Penicillium polonicum and application thereof

By using the Polish Penicillium CK2023-1 to ferment cured meat, the problem of the inability to replicate the flavor of traditional cured meat from Chengkou was solved, and similar flavored cured meat was produced in other regions.

CN118580966BActive Publication Date: 2026-08-04CHONGQING ACAD OF ANIMAL SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHONGQING ACAD OF ANIMAL SCI
Filing Date
2024-06-05
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

The unique flavor and texture of Chengkou cured pork can only be fermented and produced in Chengkou County and cannot be replicated in other regions, resulting in limited production of cured pork.

Method used

Fermentation was carried out using a strain of Polish Penicillium P. polonicum CK2023-1, which exhibits salt tolerance and biocompatibility and can secrete lipase and protease. This strain was used to prepare cured meat, mimicking the flavor of traditional Chengkou cured meat.

Benefits of technology

The cured meat prepared by fermenting with Polish Penicillium has an aroma and taste similar to that of Chengkou cured meat, thus solving the problem of geographical limitations and providing cured meat products with similar flavors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004876639150000071
    Figure BDA0004876639150000071
  • Figure BDA0004876639150000072
    Figure BDA0004876639150000072
  • Figure BDA0004876639150000081
    Figure BDA0004876639150000081
Patent Text Reader

Abstract

The application discloses a strain of producing fragrance polonies and application thereof, and relates to the technical field of microbial fermentation. The application relates to a strain of P.polonicum CK2023-1, which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO:M20232455, and the preservation date is December 4, 2023. The strain of fungus is separated from the surface of Chengkou old preserved meat with a storage period of 2 years, has good salt tolerance and biological safety, and has excellent abilities of producing lipase and protease; the strain is used for fermentation to prepare preserved meat, can effectively improve fragrance substances, and obtain similar taste and smell to the Chengkou old preserved meat, and has a good application prospect in a fermentation agent for industrialized production of preserved meat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, and in particular to an aroma-producing Penicillium polonium and its applications. Background Technology

[0002] Cured pork is one of my country's traditional meat products. The microorganisms in cured pork products can use their rich enzyme systems to modify and transform the biomolecules in the raw meat (such as fat oxidation, protein degradation, and carbohydrate hydrolysis). These substances undergo further complex reactions to form various acids, aldehydes, ketones, esters, hypoxanthines, and short peptides, giving cured pork products a flavor not found in the raw meat. Cured pork produced in different regions has different textures and flavors. Chengkou cured pork, in particular, is known for its high-quality meat, beautiful color, pure aroma, and rich nutrition, possessing a unique flavor and texture that is highly favored by consumers. However, it must be fermented and processed locally in Chengkou County to achieve its specific texture and flavor; fermentation and processing in other regions cannot produce cured pork with a similar flavor, thus limiting its production. Summary of the Invention

[0003] This invention aims to solve at least one of the technical problems existing in the prior art. To this end, this invention proposes a strain of *Penicillium polonum*, from which cured meat obtained through fermentation has a flavor similar to that of traditional cured meat from Chengkou.

[0004] The present invention also provides a fermentation agent.

[0005] The present invention also provides a product.

[0006] The present invention also provides the application of the above-mentioned Polish Penicillium, fermentation agent or product in the preparation of cured meat.

[0007] The present invention also provides a method for preparing cured meat.

[0008] The present invention also provides a type of cured meat.

[0009] According to a first aspect of the present invention, a strain of *Penicillium polonicum*, named *P. polonicum CK2023-1*, is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M20232455, and the deposit date is December 4, 2023.

[0010] According to embodiments of the present invention, *Penicillium polonum* has at least the following beneficial effects:

[0011] The *Penicillium polonum* strain used in this example was isolated from the surface of cured pork from Chengkou that had been stored for two years. It exhibits excellent salt tolerance and biocompatibility, as well as superior lipase and protease production capabilities. When used in the fermentation of cured pork, it can effectively enhance aroma compounds, achieving a flavor and aroma similar to that of Chengkou cured pork, demonstrating promising application prospects as a fermentation agent for cured pork.

[0012] A fungal agent according to a second aspect of the present invention comprises *Penicillium polonide* and / or spores and / or cultures of *Penicillium polonide*. Since the fungal agent employs all the technical solutions of *Penicillium polonide* from the above embodiments, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.

