Rice cdpk20 gene and use thereof in improving plant resistance to abiotic stress

Abstract

The application belongs to the field of agricultural biotechnology, and discloses the use of rice CDPK20 gene in improving the resistance of plants to abiotic stress, especially low temperature. The application also discloses the use of rice CDPK20 protein or its coding nucleic acid in improving the resistance of plants to abiotic stress, including: 1) constructing a rice CDPK20 functional loss mutant vector; 2) transforming the constructed vector into a receptor plant (rice) callus; and 3) cultivating a new plant variety with enhanced response to adversity at the germination stage, especially low temperature stress. The application has important theoretical and practical significance for cultivating high-yield stress-tolerant varieties and accelerating the process of stress-resistant molecular breeding.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to the rice CDPK20 gene and its use in improving plant resistance to abiotic stress. Background Technology

[0002] Rice (Oryza sativa L.) is considered one of the most important food crops globally, providing a primary food source for nearly half of the world's population. Originating in tropical and subtropical regions, rice is a warm-climate-loving crop, particularly sensitive to low temperatures. Low temperatures severely impact rice germination and emergence rates. In recent years, direct seeding technology has been widely adopted, offering advantages over traditional transplanting techniques such as lower cost and easier operation. However, direct seeding production also faces challenges such as poor seedling emergence, weed infestation, and lodging. Therefore, rapid seed germination is crucial for ensuring seedling emergence in direct seeding fields. To this end, identifying new genes regulating rice seed germination, elucidating their molecular mechanisms, and understanding their breeding applications will provide important clues for advancing direct seeding rice production.

[0003] Low temperature stress reduces cell membrane fluidity, leading to changes in the activity or conformation of membrane-localized proteins. 2+ It is an important second messenger, proven to be involved in plant adaptation to environmental changes. CDPK20 (Calcium-Dependent Protein Kinase 20) encodes a calcium-dependent protein kinase. Under low-temperature stress, CDPK can act as a key component of the calcium signaling pathway, sensing changes in intracellular calcium ion concentration, thereby converting Ca2+ signals into protein signals, further activating downstream signaling pathways, and regulating the plant's response to low temperature. Although some members of the CDPK family have been shown to participate in the regulation of cold tolerance in rice, the role of CDPK in the regulation of cold tolerance during rice germination remains unclear. Summary of the Invention

[0004] The main objective of this invention is to provide the rice CDPK20 gene and its use in improving plant resistance to abiotic stress, especially in improving cold tolerance during rice germination.

[0005] To achieve the above-mentioned objectives, this invention provides the application of rice CDPK20 protein or its encoded nucleic acid in improving plant resistance to abiotic stresses.

[0006] Further, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1 or its degenerate sequence, or the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 3 or its degenerate sequence.

[0007] Furthermore, the CDPK20 protein comprises the amino acid sequence shown in SEQ ID NO: 2.

[0008] Further, specifically including: (1) constructing a recombinant plant expression vector with loss of function of rice CDPK20; (2) transforming the constructed recombinant plant expression vector into plant tissues or plant cells; (3) cultivating and screening transgenic plants with improved resistance to abiotic stresses.

[0009] Furthermore, the application specifically includes: (1) constructing a rice CDPK20 loss-of-function mutant vector using CRISPR technology; (2) transforming the constructed vector into callus of the recipient plant (rice); and (3) cultivating and screening transgenic plants that exhibit enhanced response to germination stress, preferably low-temperature stress. The indicators of cold tolerance during germination of the plants described in this invention include germination rate, germination index, and seedling rate.

[0010] Furthermore, the abiotic stress includes low temperature stress, specifically low temperature stress during the germination period.

[0011] Furthermore, the abiotic stress includes low-temperature stress. Preferably, the low temperature is below 12°C, 11°C, 10°C, 9°C, 8°C, 7°C, 6°C, 5°C, 4°C, 3°C, 2°C, 1°C, or 0°C.

[0012] Furthermore, the plants mentioned include, but are not limited to, monocotyledonous or dicotyledonous plants; more preferably, the plants include crops, vegetables or ornamental plants, fruit trees, etc., such as rice, cotton, corn, sorghum, wheat, soybean, potato, barley, tomato, sugarcane or Arabidopsis thaliana, etc., with rice being the preferred variety.

[0013] Compared with the prior art, the present invention has the following technical advantages:

[0014] This invention observes the phenotypic changes of CRISPR knockout rice plants during germination under extreme low temperature of 12℃, performs gene cloning and functional analysis, and analyzes the relationship between candidate genes and abiotic stress response during rice germination. The results show that the loss of CDPK20 function in rice can significantly improve the ability of rice to resist low temperature stress, resulting in a significant increase in germination rate and seedling rate. Attached Figure Description

[0015] Figure 1 This shows the knockout status of various lines of the CDPK20 mutant in rice.

[0016] Figure 2 PCR positive identification of CDPK20 knockout transgenic plants was performed. Lanes 1-4 were CDPK20 mutants, lane 5 was a negative control, and lane 6 was a negative control with added double-distilled water.

[0017] Figure 3 This study analyzes the expression pattern of CDPK20 in rice. A represents the subcellular localization of the CDPK20 protein, B represents the expression level of the CDPK20 gene in seeds under low-temperature stress, and C represents the expression of the CDPK20 gene in different tissues (roots, stems, leaves, flowers, and seeds).

