5 mg / mL)] were sprayed parallel to each other onto the NC membrane at a dosage of 1 μL / cm. The anti-FITC antibody was sprayed as the C-line, and the Biotin / BAS was sprayed as the T-line, with a spacing of approximately 1 cm between the two lines. The membrane was then dried at 37°C for 0.5 h. (Details follow...) Figure 3 As shown in Figure a.

[0413] First, attach the NC film to the center of the PVC board. Then, overlap the edge of the SA-AuNPs conjugate pad with the edge of the NC film, overlap the edge of the sample pad with the edge of the conjugate pad, and overlap the edge of the absorbent paper with the edge of the NC film. After assembly, cut the paper into 4mm test strips using a strip cutter. Place the strips in a foil bag along with the desiccant and store at 4℃ for later use.

[0414] The test strip detection system is as follows:

[0415] Table 8

[0416]

[0417]

[0418] Test strip testing method:

[0419] 1) The reagents required for melting on ice are added sequentially according to the concentrations and volumes in Table 8, using the first four reagents listed in Table 8. Mix LbaCas12a(Cpf1) (1X), NEBufferr2.1 Reaction Buffer (10X), DNase / RNase-Free water and D1-1 transcribed RNA (crRNA) thoroughly and incubate at room temperature for 10 min.

[0420] 2) Add the remaining two reagents (ssDNAprobe3 and RPA amplification product of downy mildew genomic DNA (DNA template)), mix well, and obtain the test strip detection mixture.

[0421] 3) Add the above test strip mixture to the prepared test strip sample area and observe the test results.

[0422] Cas-AIRPA detection criteria screening

[0423] The experiment used two types of test strips: test strip a and test strip b.

[0424] Preparation of test strip a:

[0425] Cas-AIRPA detection criteria screening

[0426] The experiment used two types of test strips: test strip a and test strip b.

[0427] The test strip a is prepared as follows:

[0428] When anti-FITC (1 mg / mL) is sprayed away from the sample pad and Biotin / BSA (1 mg / mL) is close to the sample pad, a nitrocellulose membrane (NC membrane) 1 is obtained. The conjugate pad, sample pad and nitrocellulose membrane (NC membrane) 1 are assembled by the above test strip assembly method to obtain test strip a.

[0429] The RPA amplification products of 15 ng / μL downy mildew genomic DNA and ddH2O (control or negative control) samples were detected using test strip a and the above-described test strip detection system. Each test was repeated three times. The results showed that... Figure 10As shown in Figure a ("+" indicates the detection result of RPA amplification product of 15 ng / μL downy mildew genomic DNA, "-" indicates the detection result of ddH2O (control or negative control)), the results show that both the C and T lines are visible in the water control (negative control) detection result, while only the C line is visible in the detection result of RPA amplification product of 15 ng / μL downy mildew genomic DNA. This means that only the C line is visible when the probe is completely cut, while both the C and T lines are visible when the probe is incompletely cut or not cut at all, which can easily lead to false positives.

[0430] Perform the following operations on test strip b:

[0431] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is sprayed away from the sample pad, a nitrocellulose membrane (NC membrane) 2 is obtained. The conjugate pad, sample pad and nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain test strip b.

[0432] The RPA amplification products of downy mildew genomic DNA at a concentration of 15 ng / μL were detected using test strip b and the above-mentioned test strip detection system. The results showed that... Figure 10 As shown in Figure b (the first three are the detection results of RPA amplification products of 15 ng / μL downy mildew genomic DNA, and the last three are the detection results of ddH2O (control or negative control)), the results show that only the C line is visible in the ddH2O (control or negative control) detection result, and only the T line is visible in the 15 ng / μL downy mildew genomic DNA RPA amplification product (positive control) detection result. When the positive sample probe is completely cut, only the T line is visible; when it is not completely cut, both the T line and the C line are visible; when the probe is not cut, only the C line is visible; the detection results can be well distinguished. Based on the above results, the positions of the anti-FITC line closer to the sample pad and the Biotin / BAS line further away from the sample pad were finally selected as the positions of the C line and the T line of the test strip.

