Application of PIP5K6 gene in regulating castor bean traits

Abstract

This invention discloses the application of the PIP5K6 gene in regulating castor bean traits, belonging to the field of plant genetic engineering technology. These traits include plant height, pollen, seeds, number of leaves, stem nodes, and flowers, maturity rate of male flowers and fruits, and plant aging rate. This invention promotes earlier flowering and faster flower and fruit development in castor beans by overexpressing the PIP5K6 gene; male flower buds are larger, darker in color, have more stamens, and mature faster; female flower stigmas are darker and longer, making them more effective at capturing pollen from the air; fruits split more noticeably; seeds are fuller, darker in color, with more distinct seed coat patterns and a glossier appearance; seed germination rate is high; radicles are longer; and plant aging rate is slower. The PIP5K6 gene can be applied to the genetic engineering breeding of castor beans, and has significant value in cultivating castor bean varieties with superior traits.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application of the PIP5K6 gene in regulating castor bean traits. Background Technology

[0002] Castor bean (Ricinus communis L.) is an annual or perennial dicotyledonous herbaceous plant belonging to the genus Ricinus in the family Euphorbiaceae. It is one of the world's top ten oilseed crops and has significant application value. Many gene and genetic engineering strategies have been used to improve plant traits; however, research on genetic engineering for improving castor bean traits remains limited. Therefore, exploring the functions and mechanisms of action of castor bean-related genes is of great significance for the genetic breeding and agricultural production of castor bean.

[0003] Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) is a phospholipid kinase in organisms that catalyzes the phosphorylation of phosphatidylinositol-4-phosphate (PI4P) to synthesize phosphatidylinositol-4,5-bisphosphate (PIP2), making it a key enzyme in the phosphatidylinositol (PI) signaling pathway. Phosphatidylinositol 4,5-bisphosphate regulates the actin cytoskeleton and vesicle transport. The PIP5K gene family regulates plant growth and development in the phosphatidylinositol signaling pathway, including gene expression in plant cells, cellular responses to external environmental factors, ion channel regulation, and hormone action. Currently, research on PIP5K family genes in castor beans is relatively limited. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the PIP5K6 gene in regulating castor bean traits, in order to solve the problems existing in the prior art. This invention has demonstrated that overexpression of the PIP5K6 gene improves many traits of castor bean. Therefore, the PIP5K6 gene can be applied to the genetic engineering breeding of castor bean, and has important utilization value in the cultivation of castor bean varieties with excellent traits.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides the application of the PIP5K6 gene in regulating castor bean traits, including plant height, pollen, seeds, number of leaves, stem nodes and flowers, maturity rate of male flowers and fruits, and plant aging rate.

[0007] The reference sequence of the PIP5K6 gene is accessed by NCBI under accession number XM_015715277.1.

[0008] The present invention also provides the application of a recombinant vector containing the PIP5K6 gene in regulating castor bean traits, including plant height, pollen, seeds, as well as the number of leaves, stem nodes and flowers, the rate of male flower and fruit maturation, and the rate of plant aging.

[0009] The present invention also provides the application of recombinant bacteria containing the recombinant vector in regulating castor bean traits, including plant height, pollen, seeds, as well as the number of leaves, stem nodes and flowers, the maturity rate of male flowers and fruits, and the aging rate of the plant.

[0010] Furthermore, by overexpressing the PIP5K6 gene, castor bean plants were shortened, the number of leaves, stem nodes, male and female flowers increased, male flowers and fruits matured faster, the aging rate of plants slowed down, and pollen viability and seed quality were improved.

[0011] Furthermore, overexpression of the PIP5K6 gene significantly upregulated the PIP5K1, PIP5K2, PIP5K4, PIP5K8, and PIP5K9 genes, resulting in shorter castor bean plant height, increased number of leaves, stem nodes, male and female flowers, accelerated maturation of male flowers and fruits, slower plant aging, and improved pollen viability and seed quality.

[0012] The present invention also provides a method for improving castor bean traits, including the step of upregulating the expression level of the PIP5K6 gene;

[0013] The reference sequence of the PIP5K6 gene is accessed by NCBI under accession number XM_015715277.1.