[0013] The term "culture" refers to a liquid or solid product containing a microbial community after artificial inoculation and cultivation. It can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, and / or other components produced during the cultivation process. Understandably, it can be a culture of a single generation or a mixture of several generations.

[0014] According to some embodiments of the present invention, the microbial agent is a liquid microbial agent or a solid microbial agent.

[0015] According to some embodiments of the present invention, the bacterial agent further includes at least one of a carrier medium and a diluent (e.g., physiological saline, PBS, or deionized water).

[0016] According to some embodiments of the present invention, the microbial agent may further include at least one of surfactants, binders, stabilizers, and pH adjusters.

[0017] According to some embodiments of the present invention, the dosage form of the microbial agent includes, but is not limited to, liquid, suspension, powder, granule, wettable powder or water-dispersible granule.

[0018] According to some embodiments of the present invention, the method for preparing the culture of Penicillium polonide includes:

[0019] The *Penicillium polonum* is inoculated into a fungal culture medium (e.g., PDA medium) and cultured at 20°C–25°C to obtain the culture. The culture can also be further activated (e.g., by re-inoculating the *Penicillium polonum* into a fungal culture medium and culturing at 20°C–25°C for 7–14 days).

[0020] According to some embodiments of the present invention, the method for preparing the microbial agent includes:

[0021] The fungal agent is obtained by using the live cells and / or spores of the aforementioned *Penicillium polonum* as the active ingredient.

[0022] A product according to a third aspect of the present invention comprises the aforementioned *Penicillium polonide* and / or *Penicillium polonide* spores and / or *Penicillium polonide* cultures and / or the aforementioned fungal agent. Since the fungal agent employs all the technical solutions of *Penicillium polonide* from the above embodiments, it possesses at least all the beneficial effects brought about by the technical solutions of the above embodiments.

[0023] According to some embodiments of the present invention, the product may be a fermentation agent.

[0024] According to some embodiments of the present invention, the active ingredient of the product is the live cells of Penicillium polonum and / or its spores.

[0025] Application of the above-described Penicillium polonide, starter culture, or product according to the fourth aspect of the present invention in the preparation of cured meat

[0026] A method for preparing cured meat according to a fifth aspect of the present invention includes a step of inoculating raw meat with the aforementioned Penicillium polonide, fungicide, or product followed by fermentation.

[0027] According to some embodiments of the present invention, the method specifically includes the following steps:

[0028] The cured meat is obtained by inoculating the raw meat with the aforementioned Polish Penicillium, fungicide, or product after it has been cured and dried, and then smoking it.

[0029] According to some embodiments of the present invention, the raw meat includes pork hind leg meat.

[0030] According to some embodiments of the present invention, the marinating process includes: coating the surface of the raw meat with white wine and salt, and marinating for 3 to 7 days. The amount of salt used is 3% to 3.5%.

[0031] According to some embodiments of the present invention, the drying is cold air drying. This dries the surface of the raw meat, reducing moisture content.

[0032] According to some embodiments of the present invention, the drying includes: drying the marinated raw meat in cold air at 2°C to 8°C for 2 to 6 days.

[0033] According to some embodiments of the present invention, the inoculation method includes at least one of injection and application.

[0034] According to some embodiments of the present invention, the inoculum quantity of the *Penicillium polonide* spores is 10. 7 ~10 9 spores / g of raw meat.

[0035] According to some embodiments of the present invention, the smoking conditions include smoking at 15℃~20℃ for 20~26 days. It is understood that the smoking conditions suitable for Chengkou cured pork are also suitable for the present invention.

[0036] According to some embodiments of the present invention, the smoking process involves slow, low-heat smoking using oil-free oak wood.

[0037] According to a sixth aspect of the present invention, a type of cured meat is prepared using the above-described preparation method.

[0038] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0039] Figure 1 The results of screening for lipase production ability of some selected bacteria;

[0040] Figure 2 The results of the screening of protease production ability of some of the selected bacteria;

[0041] Figure 3 The results show the salt tolerance test results for strain CK2023-1;

[0042] Figure 4 The results show the salt tolerance test results for strain 2-6B-5;

[0043] Figure 5 The results show the salt tolerance test results for strain 3-6B-7;

[0044] Figure 6 The results of homology analysis between strain CK2023-1 and 20 strains isolated from the air in a meat-smoking kiln at an altitude of 1500 meters in Chengkou County;

[0045] Figure 7 The results of homology analysis between strain CK2023-1 and 20 strains of bacteria isolated from the air in a meat-smoking kiln at an altitude of 1500 meters in Chengkou County;

[0046] Figure 8 Representative H&E staining results for high-dose mice; where A: liver, vacuolar degeneration, 200×, Bar=100μm; B: liver, inflammatory cell infiltration, 400×, Bar=50μm; C: liver, punctate necrosis, 400×, Bar=50μm.