[0433] Screening of colloidal gold concentration and probe concentration

[0434] Five SA-AuNPs concentration gradients were set up for the experiment: 1 μL, 2 μL, 3 μL, 4 μL and 5 μL.

[0435] Preparation of 1 μL SA-GNPs binding pad:

[0436] Add 1 μL of SA-GNPs to 0.1M PBS, mix well, spray onto the conjugate pad, and dry at 37℃ for 0.5 h to obtain a 1 μL SA-GNPs conjugate pad, which is then stored at 4℃ for later use.

[0437] Preparation of 2 μL SA-GNPs binding pads:

[0438] Add 2 μL of SA-GNPs to 0.1M PBS, mix well, spray onto the conjugate pad, and dry at 37℃ for 0.5 h to obtain a 2 μL SA-GNPs conjugate pad, which is then stored at 4℃ for later use.

[0439] Preparation of 3 μL SA-GNPs binding pads:

[0440] Add 3 μL of SA-GNPs to 0.1M PBS, mix well, spray onto the conjugate pad, and dry at 37℃ for 0.5 h to obtain a 3 μL SA-GNPs conjugate pad, which is then stored at 4℃ for later use.

[0441] Preparation of 4 μL SA-GNPs binding pads:

[0442] Add 4 μL of SA-GNPs to 0.1M PBS, mix well, spray onto the conjugate pad, and dry at 37℃ for 0.5 h to obtain a 4 μL SA-GNPs conjugate pad, which is then stored at 4℃ for later use.

[0443] Preparation of 5 μL SA-GNPs binding pads:

[0444] Add 5 μL of SA-GNPs to 0.1M PBS, mix well, spray onto the conjugate pad, and dry at 37℃ for 0.5 h to obtain a 5 μL SA-GNPs conjugate pad, which is then stored at 4℃ for later use.

[0445] Using 1 μL, 2 μL, 3 μL, 4 μL, and 5 μL SA-GNPs conjugate pads, respectively, nitrocellulose membrane (NC membrane) 2 was assembled with the test strips using the assembly method described above, resulting in 1 μL SA-GNPs conjugate pad-nitrocellulose membrane (NC membrane) 2 test strips, 2 μL SA-GNPs conjugate pad-nitrocellulose membrane (NC membrane) 2 test strips, 3 μL SA-GNPs conjugate pad-nitrocellulose membrane (NC membrane) 2 test strips, 4 μL SA-GNPs conjugate pad-nitrocellulose membrane (NC membrane) 2 test strips, and 5 μL SA-GNPs conjugate pad-nitrocellulose membrane (NC membrane) 2 test strips.

[0446] 1μL:

[0447] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL was tested using a 1 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip). The results were observed after 5 minutes.

[0448] 2μL:

[0449] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL was tested using a 2 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip). The results were observed after 5 minutes.

[0450] 3μL:

[0451] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL was tested using a 3 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip). The results were observed after 5 minutes.

[0452] 4μL:

[0453] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL was tested using a 4 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip). The results were observed after 5 minutes.

[0454] 5μL:

[0455] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL was tested using a 5 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip). The results were observed after 5 minutes.

[0456] The results are as follows Figure 11 As shown in Figure a ( Figure 11 In a, 1 μL, 2 μL, 3 μL, 4 μL, and 5 μL represent the above operations, respectively. The results showed that the red color of the T line started to develop from 3 μL and did not deepen further from 4 μL. Therefore, 3 μL of SA-GNPs was tentatively selected as the loading concentration.

[0457] Due to the interaction between SA-GNPs and the probe, the concentration ratio between them affects the colorimetric effect. The probes in the CRISPR / Cas12a system were optimized, and five different concentrations of ssDNAprobe 3 were loaded with 3 μL of SA-GNPs for detection. Furthermore, five ssDNAprobe 3 concentration gradients were set up: 1 μM, 500 nM, 250 nM, 100 nM, and 50 nM.

