A multiple myeloma drug resistance related eccdna molecule and application thereof

Abstract

This invention discloses a novel EccDNA molecule associated with drug resistance in multiple myeloma and its applications. Circle-seq sequencing was used to identify a novel EccDNA molecule, EccDNA, that is aberrantly expressed in relapsed / drug-resistant MM. chr7:2101675‑2102072 The circularity of the EccDNA was then verified using reverse PCR (quantitative polymerase chain reaction) and Sanger sequencing. Finally, a larger sample size was used to confirm that this EccDNA is a widely present molecule in relapsed / drug-resistant multiple myeloma (MM), and its role in mediating bortezomib resistance to some extent was demonstrated in cell lines. This molecule provides a new research direction for biomarkers and therapeutic targets of relapsed / drug-resistant multiple myeloma patients.

Description

Technical Field

[0001] This invention belongs to the field of tumor molecular biology technology, specifically relating to an EccDNA molecule associated with drug resistance in multiple myeloma and its applications. Background Technology

[0002] Multiple myeloma (MM) is a group of clonal plasma cell malignant proliferative disorders and the second most common hematologic malignancy. Despite significant advances in MM treatment in recent years, the 10-year survival rate remains only 17%. While the advent of proteasome inhibitors and immunomodulatory agents over the past two decades has extended overall survival in MM by 3-6 years, prolonged treatment inevitably leads to clonal evolution under various therapeutic pressures, ultimately resulting in disease progression and relapse. When MM progresses to the relapse stage, treatment outcomes are often disappointing. Elucidating the pathogenesis of relapsed MM and seeking new, effective treatments are urgent priorities in the field of MM treatment.

[0003] Extrachromosomal circular DNA (EccDNA) is a group of circular double-stranded or single-stranded DNA molecules of varying sizes and sequences found within the cell nucleus, originating from but independent of chromosomal DNA. EccDNA was first confirmed in 1965, and research on it gradually increased until 2015 with the development of Circle-seq technology. EccDNA is widely distributed in eukaryotes, including plants, ciliates, yeast, Xenopus, fruit flies, mammals, and pigeons. A series of studies have confirmed that EccDNA plays an important role in many physiological and pathological processes, including gene amplification, telomere length repair, genome plasticity, and molecular sponging. Although the mechanisms of EccDNA production are still not fully understood, four widely accepted hypothetical models exist: break-fusion bridge (BFB) cycles, chromosome fragmentation, free bodies, and translocation-deletion-amplification models. In summary, EccDNA is a product of a highly unstable genome. Based on size and sequence, EccDNA can be classified into five types: small polydisperse DNA (spcDNA), microDNA, tcircle / ccircle, ERC, and EcDNA. MicroDNA and EcDNA are primarily found in tumor cells. MicroDNA can transcribe non-coding RNA and plays a regulatory role in a range of biological processes, while EcDNA is longer enough to carry complete genes, thus participating in oncogene amplification and genomic heterogeneity. In the study by Yi et al., they established a CRISPR-based ecTag method to label EcDNA in living cells with fluorescent markers and observed evidence of uneven distribution of EcDNA into daughter cells during mitosis. EcDNA lacks centromeres and therefore distributes unevenly among progeny cells during cell division, thus mediating intercellular heterogeneity. Currently, no studies on EcDNA in multiple myeloma (MM) have been reported. Summary of the Invention

[0004] The primary objective of this invention is to provide an EccDNA molecule associated with drug resistance in multiple myeloma. Specifically, circle-seq sequencing was used to identify a novel EccDNA molecule, EccDNA, that is aberrantly expressed in relapsed / drug-resistant MM. chr7 :2101675-2102072 The circularity of the EccDNA was then verified by reverse PCR (quantitative polymerase chain reaction, PCR) and Sanger sequencing. Finally, the sample was expanded to verify that the EccDNA is a widely present molecule in relapsed and drug-resistant MM and to confirm that it mediates bortezomib resistance to a certain extent in cell lines.