[0047] Figure 9 LDA images of electronic nose detection for fermented cured meat and old cured meat from Chengkou by P. polonicum CK2023-1;

[0048] Figure 10 LDA graphs of electronic tongue detection for fermented cured meat and old cured meat from Chengkou by P. polonicum CK2023-1;

[0049] Figure 11 Taste radar map of the response intensity of P. polonicum CK2023-1 fermented cured meat and Chengkou old cured meat to the electronic tongue system sensor;

[0050] Figure 12 Sensory evaluation radar charts of fermented cured meat samples from P. polonicum CK2023-1 and old cured meat from Chengkou. Detailed Implementation

[0051] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0052] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0053] In the description of this invention, the terms “comprising” and “having”, and any variations thereof, are intended to cover non-exclusive inclusion, for example, a process, method, system, product, or device that includes a series of steps or units is not necessarily limited to those steps or units that are explicitly listed, but may include other steps or units that are not explicitly listed or that are inherent to such process, method, product, or device.

[0054] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0055] "And / or" is used to indicate that one or both of the described situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0056] Unless otherwise specified, "room temperature" in this invention means (25±5)℃.

[0057] Isolation, screening and identification of strains

[0058] 1. Isolation of bacterial strains:

[0059] (1) Scrape the surface of Chengkou cured pork that has been stored for 2 years, add physiological saline to homogenize and dilute to a suitable concentration, spread it on PDA solid culture medium, and isolate single colonies by spot inoculation and other methods.

[0060] (2) Air samples were collected from a smokehouse at an altitude of 1500 meters in Chengkou County using an FKC-1 type airborne dust and bacteria sampler (Suzhou Hongji Clean Technology Co., Ltd.). 100L of samples were collected at each location, for a total of 6 locations. The petri dishes containing the collected air samples were incubated at 28℃ for 2 days. Single colonies were picked and purified by observing the morphology and state of the colonies.

[0061] 2. Screening and identification of strains:

[0062] Genomic DNA was extracted from the isolated fungi, and the internally transcribed spacer (ITS) region was amplified by PCR (using primers ITS5-1737F: GGAAGTAAAAGTCGTAACAAGG; ITS2-2043R: GCTGCGTTCTTCATCGATGC). The PCR products were sequenced, and the sequencing results were compared with BLAST on NCBI to determine the strain species. The isolated strains were then screened using protease-selective medium, lipase-selective medium, and PDA medium containing NaCl to select strains suitable for fermentation.

[0063] (1) Screening for protease production capacity: Purified single colonies were inoculated into protease detection medium using the spot inoculation method. After culturing for 5 days, the diameter of the hydrolysis zone around the strain was measured relative to the diameter of the bacterial cell. If a clear hydrolysis zone appeared around the strain inoculated into the protease detection medium, it proved that the strain produced protease. The protease production capacity was correlated with the ratio of the diameter of the clear hydrolysis zone to the colony diameter; the larger the ratio, the stronger the protease production capacity.

[0064] (2) Lipase production capacity screening: Purified single colonies were inoculated into lipase detection medium using the spot inoculation method. After culturing for 5 days, the diameter of the red hydrolysis zone around the strain was measured relative to the diameter of the bacterial cell. Under ultraviolet light, if a red hydrolysis zone appeared around the strain inoculated into the lipase detection medium, it proved that the strain produced lipase. The lipase production capacity is related to the ratio of the diameter of the red hydrolysis zone to the diameter of the colony; the larger the ratio, the stronger the lipase production capacity.

[0065] (3) The purified single colonies were inoculated onto PDA plates with salt concentrations of 1.0%, 2.0%, 3.0%, 4.0%, 5.0% and 10% and cultured for 6 days, and the growth status was observed.

[0066] Test results of some screening bacteria are as follows Figures 1-5 As shown in Table 1.