[0458] 1μM:

[0459] The test strip was prepared using a 3 μL SA-GNPs binding pad-nitrocellulose membrane (NC membrane) and the above test strip detection system (the concentration of ssDNA probe 3 in the reaction system was adjusted to 1 μM). Water (negative control) was then tested, and the results were observed after 5 minutes. The results are as follows: Figure 11 As shown in b.

[0460] 500nM:

[0461] The test strip, consisting of 3 μL SA-GNPs binding pads and a nitrocellulose membrane (NC membrane), was used in the above detection system (with the concentration of ssDNA probe 3 adjusted to 500 nM) to detect water (negative control). Results were observed after 5 minutes. The results are as follows: Figure 11 As shown in b.

[0462] 250nM:

[0463] The test strip, consisting of 3 μL SA-GNPs binding pads and a nitrocellulose membrane (NC membrane), was used in the above detection system (with the concentration of ssDNA probe 3 adjusted to 250 nM) to detect water (negative control). Results were observed after 5 minutes. The results are as follows: Figure 11 As shown in b.

[0464] 100nM:

[0465] The test strip, consisting of 3 μL SA-GNPs binding pads and a nitrocellulose membrane (NC membrane), was used in the above detection system (the concentration of ssDNA probe 3 in the reaction system was adjusted to 100 nM) to detect water (negative control). Results were observed after 5 minutes. The results are as follows: Figure 11 As shown in b.

[0466] 50nM:

[0467] The test strip, consisting of 3 μL SA-GNPs binding pads and a nitrocellulose membrane (NC membrane), was used in the above detection system (the concentration of ssDNA probe 3 in the reaction system was adjusted to 50 nM) to detect water (negative control). Results were observed after 5 minutes. The results are as follows: Figure 11 As shown in b.

[0468] The results are as follows Figure 11 b( Figure 11 (b in the figure represents the above operations respectively). The results show that ssDNAprobe 3 concentrations of 50nM-250nM are prone to false positives, and the colorimetric effect of 1μM concentration of ssDNAprobe 3 is weak. Finally, 500nM was selected as the optimal probe loading concentration.

[0469] Screening of C-line and T-line concentrations

[0470] The chemical properties, structure, steric hindrance, and molecular weight of the trapping agent on the NC membrane have a significant impact on its solid-phase adsorption capacity, thus affecting its application in test strip detection. In order to obtain more ideal detection bands, the concentrations of anti-FITC in the C line and Biotin / BSA in the T line on the NC membrane were optimized.

[0471] First, the concentration of Biotin / BSA was fixed at 1 mg / mL, and five concentration gradients of anti-FITC were set up, namely 2.5 mg / mL, 2 mg / mL, 1.5 mg / mL, 1 mg / mL and 0.5 mg / mL.

[0472] 2.5 mg / mL anti-FITC nitrocellulose membrane (NC membrane) test strip:

[0473] When anti-FITC (2.5 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is far away from the sample pad, a 2.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) is obtained. The 3 μL SA-GNPs binding pad is prepared and the 2.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) are assembled using the above test strip assembly method to obtain the 2.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) test strip.

[0474] 2 mg / mL anti-FITC nitrocellulose membrane (NC membrane) test strips:

[0475] When anti-FITC (2 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is far away from the sample pad, a 2 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) is obtained. The 3 μL SA-GNPs binding pad and the 2 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) are assembled using the above test strip assembly method to obtain the 2 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) test strip.

[0476] 1.5 mg / mL anti-FITC nitrocellulose membrane (NC membrane) test strip 2:

[0477] When anti-FITC (1.5 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is far away from the sample pad, a 1.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 is obtained. The 3 μL SA-GNPs binding pad is prepared and the 1.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain the 1.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip.

[0478] 1 mg / mL anti-FITC nitrocellulose membrane (NC membrane) 2 test strips:

[0479] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is far away from the sample pad, a 1 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) are assembled using the above test strip assembly method to obtain a 1 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) test strip.