[0014] Furthermore, the PIP5K6 gene was inserted into an overexpression vector and transformed into castor bean recipient material to improve pollen viability and germination rate, seed quality, male flower and fruit maturation speed, increase the number of leaves, stem nodes and flowers, and reduce the aging rate of castor beans.

[0015] Furthermore, the overexpression vector is pBI121-3*flag.

[0016] The present invention discloses the following technical effects:

[0017] This invention constructed overexpression and interference expression vectors for the PIP5K6 gene and successfully transformed them into the cotyledonary nodes of castor beans. The results showed that, compared to WT, the mutant plant G6-1, which overexpressed the PIP5K6 gene, promoted earlier flowering and the development of flowers and fruits in castor beans. The male flower buds of G6-1 were larger, darker in color, had more stamens, and matured faster; the stigmas of the female flowers were darker and longer, making them more effective at capturing pollen from the air. The fruits of G6-1 split more noticeably; the seeds were fuller, darker in color, with more distinct seed coat patterns and a glossier appearance; the seed germination rate was high, the radicle was longer, and the plant aging rate was slower. Conversely, the mutant plants obtained by interfering with the expression of the PIP5K6 gene exhibited the opposite phenotypic changes. In addition, the PIP5K6 gene affects the expression levels of its family of PIP5Ks (PIP5K1, PIP5K2, PIP5K4, PIP5K8, and PIP5K9). When the PIP5K6 gene is overexpressed, the expression levels of all family genes are upregulated; when the PIP5K6 gene is interfered with, the expression levels of all family genes are downregulated.

[0018] The results confirmed that the PIP5K6 gene provided by this invention can be applied to the genetic engineering breeding of castor beans, and has important utilization value in the cultivation of castor bean varieties with superior traits. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The results of cloning the target gene PIP5K6; M: DL 2000 Marker; 1-2: PIP5K6 gene;

[0021] Figure 2 Image showing single enzyme digestion of the expression vector plasmid; M: DL 15000 Marker; 1: Plasmid control; 2: KpnI single enzyme digestion product;

[0022] Figure 3 Results of Agrobacterium-mediated transformation with overexpression vector; M: DL 5000 Marker; 1-6: PIP5K6 gene;

[0023] Figure 4 The result of RT-qPCR detection of the PIP5K6 gene in G6-1 plants; *: 0.01 <P≤0.05,**:0.001<P≤0.01,***:P≤0.001;

[0024] Figure 5Phenotypic comparison of G6-1 plants and WT plants at 20 days; WT: wild-type control plants; G6-1: overexpressing resistant plants; A: male flowers; B: female flowers; C: fruits;

[0025] Figure 6 Male and female flowers of G6-1 and WT plants; A1, A2, A3: male flower buds, mature male flowers, and female flowers of WT plants; B1, B2, B3: male flower buds, mature male flowers, and female flowers of G6-1 plants; Scale bar: 500.00 μm;

[0026] Figure 7 Results of pollen viability testing for G6-1 plants; WT: Pollen staining results of wild-type plants; G6-1: Pollen staining results of overexpressing resistant plants;

[0027] Figure 8 The image shows the pollen germination of the G6-1 plant; A1, A2: germination results of mature pollen in the WT plant; B1, B2: germination results of mature pollen in the G6-1 plant; scale bar: 50μm (A1, B1), 25μm (A2, B2);

[0028] Figure 9 A comparison of mature capsules of G6-1 and WT plants;

[0029] Figure 10 Comparison of mature seeds of G6-1 and WT plants;

[0030] Figure 11 Seed germination status of G6-1 and WT plants;

[0031] Figure 12 The results of RT-qPCR detection for RNAi-resistant plants;

[0032] Figure 13 Comparison of inflorescences between RNAi-resistant plants and wild-type plants (120 days); WT: wild-type control plants; R6-1, R6-2: RNAi-resistant plants; A: male flowers; B: female flowers; C: fruits;