[0005] The EccDNA molecular sequence associated with multiple myeloma drug resistance is as follows:

[0006] AGAACAAAGACGCTTCTTCCCTCAACTTACCAAAGTGAGCAGCCTCTATGCTGCCACCCACCAGACTACCGGCTCCATGCTCACCAAAGTGAACAGCTTCTATGCTGCTCACCCACTAGACTGTTGGCTCCGTGCACACAGGGCCACAGCTGTCTCAGTCACCATCACAGCCCAAGCTGGCCCACGCCTGACACATGCT GGATAAACACATACCAGGCAGGAGAAGGAGGAGTGCAGTCCAGTGCACACAGGGGGCTCTGCAGCTGGGAAGACCCTGACTGGAGGTCTGAATCTGCCATGGGTGGGAGTGGGCAGATCACAGCCTCGCTGACCTTGGACCCTCCTGTCTGACTCAGGACTGAGTCTCCCCAGCAGAAGAGGCTGAGAGCACAGGA.

[0007] A second objective of this invention is to provide the use of the reagent for detecting the EccDNA molecules in the preparation of diagnostic and / or prognostic agents for multiple myeloma patients.

[0008] A third objective of this invention is to provide the use of the reagent for detecting the EccDNA molecules in the preparation of diagnostic, prognostic, or drug resistance assays for patients with relapsed multiple myeloma.

[0009] The reagents for detecting EccDNA molecules include PCR detection reagents or in situ hybridization detection reagents.

[0010] Furthermore,

[0011] PCR detection reagents include primers:

[0012] F:ACCAGGCAGGAGAAGGAGGAG

[0013] R: GGTAAGTTGAGGGAAGAAGCG.

[0014] A fourth object of the present invention is to provide the use of reagents that overexpress the EccDNA molecule in the preparation of agents that enhance the invasiveness of multiple myeloma cells.

[0015] A fifth object of the present invention is to provide the use of the reagent for inhibiting the expression of the EccDNA molecule in the preparation of agents that reduce the invasiveness of multiple myeloma cells.

[0016] Multiple myeloma (MM) is a highly heterogeneous group of malignant tumors of the plasma cell system, with survival ranging from several months to over 10 years. Over the years, the use of proteasome inhibitors and immunomodulatory agents has significantly improved the survival rate of MM. However, the disease remains incurable, and with the passage of time, it will eventually relapse and develop drug resistance. Once relapsed and drug-resistant, treatment outcomes are often poor, and the prognosis is bad. Identifying the mechanisms of MM relapse will help in further researching relapsed and drug-resistant MM patients.

[0017] This invention investigated circle-seq sequencing of patients with remission of multiple myeloma (MM) and those with relapsed MM during regular treatment. A large number of EccDNA molecules were detected in each sample. Eight molecules highly expressed in two samples were selected for verification by reverse PCR and Sanger sequencing. The EccDNA in the T1 sample was... chr7:2101675-2102072 The cyclic property was successfully identified. Expanding the clinical sample revealed a high positive rate in relapsed MM, while all samples were negative in remission MM. Further analysis using IC50 calculations, apoptotic cell percentage, and transwell migration assays using this molecule suggested a correlation between this molecule and bortezomib resistance in MM relapse.

[0018] In summary, this invention detected specific EccDNA in relapsed MM patients. chr7:2101675-2102072 This molecule provides a new direction for understanding the mechanisms of relapse and drug resistance in MM patients and for their treatment. Attached Figure Description

[0019] Figure 1 EccDNA molecules were detected in 6 samples;

[0020] Figure 2 Correlation heatmap and PCA plot of EccDNA from 6 specimens;

[0021] Figure 3 Sequencing quality control results of purified EccDNA from 6 samples;

[0022] Figure 4 : EccDNA chr7:2101675-2102072 The genes, proteins, and super enhancers carried are annotated.

[0023] Figure 5 EccDNA chr7:2101675-2102072 Results of molecular application of reverse PCR and Sanger sequencing to validate junction sites;

[0024] Figure 5 A: Schematic diagram of reverse PCR; Figure 5 B: Agarose gel of the reverse PCR product of the molecular genomic DNA and purified circular DNA; Figure 5C: Figure 5 After gel extraction and recovery of the target band in B, Sanger sequencing was performed to verify the junction sites. Figure 5 D: Agarose gel images of the reverse PCR products of purified circular DNA from bone marrow samples of patients in the remission and relapse groups to verify the presence of the molecule;

[0025] Figure 6 EccDNA chr7:2101675-2102072 Electrophoresis results were used to verify the successful transfection of multiple myeloma cell lines RPMI-8226 and NCI-H929.