[0480] 0.5 mg / mL anti-FITC nitrocellulose membrane (NC membrane) test strip 2:

[0481] When anti-FITC (0.5 mg / mL) is sprayed near the sample pad and Biotin / BSA (1 mg / mL) is far away from the sample pad, a 0.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 is obtained. The 3 μL SA-GNPs binding pad is prepared and the 0.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain the 0.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip.

[0482] 2.5mg / mL anti-FITC / 1mg / mL Biotin / BSA:

[0483] The RPA amplification product (DNA template) and water (negative control) of 15 ng / μL downy mildew genomic DNA were detected using a 2.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0484] 2mg / mL anti-FITC / 1mg / mLBiotin / BSA:

[0485] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 2 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0486] 1.5mg / mL anti-FITC / 1mg / mL Biotin / BSA:

[0487] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0488] 1mg / mL anti-FITC / 1mg / mLBiotin / BSA:

[0489] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0490] 0.5mg / mL anti-FITC / 1mg / mL Biotin / BSA:

[0491] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 0.5 mg / mL anti-FITC and 1 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0492] The results show that ( Figure 12 a( Figure 12 In the diagram, "+" indicates the RPA amplification result of the genomic DNA of downy mildew at a concentration of 15 ng / μL, and "-" indicates the result of the test in water (negative control). At this detection concentration, positive results are not displayed.

[0493] The concentration of anti-FITC was further fixed at 1 mg / mL, and five concentration gradients of Biotin / BSA were set up, namely 2.5 mg / mL, 2 mg / mL, 1.5 mg / mL, 1 mg / mL, and 0.5 mg / mL.

[0494] 2.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strips:

[0495] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (2.5 mg / mL) is far away from the sample pad, a 1 mg / mL anti-FITC and 2.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 2.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain the 1 mg / mL anti-FITC and 2.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip.

[0496] 2.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strips:

[0497] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (2.0 mg / mL) is far away from the sample pad, a 1 mg / mL anti-FITC and 2.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 2.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain the 1 mg / mL anti-FITC and 2.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip.

[0498] 1.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strips:

[0499] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (1.5 mg / mL) is sprayed away from the sample pad, a 1 mg / mL anti-FITC and 1.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 1.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) are assembled using the above test strip assembly method to obtain a 1 mg / mL anti-FITC and 1.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) test strip.

[0500] 1.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strips:

[0501] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (1.0 mg / mL) is far away from the sample pad, a 1 mg / mL anti-FITC and 1.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 1.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) are assembled using the above test strip assembly method to obtain a 1 mg / mL anti-FITC and 1.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane 2) test strip.

[0502] 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strips:

[0503] When anti-FITC (1 mg / mL) is sprayed near the sample pad and Biotin / BSA (0.5 mg / mL) is far away from the sample pad, a 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 is obtained. The 3 μL SA-GNPs binding pad and the 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 are assembled using the above test strip assembly method to obtain a 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip.

[0504] 1mg / mL anti-FITC / 2.5mg / mL Biotin / BSA:

[0505] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1 mg / mL anti-FITC and 2.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0506] 1mg / mL anti-FITC / 2.0mg / mL Biotin / BSA:

[0507] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1 mg / mL anti-FITC and 2.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0508] 1mg / mL anti-FITC / 1.5mg / mL Biotin / BSA:

[0509] The RPA amplification product (DNA template) of 15 ng / μL downy mildew genomic DNA and water (negative control) samples were tested using a 1 mg / mL anti-FITC and 1.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0510] 1mg / mL anti-FITC / 1.0mg / mL Biotin / BSA:

[0511] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1 mg / mL anti-FITC and 1.0 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0512] 1mg / mL anti-FITC / 0.5mg / mL Biotin / BSA:

[0513] The RPA amplification product (DNA template) of downy mildew genomic DNA at a concentration of 15 ng / μL and water (negative control) were tested using a 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (the test strip detection mixture was dropped onto the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes, and each test was repeated three times.