[0033] Figure 14 The results of observation of flowers in RNAi-resistant plants and WT plants; A1, A2, A3: male flower buds, mature male flowers, and female flowers of wild-type plants; B1, B2, B3: male flower buds, mature male flowers, and female flowers of R6-1 plants; C1, C2, C3: male flower buds, mature male flowers, and female flowers of R6-2 plants; Scale bar: 500.00 μm;

[0034] Figure 15 Pollen staining results for RNAi-resistant plants; WT: Pollen staining results for wild-type plants; R6-1, R6-2: Pollen staining results for RNAi-resistant plants;

[0035] Figure 16 Pollen observation of RNAi resistant plants; A1, A2: WT pollen germination results; B1, B2: R6-1 pollen germination results; C1, C2: R6-2 pollen germination results; Scale bar: 50μm (A1, B1, C1), 25μm (A2, B2, C2);

[0036] Figure 17 A comparison of the capsules of RNAi-resistant plants and WT plants;

[0037] Figure 18 Comparison of mature seeds of RNAi-resistant plants and WT plants;

[0038] Figure 19 Comparison of seed germination between RNAi-resistant plants and WT plants;

[0039] Figure 20 The result of RT-qPCR detection of the PIP5Ks gene in G6-1 plants; *: 0.01 <P≤0.05,**:0.001<P≤0.01,***:P≤0.001;

[0040] Figure 21 RT-qPCR results for the PIP5Ks gene in R6-1 and R6-2; *: 0.01 <P≤0.05,**:0.001<P≤0.01,***:P≤0.001。 Detailed Implementation

[0041] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0042] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0044] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0045] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0046] The castor beans required for this invention were provided by the Inner Mongolia Autonomous Region University Castor Industry Engineering Technology Research Center. The required bacterial strains were ordered from Beijing Zhuangmeng International Biotechnology Co., Ltd. The required RNAi vector backbone was ordered from Shanghai Jinchao Technology Development Co., Ltd. Unless otherwise specified, all other materials, instruments, and reagents used were commercially available; unless otherwise specified, the experimental methods used were conventional experimental methods in the field.

[0047] Example 1: Identification of traits in PIP5K6 gene overexpression resistant plants

[0048] Overexpression of the 1PIP5K6 gene

[0049] 1.1 Target gene

[0050] RNA was extracted from the inflorescence axis of the female castor bean Lm line aLmAB5 and reverse transcribed into cDNA. Seamless cloning primers were designed based on the PIP5K6 gene sequence (the reference sequence of the PIP5K6 gene is available in NCBI under accession number XM_015715277.2) to clone the PIP5K6 gene using cDNA as a template. Primer sequences are shown in Table 1; the reaction system was: 5× primer star buffer (Mg... 2+10.0 μL of premixed dNTP Mixture (2.5 μM); 4.0 μL of dNTP Mixture (2.5 μM); 1.0 μL of GPK6-F; 1.0 μL of GPK6-R; 3.0 μL of cDNA; 0.5 μL of Premix PrimeSTAR HS; 30.5 μL of ddH2O; The reaction program was: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 45 s, 60 °C annealing for 30 s, 72 °C extension for 1 min, for a total of 35 cycles; 72 °C extension for 10 min.

[0051] Table 1 Primers for the target gene

[0052]

[0053] 1.2 Ligation of target gene and vector

[0054] The pBI121-3*flag expression vector (described in the literature "Functional Study of Castor PIP5K11 Gene in Lm-type Female Lines") was digested with a single enzyme at 37°C. The reaction system was: 10×K Buffer, 10.0 μL; restriction enzyme, 5.0 μL; pBI121-3*flag plasmid, 5 μg; ddH2O to a final volume of 100.0 μL. The digestion products were detected by electrophoresis, and the correct bands were recovered and purified. The target gene fragment obtained in the previous step was ligated to the digested vector at 50°C. The ligation system was: target gene fragment, 80-100 ng; digested and purified vector, 280 ng; Super Fusion Cloning Mix (2x), 5 μL; ddH2O to a final volume of 10 μL.