[0026] Figure 7 EccDNA was analyzed in multiple myeloma cell lines RPMI-8226 and NCI-H929, respectively. chr7 :2101675-2102072 IC50 results of bortezomib after molecular transfection;

[0027] Figure 8 EccDNA was analyzed in multiple myeloma cell lines RPMI-8226 and NCI-H929, respectively. chr7 :2101675-2102072 The proportion of apoptotic cells was detected after molecular transfection with bortezomib 15 nmol / L for 24 hours.

[0028] Figure 9 EccDNA was analyzed in multiple myeloma cell lines RPMI-8226 and NCI-H929, respectively. chr7 :2101675-2102072 Results of transwell migration experiments performed after molecular transfection.

[0029] Figure 10 Further expansion of the sample size was used to validate the obtained ROC curve and EccDNA. chr7:2101675-2102072 Forty-five relapsed and drug-resistant patients with positive molecular markers were divided into low-risk and high-risk groups based on the average expression abundance of the molecule, and survival curves were plotted. Detailed Implementation

[0030] The following examples are intended to further illustrate the present invention, but not to limit it.

[0031] Currently, research tools and methods for EccDNA are mature and feasible. EccDNA can be reconstructed through whole-genome sequencing, Circle-seq, and bioinformatics algorithms. Other epigenetic techniques, such as ChIP-seq, ATAC-seq, and 4Cseq, can assist in exploring topological structures. Reverse PCR combined with Sanger sequencing can be used for EccDNA validation. Optical microscopy (LM), electron microscopy (EM), and fluorescence microscopy can visualize EccDNA.

[0032] Example 1:

[0033] method

[0034] 1. Clinical Samples

[0035] This invention collected bone marrow from more than 50 patients with multiple myeloma who were regularly hospitalized in the Department of Hematology, Xiangya Third Hospital of Central South University from April to May 2023. The bone marrow was placed in 2mL cryovials and then transferred to a -80℃ freezer for storage. The efficacy was evaluated according to the 2016 criteria of the International Myeloma Working Group (IMWG). First, 3 patients who achieved complete remission after initial treatment and 3 patients who relapsed during regular treatment were selected.

[0036] 2. DNA extraction:

[0037] 1. Grind the sample (0.5 mL of bone marrow frozen at -80℃) in liquid nitrogen (using a grinding rod or needle tip);

[0038] 2. After grinding, add cell lysis buffer: 1 mL Buffer, 50 μL 10% NP 40, 2 μL 1 mL DTT;

[0039] 3. Homogenize the cell suspension 10 times using a 1 ml syringe through a 27-gauge needle;

[0040] 4. Place on ice for 20 minutes;

[0041] 5. Centrifuge at 200xg for 5 minutes. The precipitate after centrifugation contains cell nuclei, and the supernatant contains cytoplasm, cell membrane, and mitochondria.

[0042] 6. Wash the cell nucleus pellet with 500 μL of separation buffer, disperse the pellet in a pipette, and homogenize it 10 times with a 25-gauge needle.

[0043] Centrifuge at 7200xg for 10 min and discard the supernatant.

[0044] change Extraction was performed according to the instructions using the DNA Mini Kit.

[0045] 1. Tissue ≤25mg (i.e., the previous nuclear precipitate): 1.5mL centrifuge tube + 180uL ATL + 20uL proteinase K

[0046] 2. Shake and mix thoroughly, then lyse completely at 56℃ for 1-3 hours, shaking intermittently during incubation;

[0047] 3. Oscillate in 200µL Buffer AL for 15 seconds;

[0048] 4. Briefly centrifuge at 70℃ for 10 minutes;

[0049] 5. Shake 200uL of 96-100% alcohol for 15 seconds;

[0050] 6. Transfer the mixture into the column at 6000 x g (8000 rpm) for 1 min;

[0051] 7. 500uL Buffer AW1 6000xg (8000rpm)1min;

[0052] 8. 500uL Buffer AW2 20000xg (14000rpm) 3min;

[0053] 9. 20000 x g (14000 rpm) for 1 min;

[0054] 10. Centrifuge tubes containing 1.5 mL of Buffer AE at room temperature for 1 min; centrifuge at 6000 x g (8000 rpm) for 1 min.

[0055] 11. Repeat step 10.