[0514] The results are as follows Figure 12 As shown in b ( Figure 12 b( Figure 12 In the diagram, "+" indicates the detection result of RPA amplification product of genomic DNA of downy mildew at a concentration of 15 ng / μL, and "-" indicates the detection result of water (negative control). The results show that as the concentration of Biotin / BSA decreases, the distinction between positive and negative results on the test strip becomes more obvious. The test strip prepared with a concentration of 0.5 mg / mL Biotin / BSA and a concentration of 1 mg / mL anti-FITC has the best color development effect.

[0515] Sensitivity testing of test strips

[0516] After optimizing the test strip conditions, the RPA amplification products of different concentrations of downy mildew genome were detected using a 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) 2 test strip and the above test strip detection system (adjusting the concentration of ssDNAprobe 3 in the reaction system to 500 nM). This validated the sensitivity of the downy mildew Cas12a test strip detection. Similarly, a downy mildew concentration of 15 ng / μL was used as the initial concentration for pathogen detection, and the strips were subsequently diluted 10 times to obtain concentrations of 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL.

[0517] Preparation of 15 ng / μL downy mildew genomic DNA: The genomic DNA of downy mildew of Chinese cabbage was prepared according to the above method for preparing downy mildew (Plasmodiophorabrassicae Woronin) DNA, and then diluted to 15 ng / μL to obtain a concentration of 15 ng / μL downy mildew genomic DNA.

[0518] The 15 ng / μL downy mildew genomic DNA was sequentially diluted 10 times to obtain 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL, respectively.

[0519] Using the amplification system in Table 4, RPA amplification was performed on the obtained 15 ng / μL, 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL downy mildew genomic DNA, respectively, to obtain RPA amplification products for 15 ng / μL, 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL downy mildew genomic DNA, respectively.

[0520] Using the amplification system and test strip detection method shown in Table 8, the RPA amplification products of the above-mentioned 15 ng / μL downy mildew genomic DNA, 1.5 ng / μL downy mildew genomic DNA, 0.15 ng / μL downy mildew genomic DNA, 0.015 ng / μL downy mildew genomic DNA, 0.0015 ng / μL downy mildew genomic DNA, and 0.00015 ng / μL downy mildew genomic DNA were reacted to obtain 15 ng / μL downy mildew genomic DNA RPA amplification products. Test strips containing RPA amplification products of pathogenic genomic DNA, test strips containing 1.5 ng / μL of RPA amplification products of downy mildew genomic DNA, test strips containing 0.15 ng / μL of RPA amplification products of downy mildew genomic DNA, test strips containing 0.015 ng / μL of RPA amplification products of downy mildew genomic DNA, test strips containing 0.0015 ng / μL of RPA amplification products of downy mildew genomic DNA, and test strips containing 0.00015 ng / μL of RPA amplification products of downy mildew genomic DNA.

[0521] The above method was used to prepare a test strip mixture containing genomic DNA from R032 cabbage leaves that were not infected with downy mildew, RPA amplification products of genomic DNA from R032 cabbage leaves that were not infected with downy mildew, and RPA amplification products of genomic DNA from R032 cabbage leaves that were not infected with downy mildew.

[0522] 15ng / μL:

[0523] The test strips containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above-mentioned test strip detection system were used to detect a 15 ng / μL concentration of downy mildew genomic DNA sample. The test strip detection mixture containing 15 ng / μL of RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM. The results were observed after 5 minutes of reaction.

[0524] 1.5 ng / μL:

[0525] The test strips containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above-mentioned test strip detection system were used to detect a 1.5 ng / μL concentration of downy mildew genomic DNA. The test strip detection mixture containing 1.5 ng / μL of RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM. The results were observed after 5 minutes of reaction.

[0526] 0.15 ng / μL:

[0527] The test strips were prepared using 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above test strip detection system (0.15 ng / μL of the RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM) to detect downy mildew genomic DNA samples. The results were observed after 5 minutes of reaction.

[0528] 0.015 ng / μL:

[0529] The test strips containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above-mentioned test strip detection system were used to detect a 0.015 ng / μL concentration of downy mildew genomic DNA. The test strip detection mixture containing 0.015 ng / μL of RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM. The results were observed after 5 minutes of reaction.