[0055] 1.3 Overexpression vector pBI121-3*flag-PIP5K6 was transformed into Agrobacterium competent cells

[0056] The product of ligating the PIP5K6 gene with pBI121-3*flag was transformed into E. coli DH5α competent cells, and bacterial culture was used as a template for identification by PCR. After PCR identification, the plasmid was extracted from E. coli to obtain the overexpression vector pBI121-3*flag-PIP5K6 of the PIP5K6 gene.

[0057] The PIP5K6 gene overexpression vector pBI121-3*flag-PIP5K6 was transformed into Agrobacterium competent cells GV3101. The overexpression vector was then transformed into the cotyledonary nodes of castor bean aLmAB5 using Agrobacterium-mediated transformation. Plants resistant to the target gene overexpression were screened and domesticated for transfer, resulting in the PIP5K6 gene overexpression resistant plant G6-1.

[0058] 1.4 Molecular identification of PIP5K6 gene overexpression resistant plants

[0059] Total RNA was extracted from resistant plants and WT plants, and reverse transcribed into cDNA. Quantitative PCR primers for the castor bean PIP5K6 gene and internal control were designed using NCBI; primer sequences are detailed in Table 2 (synthesized by Shanghai Sangon Biotech Co., Ltd.). RT-qPCR was performed using the synthesized cDNA as a template. Each plant sample was tested in 5 biological replicates, and the average value was taken. A 23T / T ratio was used. -ΔΔCт The relative expression level of the PIP5K6 gene was calculated using a specific method. Data statistics and analysis were performed using SPSS 19.0 software. Independent samples t-tests were used to compare the significance between means, and the results are presented in bar chart format.

[0060] Table 2. RT-qPCR primers for transgenic plants

[0061]

[0062] Biological identification of resistant plants with 1.5PIP5K6 gene overexpression

[0063] At 90 and 120 days of development, the growth and development of leaves, plant height, stem nodes, flowers, fruits, and seeds of the overexpressing resistant plant (G6-1) and 30 wild-type control plants (WT) were observed and measured. The methods were all in accordance with the literature "Functional study of castor bean PIP5K11 gene in Lm type female line".

[0064] Pollen was determined using the TTC method. Pollen was placed on a glass slide, TTC staining solution was added, and the slide was incubated at 37°C for 15-20 minutes. After incubation, the pollen was observed under a microscope.

[0065] Prepare a culture medium to promote pollen germination (refer to the literature "Functional study of castor bean PIP5K11 gene in Lm type female line"). After germination treatment, evenly scatter the pollen of the plants to be tested on a glass slide, add sucrose and boric acid solution, and incubate for 1 hour. Observe the germination under a microscope and count the pollen germination rate.

[0066] One hundred WT seeds and seeds of plant G6-1 were germinated, and the germination results were observed and statistically analyzed.

[0067] 2 Results

[0068] 2.1 Results of Target Gene Cloning

[0069] Cloning the target gene PIP5K6, the results are as follows: Figure 1 .Depend on Figure 1 The length is approximately 2361 bp, the band is correct, and it will be purified and recovered for later use.

[0070] 2.2 Results of single enzyme digestion of vector plasmid

[0071] The plasmid of the expression vector was digested with a single enzyme, and then... Figure 2 It can be seen that the structure of the plasmid changes after being digested by a single enzyme, and the digestion rate is slower than that of the control plasmid. Therefore, the bands are correct and it can be used for vector construction.

[0072] 2.3 Results of Agrobacterium-mediated transformation with overexpression vector

[0073] The constructed overexpression vector was transformed into Agrobacterium competent cells and identified by PCR. The results are as follows: Figure 3 As shown in the figure, the lengths of lanes 1-6 are all 2361 bp, the bands are correct, and they should be stored in the refrigerator for later use.

[0074] 2.4 Molecular level detection results of PIP5K6 gene overexpression resistant plants

[0075] Quantitative PCR was performed on G6-1 plants: Total RNA was extracted from the inflorescence axis of the main stem of G6-1 plants and WT plants, and reverse transcribed into cDNA. RT-qPCR was then performed using cDNA as a template. The results are as follows: Figure 4 The results showed that the expression level of the PIP5K6 gene was significantly upregulated.