[0056] 3. circle-seq sequencing

[0057] Total DNA extracted was measured for concentration using a NanoDrop ND-1000 (NanoDrop, USA), and DNA integrity was checked using agarose gel electrophoresis for quality control. Genomic DNA was obtained by digesting mitochondrial DNA with PacI restriction endonuclease from NEB (USA), followed by enzymatic digestion of linear DNA with Plasmid Safe ATP-dependent DNase from Lucigen (USA). Finally, DNA was extracted with a phenol / chloroform / isoamyl alcohol (25:24:1) solution, precipitated with ethanol, and purified as EccDNA. Rolling circle amplification was performed on the purified EccDNA using the NEB phi29-XT RCA Kit. The rolled circle amplification products were analyzed using Diagenode (Belgium). The instrument was used for ultrasonic fragmentation, employing equipment from NEB Corporation of the United States. Ultra TMIIDNA library preparation kits were used to prepare libraries, which were then diluted and sequenced using the Illumina NovaSeq 6000S4 Reagent Kit (300 cycles). Raw sequencing data were quality controlled using FASTP software (V0.23.2), and the resulting data were aligned to the human genome (UCSCHG38) using BWA software (V0.7.17). EccDNA was detected from the sequencing data using Circle-Map software (V1.1.4). The BedTools tool was used to annotate the genes and superenhancers carried by the EccDNA in the GECODE database (GRCh38 assembly, release 42).

[0058] 4. PCR reaction:

[0059] Primers were designed using Primer Premier5, and the purified EccDNA was processed using TransGen Biotech (Beijing) Co., Ltd. PCR amplification was performed using FastPfu DNA Polymerase in a 50 μL reaction system. Specifically: 1 μL template, 1 μL forward primer (10 μM / L) (final concentration 0.2 μM / L), and 1 μL reverse primer (10 μM / L) (final concentration 0.2 μM / L). FastPfu DNA Polymerase 1uL (2.5 units),

[0060] FastPfu Buffer (1x) 10uL, 2.5mM dNTPs 4uL (0.2mM / L), RNase-free water 32uL.

[0061] Add the mixture to each well of the corresponding PCR tube, and then place the tube on a PCR instrument for PCR reaction. The reaction conditions are set as follows: 95℃ pre-denaturation for 2 min, followed by 35 cycles of 95℃ for 20 s, 53.5℃ for 20 s, 72℃ for 3 s, and 72℃ for 5 min extension.

[0062] EccDNA chr7:2101675-2102072 The primer sequences are:

[0063] F:ACCAGGCAGGAGAAGGAGGAG

[0064] R:GGTAAGTTGAGGGAAGAAGCG

[0065] 5. Agarose gel electrophoresis + gel cutting and recovery

[0066] 1. Gel preparation: Slowly pour one packet of TAE instant granules into a clean beaker, add 600mL of distilled water, and stir well with a magnetic stirrer. After the solution becomes clear, add distilled water to bring the volume to 1L to obtain 1×TAE buffer. Agarose 0.75g + TAE 50mL (1.5%). Microwave heating to boiling, stopping and repeating 3 times, then cooling to 60℃ and adding DNA dye (10000X: 50mL added to 5uL).

[0067] 2. Pour the gel, cool (30 min), remove the comb, electrophoresis tank, and spot the sample (DNA Marker 5 uL, DNA loading buffer 5 uL + PCR product 25 uL).

[0068] 3. Electrophoresis: 120V, 30min. Observe the electrophoresis results and extend the electrophoresis time if necessary.

[0069] 4. Imaging system: Imaging is performed on an agarose gel loading platform.

[0070] Using Norvitamin Gel DNA Extraction Mini Kit: Perform gel extraction according to instructions.

[0071] 1. After DNA electrophoresis, quickly cut the gel containing the target DNA fragment under UV light. Absorb all liquid from the gel surface with a paper towel and chop it into small pieces, removing as much excess gel as possible. Weigh the gel (excluding the weight of the empty tube).

[0072] The value is 20 mg (100 mg of gel is equivalent to 100 μl volume, which is considered as one gel volume).

[0073] 2. Add an equal volume of 20 μL of Buffer GDP. Incubate in a water bath at 50–55°C for 7–10 minutes. Adjust the time according to the size of the gel to ensure complete dissolution of the gel. Invert the container twice during the water bath to accelerate the dissolution process.

[0074] 3. Briefly centrifuge to collect droplets on the tube wall. Place the FastPure DNA Mini Columns-G adsorption column in...

[0075] Transfer the sol solution to the adsorption column using 2ml collection tubes, and incubate at 12,000 rpm (13,800 rpm).

[0076] Centrifuge (×g) for 30-60 seconds.