[0067] Table 1. Results of tests on the lipase and protease production capabilities of some selected bacteria.

[0068] strain number strain type Diameter of clear zone / colony diameter Diameter of the red hydrolysis zone / diameter of the colony 3-6B-7 Debaryomyces robertsiae 2.69±0.13 / 2-6B-5 Kodamaea ohmeri 2.53±0.11 / CK2023-1 Penicillium polonicum 2.25±0.05 3.85±0.12 1-6B-13 Penicillium sp 1.24±0.15 1.97±0.20 1-6B-1 Penicillium rubens 1.25±0.12 / 1-6C-5 Penicillium crustosum 1.18±0.15 / 2-6C-6 Aspergillus puulaauensis 1.14±0.07 1.02±0.02 2-6B-4 Aspergillus jensenii 1.11±0.13 /

[0069] In summary, *Penicillium polonica* CK2023-1 possesses strong protease and lipase production capabilities. Furthermore, it can grow normally on PDA plates with salt concentrations of 1.0%, 2.0%, 3.0%, 4.0%, and 5.0%, and even on PDA plates with a high salt concentration (10%). Given that the salt concentration of cured pork from Chengkou is generally 3.0%–4.5%, *Penicillium polonica* CK2023-1 can be used as a fermentation strain for cured pork.

[0070] The ITS 1-5F sequences of *Penicillium pollonicum* CK2023-1 are shown in SEQ ID NO:1. Its ITS sequences show 100% homology with those of 40 strains isolated from the air in a meat-smoking oven at an altitude of 1500 meters in Chengkou County. Figures 6-7 As shown.

[0071] (SEQ ID NO:1).

[0072] Example 1

[0073] This embodiment provides a method for preparing cured pork, as follows:

[0074] Coat 100g of fresh black pig hind leg meat (purchased from Chengkou County slaughterhouse) with 50° liquor, add salt at a ratio of 2.8wt%, and rub thoroughly. Marinate at 2℃~4℃ for 3 days, then air dry at 2℃~8℃ for 4 days. Using sterile gloves, apply 1mL of Penicillium polonicum CK2023-1 spore suspension to the surface of the meat. Smoke over a low flame using non-greasy oak wood for 26 days at a smoking temperature of 15℃~20℃ to obtain cured meat (hereinafter referred to as P. polonicum CK2023-1 fermented cured meat).

[0075] The preparation method of the spore suspension of *Penicillium polonaise* CK2023-1 is as follows: *Penicillium polonaise* CK2023-1 is inoculated onto a PDA plate and cultured at 28℃ for 7 days. Then, 10 mL of sterile physiological saline is added to the plate. The spores on the surface are gently scraped off using an inoculation loop, and the suspension is collected into a sterile 50 mL Erlenmeyer flask. Sterile glass beads with a diameter of 4 mm are added, and the flask is shaken for 15 minutes. The flask is then passed through three layers of sterile gauze for appropriate dilution. The spores are counted using a hemocytometer to adjust the spore concentration to 10⁻⁶. 7 The spores / mL yielded a suspension of Penicillium Polonaise CK2023-1 spores.

[0076] Comparative Example 1

[0077] This comparative example provides a type of cured pork (hereinafter referred to as Chengkou Old Cured Pork), produced in Chengkou County. The preparation method is as follows:

[0078] Rub 100g of fresh black pig hind leg meat (purchased from Chengkou County slaughterhouse) with 50° liquor, add salt at a ratio of 2.8wt%, and knead thoroughly. Marinate at 2℃~4℃ for 3 days, then air dry at 2℃~8℃ for 4 days. Finally, smoke it over a low fire using non-greasy oak wood for 26 days at a smoking temperature of 15℃~20℃ to obtain Chengkou cured pork.

[0079] Detection Example 1: Biosafety

[0080] Strain strain CK2023-1 was inoculated onto PDA agar plates and cultured at 28°C for 7 days. Colonies were scraped from the entire plate using a sterile inoculation loop and dissolved in sterile physiological saline. The plates were centrifuged at 12000 rpm for 10 min at 4°C, the supernatant was discarded, and the contents were weighed. The plates were resuspended in an equal volume of sterile physiological saline and vortexed for 3 min to prepare bacterial suspensions with concentrations of 0.5 g / mL, 0.25 g / mL, and 0.125 g / mL. The suspensions were stored at 4°C for later use.