[0076] 2.5 Biological level detection results of PIP5K6 gene overexpression resistant plants

[0077] 2.5.1 Statistical analysis results of flowering and fruit development stages of overexpressing resistant plants

[0078] At 90 days after transplanting, the flowering and fruit development periods of G6-1 plants and 30 WT plants were statistically analyzed, and the results are shown in Table 3. Table 3 shows that at 90 days after transplanting, G6-1 plants were shorter than WT plants, had more basal leaves that aged more slowly, more stem nodes, and more female and male flowers.

[0079] Table 3. Phenotypic detection of resistant plants at 90 days.

[0080]

[0081] Note: Different lowercase letters indicate significant differences (P<0.05).

[0082] 120 days after transplanting, the flowering and fruit development periods of G6-1 plants and 30 WT plants were observed and statistically analyzed. The results are shown in the table below. Figure 5 Table 4 shows that G6-1 plants age more slowly than WT plants, with fewer leaves falling off. G6-1 male flowers mature faster, and capsules also mature faster.

[0083] Table 4. Phenotypic statistics of G6-1 plants at 120 days

[0084]

[0085] 2.5.2 Structural analysis of flowers in resistant plants

[0086] The differences in male and female flowers between G6-1 plants and wild-type control (WT) plants were observed, and the results are as follows: Figure 6 .

[0087] from Figure 6 Observations at A1, A2, B1, and B2 revealed that G6-1 had larger, darker-colored male flower buds, fuller and more numerous stamens, and matured faster than WT. Figure 6 Observations in A3 and B3 revealed that the stigma of the female flower of G6-1 was darker and longer than that of WT, making it more effective at capturing pollen from the air.

[0088] 2.5.3 Results of pollen viability detection in overexpressing resistant plants

[0089] Highly viable pollen is deep red, while less viable pollen is light red or colorless. (From Table 5 and...) Figure 7 It can be seen that the pollen from G6-1 is darker in color and more viable than that from WT. 95% of the pollen from G6-1 is viable, compared to 88% from WT. This indicates that overexpression of the PIP5K6 gene enhances pollen viability.

[0090] Table 5. Pollen viability statistics of PIP5K6 gene overexpression resistant plants.

[0091]

[0092] The pollen germination rate of G6-1 plants was measured, and the results are as follows: Figure 8 As shown in Table 6, a statistical analysis of 100 mature pollen grains revealed that G6-1 pollen germinated faster and was less prone to fragmentation; moreover, the germination rate of G6-1 pollen was 12 percentage points higher than that of WT. This indicates that overexpression of the PIP5K6 gene enhances the pollen's ability to germinate and form pollen tubes.

[0093] Table 6. Pollen germination rate statistics of G6-1 and WT plants.

[0094]

[0095] 2.5.4 Results of observation on fruit phenotype of overexpressing resistant plants

[0096] A total of 15 capsules were harvested from the castor bean plant G6-1, which was overexpressed with the PIP5K6 gene and resistant to the gene. The average number of capsules per wild-type (WT) plant was 6. The capsule and seed phenotypes of the overexpressed resistant plant G6-1 and 30 wild-type (WT) plants were observed. Figure 9Analysis shows that G6-1 and WT have the same number of capsule locules, both having 3, but G6-1 has a darker capsule color, more and more curved surface thorns, and less obvious fruit splitting.

[0097] 2.5.5 Results of observation on seed phenotype of overexpressing resistant plants

[0098] Depend on Figure 10 As shown in Table 7, G6-1 seeds are fuller after maturity, have a higher average seed quality, and have a darker, shinier seed coat with more distinct patterns.

[0099] Table 7. Statistical table of 100-seed weight of G6-1 and WT plants

[0100]

[0101] Seeds of G6-1 and WT plants were subjected to germination treatment, and the germination rate was statistically analyzed. The results are shown in Table 8. Figure 11 As shown, G6-1 seeds germinate faster, have longer radicles, and have a higher germination rate than WT seeds.