[0077] 4. Discard the filtrate and place the adsorption column in the collection tube. Add 300 μl of Buffer GDP to the adsorption column and let it stand for 1 minute.

[0078] Centrifuge at 12,000 rpm (13,800 × g) for 30-60 seconds.

[0079] 5. Discard the filtrate and place the adsorption column in the collection tube. Add 700 μl of Buffer GW (with anhydrous ethanol added) to the adsorption column and centrifuge at 12,000 rpm (13,800 × g) for 30-60 seconds.

[0080] 6. Repeat step 5.

[0081] 7. Discard the filtrate and place the adsorption column back into the collection tube. Centrifuge at 12,000 rpm (13,800 × g) for 2 min.

[0082] 8. Place the adsorption column in a 1.5 ml sterile centrifuge tube, add 20-30 μl of Elution Buffer to the center of the adsorption column, incubate for 2 min, and centrifuge at 12,000 rpm (13,800 × g) for 1 min. Discard the adsorption column and...

[0083] The DNA was stored at -20°C and sent to a sequencing company for Sanger sequencing.

[0084] 6. Transfection

[0085] 1. Seed 1 mL of logarithmic growth phase cells (multiple myeloma cell line RPMI-8226) into each well of a 12-well plate.

[0086] NCI-H929 cell line), 3x10 6 / mL.

[0087] 2. For each well of a 12-well plate to be transfected, add 50 μl of antibiotic-free and serum-free 1640 culture medium, add 1 μg of synthetic circular DNA, and gently mix by pipetting; then add 1 μl of Lipo8000. TM Mix the transfection reagent gently by blowing it through a pipette.

[0088] 3. Continue culturing for 24 hours and then calculate the IC50 of bortezomib.

[0089] 7. CCK-8 Experiment

[0090] 1. Seed 200 μL of transfected cells in logarithmic growth phase into 96-well plates, 8000 cells / 200 μL of culture medium, and set the number of replicates to 3.

[0091] 2. Set up blank wells, control wells, and drug concentration gradient wells. The blank wells are made of complete culture medium, the control wells are the group without drug, and the drug concentration gradients are set as bortezomib 5 nmol / L, 10 nmol / L, 15 nmol / L, 20 nmol / L, 25 nmol / L, and 30 nmol / L.

[0092] 3. After culturing for 24 hours, add 20 μL of CCK-8 reagent to each well and continue culturing for 3 hours. Measure the absorbance at 450 nm using a microplate reader.

[0093] 8. Annexin V-FITC / PI detection

[0094] 1. 1x10 5 Transfected cells in logarithmic growth phase were resuspended in complete medium containing 15 nmol / L bortezomib and seeded in 6-well plates for 24 h. Double-stranded linear DNA (DsDNA) transfection was used as a negative control.

[0095] 2. After 24 hours, use the Annexin V-FITC / PI apoptosis detection kit according to the instructions (BD FACSCanto). TM Apoptotic cells were detected by flow cytometry, and the data were analyzed using FlowJo software.

[0096] 9. Transfer Experiment

[0097] 1. Preparation of transfected cell suspension: Cells were starved for 12 hours beforehand to remove serum influence, resuspended, and the cell density was adjusted to 5 × 10⁶ cells / year. 5 / mL.

[0098] 2. Add 100 μL of cell suspension to the upper chamber of the Transwell plate and 600 μL of culture medium containing 20% ​​FBS to the lower chamber of the 24-well plate.

[0099] 3. After culturing for 24 hours, remove the transwell chamber, stain with crystal violet, and take pictures under a microscope.

[0100] 10. Statistical Analysis

[0101] ROC analysis was performed, and GraphPad Prism 10.0 was used to compare means. Data are expressed as mean ± standard deviation. For normally distributed samples, a two-tailed unpaired Student's t-test was used; otherwise, nonparametric tests were used. When analyzing clinical data, Kaplan-Meier survival curves were used, and the significance was tested using the Log-rank test. All statistical tests were defined as p < 0.05 as statistically significant.