[0081] 1. An acute toxicity test was conducted for 7 days according to the "Acute Oral Toxicity Test" (GB15193.3-2014). The entire experimental project was supervised by the Experimental Animal Ethics Review Committee of Southwest University and passed the ethical review, with the ethical review number IACUC-20230614-04.

[0082] Forty SPF-grade Kunming mice (5 weeks old, weighing 18.0–22.0 g) were randomly divided into two groups of 20 mice each (10 males and 10 females) after acclimatization: a control group and an experimental group. Mice in the experimental group were orally administered 400 μL of the corresponding bacterial suspension per mouse, reaching the maximum safe dose of 10000 mg / kg (10 g / kg). Mice in the control group were orally administered physiological saline. Oral administration was performed once daily. Observation continued until day 7, recording the mice's health status, the appearance of acute toxicity signs, and mortality. The mice's weight and food intake were also recorded daily, along with body temperature measurements.

[0083] After the 7-day acute toxicity test, mice were fasted for 12 hours. Following intraperitoneal injection of 3% sodium pentobarbital solution (50 mg / kg body weight) for anesthesia, mice were euthanized by cervical dislocation. Dissection was performed, and the heart, liver, spleen, lungs, and kidneys were removed. The presence of lesions was observed, and the organs were weighed. The organ index was calculated as follows: Relative organ index = organ mass (g) / mouse body weight (g) × 100%.

[0084] (1) Effect of P. polonicum CK2023-1 on body temperature in mice: The results are shown in Table 2.

[0085] Table 2

[0086]

[0087] Tests showed no significant difference in body temperature between the experimental group and the control group within 7 days, and no significant difference in body temperature changes among the groups (p>0.05).

[0088] (2) Effects of P. polonicum CK2023-1 on mouse body weight and food intake: The results are shown in Table 3.

[0089] Table 3

[0090]

[0091] Over 7 days, the average daily food intake of female mice ranged from 22 to 29 g, while that of male mice ranged from 20.3 to 30.5 g. There was no significant difference in body weight among the same sex groups (p > 0.05).

[0092] (3) Effect of P. polonicum CK2023-1 on organ index in mice: organ index = organ weight / mouse body weight. The results are shown in Table 4.

[0093] Table 4

[0094]

[0095] There were no significant differences in organ indices (organ-to-body ratio / organ coefficient) between female and male mice administered the strain via gavage and the control group (P > 0.05). Furthermore, no lesions were observed in any of the organs.

[0096] 2. A subacute toxicity test was conducted for 28 days according to the "Subacute Oral Toxicity Test" (GBZ / T 240.15-2011). The entire experimental project was supervised by the Experimental Animal Ethics Review Committee of Southwest University and passed the ethical review, with the ethical review number IACUC-20230614-03.

[0097] Forty SPF-grade Kunming mice (5 weeks old, weighing 18.0–22.0 g) were randomly divided into four groups (n=10 per group, half male and half female): a high-dose group, a medium-dose group, a low-dose group, and a control group. During the rearing period, mice had free access to food and water at an ambient temperature of 22℃, humidity of 60%, and 12 hours of light per day. Mice were housed in separate cages within the same room, with free access to water, and their cages were cleaned regularly. After 5 days of acclimatization, the high-dose, medium-dose, and low-dose groups were administered 400 μL / mouse / day via gavage at doses of 10 g / kg body weight, 5 g / kg body weight, and 2.5 g / kg body weight (bacterial weight based on wet weight), respectively, for 28 consecutive days. The control group was administered an equal volume of sterile saline via gavage. Before the end of the experiment, all mice were fasted for 12 hours, weighed, and then anesthetized by intraperitoneal injection of 3.0% sodium pentobarbital solution (50 mg / kg body weight). 100 μL of blood (containing 10% EDTA-K2) was collected from the eyeballs, and 18 indicators, including white blood cell count (WBC), monocyte percentage (Mon%), monocyte count (Mon#), red blood cell distribution width (RDW), red blood cell count (RBC), hematocrit (HCT), lymphocyte percentage (Lymph%), lymphocyte count (Lymph#), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), mean platelet volume (MPV), hemoglobin content (HGB), platelet distribution width (PDW), platelet count (PLT), plateletcrit (PCT), neutrophil percentage (Gran%), and neutrophil count (Gran#), were analyzed using a fully automated blood analyzer. Blood was collected and serum was separated. Seven indicators were analyzed using a Chemray 800 fully automated biochemical analyzer: alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein (TP), blood urea nitrogen (BUN), creatinine (CR), albumin (ALB), and total cholesterol (TC). Mice were euthanized by dislocation, and the heart, liver, spleen, lungs, and kidneys were harvested to observe for lesions. Each organ was fixed in 4% paraformaldehyde solution, and the fixative was replaced after 24 hours. The fixed samples were then paraffin-embedded, sectioned, stained with Hexagonal E. (H&E), stained with toluidine blue, and mounted using standard methods. Pathological changes in each sample were observed under an optical microscope.