[0530] 0.0015 ng / μL;

[0531] The test strips containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above-mentioned test strip detection system were used to detect a 0.0015 ng / μL concentration of downy mildew genomic DNA template sample. The test strip detection mixture containing 0.0015 ng / μL of RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM. The results were observed after 5 minutes of reaction.

[0532] 0.00015 ng / μL:

[0533] The test strips containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above-mentioned test strip detection system were used to detect a 0.00015 ng / μL concentration of downy mildew genomic DNA. The test strip detection mixture containing 0.00015 ng / μL of RPA amplification product of downy mildew genomic DNA was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM. The results were observed after 5 minutes of reaction.

[0534] CK:

[0535] The DNA of R032 cabbage leaves uninfected with downy mildew was detected using a test strip containing 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) and the above test strip detection system (the RPA amplification product of R032 cabbage leaves uninfected with downy mildew was added to the sample area of ​​the test strip, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes of reaction.

[0536] NC:

[0537] DNA samples from DNase / RNase-Free water were tested using a 1 mg / mL anti-FITC and 0.5 mg / mL Biotin / BSA nitrocellulose membrane (NC membrane) test strip and the above test strip detection system (an equal volume of DNase / RNase-Free water was added to the sample area of ​​the test strip along with a 0.0015 ng / μL test strip detection mixture, and the concentration of ssDNAprobe 3 in the reaction system was adjusted to 500 nM). The results were observed after 5 minutes of reaction.

[0538] The results are as follows Figure 13 As shown ( Figure 13 In the diagram, C1, C2, C3, C4, C5, C6, NC, and CK represent the aforementioned 1.5 x 10⁻⁶. 1 ng / μL, 1.5x10 0 ng / μL, 1.5x10 -1 ng / μL, 1.5x10 -2 ng / μL, 1.5x10 -3 ng / μL and 1.5x10 -4 (NC and CK experimental procedures were performed). The lowest detection sensitivity for *Peronospora* was 0.015 ng / μL. The sensitivity results of this test strip were consistent with the results of the fluorescence visualization system.

[0539] Comparison of three detection methods: quantitative RT-qPCR, Cas-BrRPA, and Cas-AIRPA.

[0540] Detection Standard Line - Quantitative Real-Time RT-qPCR

[0541] Currently, the main standard for detecting downy mildew on vegetables is real-time quantitative RT-qPCR. We used a pathogen concentration of 15 ng / μL as the initial concentration for downy mildew detection, and then successively diluted it by a factor of 10 to 1.5 ng / μL, 0.15 ng / μL, 0.015 ng / μL, 0.0015 ng / μL, and 0.00015 ng / μL, and plotted a quantitative RT-qPCR standard curve for downy mildew. Figure 14 (a) and the minimum detection limit for quantitative fluorescence detection of downy mildew ( Figure 14 (b) The results showed that the lowest detectable concentration of downy mildew was 0.015 ng / μL. Table 9 compares the advantages and disadvantages of the three detection methods. All three methods have good specificity and accuracy. Although the detection sensitivity of Cas-BrRPA and Cas-AIRPA is slightly lower than that of quantitative fluorescence detection, the detection methods of Cas-BrRPA and Cas-AIRPA show obvious advantages in terms of detection time and space, as well as the fact that they do not require the purchase of large-scale instruments and equipment.

[0542] Table 9 Comparison of three detection methods

[0543]

[0544] In summary, this invention, based on CRISPR / Cas12a technology combined with isothermal amplification RPA, first established a laboratory-based, visualized rapid detection platform for downy mildew in Chinese cabbage, Cas-BrRPA. This platform can rapidly detect downy mildew pathogens within 35 minutes, with a detection level as low as 0.015 ng / μL. Building upon this, and combining colloidal gold immunochromatographic test strip technology, a field detection platform, Cas-AIRPA, was established. This platform can rapidly detect downy mildew in Chinese cabbage in the field within 25 minutes without the need for any instruments, also detecting downy mildew at a concentration of 0.015 ng / μL. This invention has significant application value for the early prevention and diagnosis of downy mildew in Chinese cabbage. The schematic diagrams of the Cas-BrRPA platform detection process and the Cas-AIRPA platform detection process are shown below. Figure 1 and 2 As shown.