[0102] result

[0103] Of the 6 patients, 5 were female and 1 was male, with a median age of 62 (54–73) years. Three patients had IgGκ type, 1 had IgGλ, 1 had IgAλ, and 1 had κ type. Three patients achieved complete remission at presentation (control group), and three patients relapsed at presentation (text group), including two first-time relapses and one second-time relapse. 66849 (49–64382864 bp), 141670 (36–199294363 bp), 137324 (37–223214095 bp), 93417 (34–85473352 bp), 39748 (36–223224992 bp), and 56613 (34–80539670 bp) EccDNA were analyzed from the 6 samples. Figure 1 Both the PCA plot and the correlation heatmap indicated significant heterogeneity of EccDNA among the six samples. Figure 2 Sequencing quality control results of purified EccDNA from 6 samples (). Figure 3 ), and also EccDNA chr7:2101675-2102072 Annotations of the carried gene, protein, and superenhancer showed that the molecule carried a protein-coding gene and also detected an enhancer. Figure 4 To demonstrate the circular nature of the EccDNA molecule, four molecules with high expression abundance from the C2 and T1 samples were selected for reverse PCR and Sanger sequencing to verify the junction site. The EccDNA in the T1 sample... chr7:2101675-2102072 The molecule was confirmed to form a circular structure. It was negative in the remaining 5 sequencing samples. To further investigate its expression in multiple myeloma (MM), a larger clinical sample was developed for validation. The results showed that the molecule was negative in all 12 patients in the remission group, while it was positive in 7 out of 11 relapsed patients. Figure 5 To further verify whether this molecule is related to relapse and drug resistance in multiple myeloma (MM), the molecule was transfected into the RPMI-8226 and NCI-H929 cell lines, respectively. Figure 6 The results are amplification electrophoresis results verifying successful transfection of this molecule. Then, the IC50 of bortezomib in the transfected and untransfected control cell lines was calculated. It was found that transfection with this molecule led to an increase in IC50 in both cases, suggesting a certain correlation between this molecule and MM relapse and drug resistance. Figure 7 Furthermore, multiple myeloma cell lines RPMI-8226 and NCI-H929 were transfected with this molecule. After treatment with bortezomib 15 nmol / L for 24 hours, the proportion of apoptotic cells was detected. It was found that the proportion of apoptotic cells after transfection with this molecule decreased compared with the untransfected group. Figure 8Furthermore, transwell migration assays were performed on RPMI-8226 and NCI-H929 cell lines after transfection with this molecule, and the results showed that cell invasiveness increased after transfection with this molecule. Figure 9 Further, in collaboration with multiple hospitals, the sample size was expanded for validation. The positive rate of this molecule was 4% in 50 patients in remission and 90% in 50 patients with relapse. ROC curve analysis was performed. Figure 10 The AUC was 0.9307. Furthermore, in 45 patients with recurrent positive results, patients were divided into low-risk and high-risk groups based on the average expression abundance of this molecule. Survival curves were plotted, showing that the survival curve of the high-risk group was significantly lower than that of the low-risk group, suggesting that this molecule is also related to patient prognosis. Figure 10 ).

Claims

1. An EccDNA molecule associated with drug resistance in multiple myeloma, wherein the sequence of the EccDNA molecule is as follows: AGAACAAAGACGCTTCTTCCCTCAACTTACCAAAGTGAGCAGCCTCTATGCTGCCACCCACCAGACTACCGGCTCCATGCTCACCAAAGTGAACAGCTTCTATGCTGCTCACCCACTAGACTGTTGGCTCCGTGCACACAGGGCCACAGCTGTCTCAGTCACCATCACAGCCCAAGCTGGCCCACGCCTGACACATGCT GGATAAACACATACCAGGCAGGAGAAGGAGGAGTGCAGTCCAGTGCACACAGGGGGCTCTGCAGCTGGGAAGACCCTGACTGGAGGTCTGAATCTGCCATGGGTGGGAGTGGGCAGATCACAGCCTCGCTGACCTTGGACCCTCCTGTCTGACTCAGGACTGAGTCTCCCCAGCAGAAGAGGCTGAGAGCACAGGA.

2. The use of the EccDNA molecular reagent of claim 1 in the preparation of diagnostic, prognostic, or drug resistance detection agents for patients with relapsed multiple myeloma.

3. Use according to claim 2, characterized in that, The detection reagent for EccDNA as described in claim 1 includes PCR detection reagents or in situ hybridization detection reagents.

4. Use according to claim 3, characterized in that, PCR detection reagents include primers: F:ACCAGGCAGGAGAAGGAGGAG R: GGTAAGTTGAGGGAAGAAGCG .

5. The use of the reagent for overexpressing the EccDNA molecule of claim 1 in the preparation of agents that enhance the invasiveness of multiple myeloma cells.

Images