[0098] (1) Effects of P. polonicum CK2023-1 on mouse body weight and daily food intake: The results are shown in Table 5.

[0099] Table 5

[0100]

[0101] The average weight gain of female mice in the high-dose, medium-dose, and low-dose groups was 10.76 g, 13.5 g, and 11.96 g, respectively, while the average weight gain of male mice in the high-dose, medium-dose, and low-dose groups was 14.94 g, 17.66 g, and 16.16 g, respectively. There were no significant differences in weight or daily food intake between the high-dose, medium-dose, and low-dose groups and the control group (p > 0.05).

[0102] (2) Effect of P. polonicum CK2023-1 on organ index in mice: organ index = organ weight / mouse body weight. The results are shown in Table 6.

[0103] Table 6

[0104]

[0105] There were no significant differences in organ indices among the high-dose group, medium-dose group, low-dose group and control group (p>0.05).

[0106] (3) Effects of P. polonicum CK2023-1 on routine blood parameters in mice: The results are shown in Tables 7 and 8.

[0107] Table 7

[0108]

[0109] Table 8

[0110]

[0111]

[0112] In female mice, there were no significant differences in any blood routine indicators among the high-dose, medium-dose, low-dose, and control groups (p > 0.05). In male mice, there were also no significant differences in any blood routine indicators among the high-dose, medium-dose, low-dose, and control groups (p > 0.05).

[0113] (4) Effects of P. polonicum CK2023-1 on biochemical indicators in mice: The results are shown in Table 9.

[0114] Table 9

[0115]

[0116]

[0117] (4) Effects of P. polonicum CK2023-1 on mouse tissues: Pathological examinations were performed on the heart, liver, spleen, lung, and kidney tissues of mice in the high-dose group, and the original scoring sheet was completed. The results are shown in Table 10 and... Figure 8 As shown.

[0118] Table 10

[0119]

[0120] Note: N: Normal; 0: Absent; 1: Slight; 2: Mild; 3: Moderate; 4: Severe; P: Present.

[0121] No lesions were observed in the heart, spleen, lung, and kidney tissues of either female or male mice. In the liver tissue of female mice, no vacuolar degeneration was observed; two samples showed mild cell necrosis, and two samples showed mild inflammatory cell infiltration. In the liver tissue of male mice, no cell necrosis or inflammatory cell infiltration was observed; one liver sample showed mild vacuolar degeneration.

[0122] Detection Example 2

[0123] In this test example, the fermented cured meat of P. polonicum CK2023-1 prepared in Example 1 (hereinafter referred to as P. polonicum CK2023-1) and the old cured meat of Chengkou in Comparative Example 1 (hereinafter referred to as Chengkou Bacon) were used as the cured meat samples to be tested. The aroma and taste of the cured meat samples to be tested were evaluated by means of electronic nose, electronic tongue and sensory evaluation.

[0124] (1) Electronic nose detection:

[0125] Place 5g of the cured meat sample to be tested in a gas collecting bottle and incubate in a 40℃ water bath for 30min. Use the German AIRSENSE-PEN3 electronic nose with the following parameters set: carrier gas flow rate 400mL / min, washing time 120s, zeroing time 5s, pre-injection time 8s, and sample measurement time 100s. First, perform automatic gas washing with the instrument. When all the index lines converge near 1.0 on the ordinate, it indicates that the instrument has washed the gas clean. After 100s of washing, quickly insert the blasting needle and probe into the sample gas collecting bottle after a 5s countdown. Measure each sample 3 times and take the average value.

[0126] Principal component analysis (PCA) was performed on the detection data from the electronic nose detector within the 97-100 s range. Based on the PCA data, further compression was performed using linear discriminant analysis (LDA) to further compress within-group data points and amplify between-group differences, making the distinctions more obvious. The results are as follows: Figure 9 As shown.