[0102] Table 8. Seed germination rate statistics of G6-1 plants

[0103]

[0104] Based on molecular and biological identification, the PIP5K6 gene overexpression resistant plant G6-1 was identified as an overexpression mutant plant.

[0105] Example 2: Identification of traits in PIP5K6 gene RNAi resistant plants

[0106] 1.1 Construction of the RNAi vector pCambia2301-PIP5K6 for the PIP5K6 gene and resistant plants

[0107] The reverse and forward interference fragments of the PIP5K6 gene were cloned, respectively. The interference fragment sequence is as follows: TGGCTTGATACTGCCCCTCATGGACAAGGTAAATATCTTTGGACAGATGGGTGCATGTATGTTGGTGAATGGTATAGAGGGAAAACTATGGGGAAAGGTAAATTTAGTTGGCCTTCTGGTGCTACTTATGAAGGTGATTTCAAAAGTGGTTATATGGATGGTAAAGGGACTTATACAGGTTCTTCAGGTGATACATATAGAGGTGCTTGGGTTA The primer sequences for the reverse and forward interference fragments are detailed in Table 9. The vector plasmid pCambia2301 was digested with BamHI and XbaI restriction enzymes. The purified digested products were then ligated with the reverse interference fragment to obtain an intermediate vector plasmid containing the inserted reverse fragment. The intermediate vector plasmid containing the inserted reverse fragment was then digested with KpnI, and the digested products were purified. These were then ligated with the forward interference fragment and transformed into competent *E. coli* cells. Single colonies were selected for PCR detection, and colonies meeting the expected criteria were selected. Subsequently, the culture was shaken and plasmids were extracted, and the amplified products were simultaneously sequenced. The sequencing results were correct, confirming the successful construction of the RNAi vector for the PIP5K6 gene, which was named pCambia2301-PIP5K6. Genetic transformation of castor bean cotyledon nodes was performed using the recombinant vector pCambia2301-PIP5K6, yielding four resistant plants (including R6-1 and R6-2).

[0108] Table 9 Primers for reverse and forward interference fragments

[0109]

[0110] 1.2 RT-qPCR results of RNAi resistant plants

[0111] Real-time quantitative PCR was performed using cDNA from R6-1 and R6-2 plants as templates, and the results are as follows: Figure 12This indicates that the expression level of the PIP5K6 gene was significantly downregulated in R6-1 and R6-2.

[0112] 1.3 Results of biological level detection of RNAi resistant plants

[0113] 1.3.1 Statistical results of flowering and fruit development stages of RNAi resistant plants

[0114] Table 10 shows the results of statistical analysis of the flowering and fruit development stages of RNAi-resistant plants. It can be seen that: 90 days after transplanting, R6-1 and R6-2 plants were shorter, and leaf drop did not change significantly; R6-1 and R6-2 had significantly more female flowers, but the number of male flowers was much less than WT. Since R6-1 and R6-2 plants develop more slowly, it is necessary to further observe whether the number of male flowers will reach the normal level after 120 days.

[0115] Table 10. Growth statistics of RNAi-resistant plants at 90 days

[0116]

[0117] From Table 11, Figure 13 Analysis shows that 120 days after transplanting, the fruits of WT were nearly mature, while those of R6-1 were only entering the fruit development stage. Furthermore, the number of female flowers that ultimately developed into capsules was far less than that of WT, and in some cases, none of the female flowers of R6-2 developed into fruit. Compared to WT, R6-1 flowered approximately 15 days later, and R6-2 flowered approximately 5 days later. Additionally, both R6-1 and R6-2 exhibited slow growth after flowering, and most of the female flowers failed to develop into fruit after pollination.