Claims

1. An RNA molecule, characterized in that, The RNA molecule is a guide RNA molecule capable of binding to Cas12a, and the nucleic acid sequence of the guide RNA molecule is positions 4-44 of sequence 1, wherein... The scaffold region is located from position 4 to position 24 of sequence 1, and the target region is located from position 25 to position 44 of sequence 1.

2. A biomaterial, characterized in that, The biomaterial includes any of the following: A1) The gene encoding the RNA molecule of claim 1; A2), an expression cassette containing the gene described in A1).

3. A method for preparing a guide RNA molecule, characterized in that, The guide RNA molecule is the guide RNA molecule of claim 1, and the method includes the step of transcribing the biological material of claim 2.

4. A kit for detecting downy mildew in Chinese cabbage, characterized in that, Includes the RNA molecule of claim 1 or the guide RNA molecule prepared by the method of claim 3, and Cas12a protein, primer pairs, and detection probe; The primer pair consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein RPA-Downy-ITS-F is a single-stranded DNA with nucleotide sequence sequence 5, and RPA-Downy-ITS-R is a single-stranded DNA with nucleotide sequence sequence 6. The detection probe is either ssDNA probe1 or ssDNA probe2, wherein ssDNA probe1 is 5'-6-FAM-TTTTTTTT-BHQ1-3' and ssDNA probe2 is 5'-6-FAM-TTTTTTTT-TAMRA-3'.

5. A kit for detecting downy mildew in Chinese cabbage, characterized in that, Includes the RNA molecule of claim 1 or the guide RNA molecule prepared by the method of claim 3, Cas12a protein, primer pairs and detection probe; The primer pair consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein RPA-Downy-ITS-F is a single-stranded DNA with nucleotide sequence sequence 5, and RPA-Downy-ITS-R is a single-stranded DNA with nucleotide sequence sequence 6. The detection probe is ssDNA probe3, and ssDNA probe3 is 5'-6-FITC-TTTTTTTT-Biotin-3'.

6. The reagent kit as described in claim 5, characterized in that, The kit also includes a colloidal gold test strip for detecting downy mildew in Chinese cabbage. One end of the ssDNA probe3 is labeled with fluorescein, and the other end is labeled with biotin. The test strip includes a conjugate pad, a detection line, and a control line. The conjugate pad is coated with colloidal gold-labeled streptavidin, the detection line is coated with biotin-labeled protein, and the control line is coated with fluorescein antibody.

7. A method for detecting the pathogen of downy mildew of Chinese cabbage, the method comprising amplifying the DNA of a sample to be tested using a primer pair to obtain an amplification product of the sample to be tested, reacting Cas12a protein, the RNA molecule of claim 1, the amplification product of the sample to be tested, and a detection probe, and determining whether the sample contains the pathogen of downy mildew of Chinese cabbage by detecting the cleavage of the detection probe; wherein the primer pair consists of RPA-Downy-ITS-F and RPA-Downy-ITS-R, wherein RPA-Downy-ITS-F is a single-stranded DNA with nucleotide sequence sequence 5, and RPA-Downy-ITS-R is a single-stranded DNA with nucleotide sequence sequence 6; The detection probe is either ssDNA probe1 or ssDNA probe2, wherein ssDNA probe1 is 5'-6-FAM-TTTTTTTT-BHQ1-3' and ssDNA probe2 is 5'-6-FAM-TTTTTTTT-TAMRA-3'.

8. The use of the RNA molecule of claim 1, the biological material of claim 2, or the kit of any of claims 4-6 in any of the following: P1. Application in the detection of downy mildew; P2. Application in the preparation of products for detecting downy mildew.

Images