[0127] The combined discriminant contribution of the first and second principal components reached 86.30%, with the first principal component contributing 51.2%. Therefore, these two principal components essentially represent the main informational features of the sample. The aroma of fermented cured meat from P. polonicum CK2023-1 is similar to that of old cured meat from Chengkou.

[0128] (2) Electronic tongue detection:

[0129] Place 30g of the cured meat sample to be tested in a homogenizing bag and add ultrapure water at a ratio of 1g:10mL; homogenize for 5 minutes at 12 rpm; sonicate at 40℃ for 30 minutes to achieve a core temperature of 40℃; homogenize again for 5 minutes at 12 rpm; centrifuge the homogenized liquid at 8000r / min at room temperature for 10 minutes and collect the supernatant; filter the supernatant with filter paper to obtain a clear liquid free of impurities; collect 100mL of filtrate for electronic tongue detection; using the Japanese INSENTSA-402B electronic tongue, place the positive electrode washing solution, negative electrode washing solution, and reference solution into the corresponding labeled slots, and place the filtrate into the sample slot; set the name of each sample slot in the system and perform 4 cycles.

[0130] PCA analysis was performed on the electronic tongue detector values ​​from three tests to identify the most important and highest-contributing factors in the principal component analysis. The spatial distribution map of the PCA results visually reflects the differences between samples. Based on the PCA analysis, the data points within each group were further compressed to amplify the differences between groups, making the distinctions more obvious. The LDA analysis results are shown below. Figure 10 The first principal component contributed 72.50%, the second principal component contributed 11.50%, and the total contribution reached 84.00%. These two principal components basically represent the main informational features of the sample. The fermented cured pork sample from *P. polonicum* CK2023-1 tasted similar to that of Chengkou cured pork, indicating that *P. polonicum* CK2023-1 has a good fermentation effect on pork.

[0131] To more intuitively analyze the response intensity of the electronic tongue system sensors to different samples, the obtained data was plotted as a taste radar chart, with each axis representing one sensor. The results are as follows: Figure 11 As shown. All sensor response values ​​range from -50 to 10 (negative values ​​are the result of data processing of the sensor signals, reflecting only the amplitude of the electrical signal response, not the specific data value). In terms of sourness, astringency, bitterness, aftertaste, umami, and richness, P. polonicum CK2023-1 fermented cured meat is similar to Chengkou old cured meat.

[0132] (3) Sensory evaluation: 60 people were randomly divided into three groups of 20 people each. The sensory evaluation of the bacon samples to be tested was carried out. The evaluation items were odor, fat color, lean meat color, texture, lean meat hardness, fat meat hardness, lean meat saltiness, and fat meat saltiness. The specific scoring criteria are shown in Table 11.

[0133] Table 11

[0134]

[0135]

[0136] The results are as follows Figure 12 As shown.

[0137] The aroma, fat color, lean meat color, texture, lean meat firmness, fat firmness, lean meat saltiness, and fat saltiness of fermented cured meat (P. polonicum CK2023-1) are similar to those of Chengkou old cured meat.

[0138] In conclusion, the aroma and taste of the fermented cured meat made from P. polonicum CK2023-1 are very similar to those of the old cured meat from Chengkou.

[0139] The embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A strain of Penicillium polonicum, characterized in that, Name is Penicillium polonicum CK2023-1 is deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20232455, on December 4, 2023.

2. A microbial agent, characterized in that, Includes the *Penicillium polonum* as described in claim 1 and / or the spores of the *Penicillium polonum* as described in claim 1 and / or the culture of the *Penicillium polonum* as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The bacterial agent can be a solid bacterial agent or a liquid bacterial agent.

4. The microbial agent according to claim 2, characterized in that, The bacterial agent also includes at least one of a carrier medium and a diluent.

5. A product characterized by, Includes the *Penicillium polonum* as described in claim 1 and / or the spores of *Penicillium polonum* as described in claim 1 and / or the culture of *Penicillium polonum* as described in claim 1 and / or the fungal agent as described in any one of claims 2 to 4.

6. The use of the Polish Penicillium according to claim 1, the fungal agent according to any one of claims 2 to 4, or the product according to claim 5 in the preparation of cured meat.