[0118] Table 11. Growth statistics of RNAi-resistant plants after 120 days

[0119]

[0120] 1.3.2 Results of floral structure analysis of RNAi-resistant plants

[0121] The structure of the flowers of RNAi-resistant plants was observed, and the results are as follows: Figure 14 As shown. From Figure 14 Observations in A1, B1, and C1 revealed that the male flower buds of R6-1 and R6-2 were smaller, with fewer stamens and a lighter color. Observations in A2, B2, and C2 revealed that the filaments of mature male flowers of R6-1 and R6-2 were looser than those of WT plants. Observations in A3, B3, and C3 revealed that the stigmas of female flowers of R6-1 and R6-2 were lighter in color and shorter than those of WT plants, and some stigmas showed signs of necrosis.

[0122] 1.3.3 Results of pollen viability detection in RNAi-resistant plants

[0123] When staining pollen, pollen with high viability is dark red, while pollen with low viability is light red or yellow. The pollen viability detection results of RNAi-resistant plants of the PIP5K6 gene are shown in Table 12. Figure 15 As shown, when 100 pollen grains were observed, the pollen viability of R6-1 and R6-2 was very weak. Specifically, the pollen viability of R6-1 was 57 percentage points lower and that of R6-2 was 65 percentage points lower. This indicates that RNAi of the PIP5K6 gene reduces the pollen viability of castor beans.

[0124] Table 12 Pollen viability detection of RNAi-resistant plants

[0125]

[0126] Note: Different lowercase letters indicate significant differences (P<0.05).

[0127] Pollen from RNAi-resistant plants was stained, and the results were statistically analyzed. The results are shown in Table 13. Figure 16 As shown in the figure. When calculating the germination rate of 100 pollen grains, the germination probability of R6-1 pollen was 53 percentage points lower, and the germination probability of R6-2 pollen was 75 percentage points lower.

[0128] Table 13. Statistics on pollen germination count in RNAi-resistant plants.

[0129]

[0130] Observation and statistics of pollen deformity in RNAi resistant plants, such as Figure 16 As shown in Table 14, compared with WT, mature pollen germination of R6-1 and R6-2 showed abnormalities, with abnormality rates of 40% and 73%, respectively. Combined with the results of pollen germination rate determination in RNAi-resistant plants, this indicates that PIP5K6 gene RNAi affects normal castor pollen development and reduces the proportion of pollen tubes formed during germination.

[0131] Table 14. Statistics on pollen malformation rate in PIP5K6 gene RNAi resistant plants.

[0132]

[0133]

[0134] 1.3.4 Results of observation on fruit phenotype of RNAi resistant plants

[0135] A total of 18 seeds were harvested from the castor bean plant R6-1, which was resistant to the PIP5K6 gene using RNAi, while R6-2 produced no seeds. The wild-type (WT) plants averaged 18 seeds per plant. The capsules of the RNAi-resistant plants were observed and compared. Figure 17As shown, since none of the female flowers of R6-2 developed into fruits, they cannot be compared. The capsules of R6-1 did not split open clearly, were smaller in shape, and lighter in color.

[0136] 1.3.5 Results of Seed Phenotypic Observation of RNAi-Resistant Plants

[0137] like Figure 18 As shown in Table 15, compared with WT seeds, most R6-1 seeds were smaller, of lower quality, and had whitish and dull seed coats. These results indicate that RNAi-resistant plants delay flowering, inhibit flower and fruit development, and reduce seed quality.

[0138] Table 15. Statistical table of 100-seed weight of PIP5K6 gene interference-resistant plants and wild-type plants.

[0139]

[0140] 1.3.6 Results of seed germination rate of RNAi-resistant plants

[0141] The same number of R6-1 and WT seeds were germinated for 72 hours, and the germination status was observed and statistically analyzed. The results are as follows: Figure 19 As shown in Table 16, compared with WT, R6-1 had a lower seed germination rate, with R6-1 at 33% and WT at 66%. This indicates that the germination of castor bean seeds in RNAi plants was affected, resulting in a significant decrease in germination rate.

[0142] Table 16 Seed germination results of RNAi-resistant plants

[0143]

[0144] The PIP5K6 gene RNAi resistant plants R6-1 and R6-2, detected at the molecular and biological levels, are RNAi mutant plants of the PIP5K6 gene.

[0145] Example 3: Analysis results of expression changes of various PIP5Ks genes in mutant plants

[0146] 1.1 Analysis results of expression changes of PIP5Ks genes in mutant plants

[0147] 1.1.1 Effects of overexpression on the expression levels of various PIP5Ks genes in mutant plants

[0148] The expression level of PIP5Ks in G6-1 plants was detected according to the literature "Functional study of castor bean PIP5K11 gene in Lm type female line". The results are as follows: Figure 20 When the PIP5K6 gene in castor bean is overexpressed, the expression levels of other members of the PIP5K gene are significantly upregulated in G6-1 plants.

[0149] 1.1.2 Effects of PIP5K6 gene RNAi on the expression levels of its family of genes

[0150] The expression levels of other PIP5Ks members in the PIP5K6 gene RNAi mutant plants R6-1 and R6-2 were detected, and the results are as follows: Figure 21 This resulted in a significant downregulation of the expression levels of other members of PIP5Ks in R6-1 and R6-2 plants.

[0151] In summary, this invention constructed overexpression and interference expression vectors and successfully transformed them into castor bean cotyledon nodes. Overexpression yielded one mutant plant, G6-1, which is a hermaphroditic inflorescence type. Compared with the wild type (WT), G6-1 promotes earlier flowering and the development of flowers and fruits in castor beans; the male flower buds of G6-1 are larger, darker in color, have more stamens, and mature faster; the stigmas of the female flowers are darker and longer, making them more effective at capturing pollen from the air; the fruits of G6-1 split more clearly; the seeds are fuller, darker in color, with more distinct seed coat patterns and a more glossy appearance; the seed germination rate is high, and the radicle is long.

[0152] Interference expression yielded two mutant plants, R6-1 and R6-2, which are hermaphroditic inflorescence types. R6-1 and R6-2 exhibited earlier leaf drop, slower flowering and fruit maturation, and most female flowers failed to develop into fruits after flowering. R6-1 and R6-2 also showed weaker pollen viability, fewer viable pollen, a low pollen-to-pollen tube ratio, and a certain percentage of pollen malformation. The capsules were almost indehiscent. Mature seeds were small, with whitish and dull seed coats, and a significantly reduced germination rate.

[0153] In addition to the phenotypes mentioned above, a comparison of the biological level detection results of overexpression and interference expression of resistant plants revealed that both overexpression and interference expression of the PIP5K6 gene in castor beans resulted in stunted growth. The molecular mechanism by which both produce this same phenotype is currently unclear and requires further investigation.

[0154] In the quantitative fluorescence detection of the overexpression mutant plant G6-1, the expression levels of family genes (PIP5K1, PIP5K2, PIP5K4, PIP5K8, PIP5K9) were all significantly upregulated; the results of RNAi mutant plants R6-1 and R6-2 were exactly the opposite, with the expression levels of other family members being significantly downregulated.

[0155] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. PIP5K6 The application of genes in regulating castor bean traits is characterized by, The traits include plant height, pollen, seeds, number of leaves, stem nodes and flowers, maturity rate of male flowers and fruits, and plant aging rate; PIP5K6 The reference sequence of the gene is accessed by NCBI under accession number XM_015715277.2; The application is the overexpression of [a specific substance] in castor beans. PIP5K6 Genes, regulation PIP5K1 , PIP5K2 , PIP5K4 , PIP5K8 and PIP5K9 The gene was significantly upregulated, resulting in shorter castor bean plants, increased number of leaves, stem nodes, male and female flowers, faster maturation of male flowers and fruits, slower plant aging, and improved pollen viability and seed quality.

2. A method for improving the properties of castor beans, characterized in that, Will PIP5K6 Genes were inserted into an overexpression vector and transformed into castor bean recipient material to improve pollen viability and germination rate, seed quality, male flower and fruit maturation speed, increase the number of leaves, stem nodes and flowers, and reduce the aging rate of castor beans; PIP5K6 The reference sequence of the gene is accessed by NCBI under accession number XM_015715277.

2.

3. The method according to claim 2, characterized in that, The overexpression vector is pBI121-3. flag.

Images