[0018] Figure 4 Germination experiments were conducted on wild-type and CDPK20 knockout transgenic plants under normal conditions. A represents germination rate; B represents time to reach 50% germination rate; C represents germination index; D represents seedling survival rate; E represents time to reach 50% seedling survival rate; and F represents seedling survival index.

[0019] Figure 5 Germination experiments were conducted on wild-type and CDPK20 knockout transgenic plants under 12℃ low-temperature stress. A represents germination rate; B represents time to reach 50% germination rate; C represents germination index; D represents seedling survival rate; E represents time to reach 50% seedling survival rate; and F represents seedling survival index. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0021] Definitions of terms involved in this invention

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0023] The terms "polynucleotide" or "nucleotide" refer to deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers, either in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs (phosphate thioesters, phosphoramidites, etc.) used in antisense techniques. Unless otherwise specified, specific nucleic acid sequences implicitly encompass variants of their conserved modifications (including, but not limited to, degenerate codon substitutions) and complementary sequences, as well as explicitly specified sequences. Specifically, degenerate codon substitution can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with a mixed base and / or deoxyinosine residue.

[0024] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. That is, the description of a polypeptide is equally applicable to the description of a peptide and the description of a protein, and vice versa. The terminology applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terminology covers amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.

[0025] The term "recombinant plant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, an engineered selection marker for expression in plant cells, and the heterologous DNA sequence to be transcribed.

[0026] The term "off-target" refers to the phenomenon where there are numerous base segments in the genome sequence that are very close to a specific nucleotide sequence. During gene editing, these segments, which are very close to the target of the guide RNA, may also bind to and be knocked out. Off-target effects can be ruled out by verifying whether the phenotypes of mutants produced by different targets are consistent.

[0027] In this invention, the term "transformation" refers to the genetic transformation of polynucleotides or polypeptides into plants by introducing the gene encoding the rice CDPK20 protein into plant cells. Methods for introducing such polynucleotides or polypeptides into plants are well known in the art, including but not limited to stable transformation, transient transformation, and virus-mediated transformation. "Stable transformation" refers to the integration of the introduced polynucleotide construct into the genome of a plant cell and its inheritance through its progeny; "transient transformation" refers to the introduction of a polynucleotide into a plant but its temporary expression or presence in the plant.

[0028] In this invention, the term "germination rate" refers to the percentage of rice seeds that germinate normally within a specified period under optimal germination conditions. Rice seedling emergence rate refers to the percentage of rice seeds that successfully grow into mature, healthy seedlings from sowing to the appearance of a certain number of mature leaves in the paddy field within a certain timeframe. It reflects the viability of rice seeds and their emergence after sowing.

[0029] Example 1: Construction of CDPK20 gene CRISPR knockout vector

[0030] Knockout target sites 1 and 2 were designed based on the CDPK20 gene cDNA sequence (SEQ ID NO: 1) (Table 1).

[0031] Table 1 Knockout target sites (5'-3')

[0032] Target site 2 AATTTTGATGAGCTGAAGCT(SEQ ID NO:5)

[0033] Primers CDPK20 target1-BsF, CDPK20 target1-F0, CDPK20 target2-R0, and CDPK20 target2-BsR were designed based on the target sites. Four-primer PCR amplification was performed using a 100-fold diluted pCBC-MT1T2 plasmid as a template. The PCR products were purified and recovered, and the final vector was constructed using an enzyme digestion-ligation system. The vector was named CRISPR-CDPK20.

[0034] Table 2 Gene knockout primers (5'-3')

[0035]

[0036] Figure 1The results show that mutation type 1 (CDPK20-1) involves a 1bp deletion at target site 1 in the coding region of CDPK20. This deletion causes a frameshift during translation, ultimately leading to premature translation termination at amino acid 194. Mutation type 2 (CDPK20-2) involves an addition of 1bp at target site 1 in the coding region of CDPK20. This deletion also causes a frameshift during translation, ultimately leading to premature translation termination at amino acid 191. The CDPK20 protein possesses two functional domains: an S_TKc kinase domain and an EF-hand domain for sensing Ca2+. 2+ Signal.

[0037] Example 2 Agrobacterium transformation

[0038] The CRISPR-CDPK20 knockout vector was transferred into Agrobacterium EHA105 competent cells using the freeze-thaw method (competent cells were purchased from Shanghai Sangon Biotech Co., Ltd.). The specific experimental method was as described in the Molecular Cloning Laboratory Manual.

[0039] Example 3 Genetic Transformation

[0040] 1) Sterilization: Remove the shells from healthy, plump Zhonghua 11 seeds, soak them in 70% ethanol for 1-2 minutes, add 50% bleach and place on a shaker (200 rpm) for about 1-1.5 hours. Rinse with sterile water 4-6 times, place the seeds on sterile filter paper to absorb excess moisture, and then evenly place them in NBD medium and incubate in the dark at 28°C. All the above steps are performed in a laminar flow hood.

[0041] 2) Subculture: After dark culture for about 10-15 days, the rice seed buds are separated and transferred to subculture medium NBD for continued dark culture at 28℃; after 10 days, the seeds are separated from the callus and the callus is transferred to a new subculture medium NBD. After dark culture at 28℃ for about 4-5 days, Agrobacterium transformation can be carried out.

[0042] 3) During this period, Agrobacterium containing plasmids is streaked on the corresponding antibiotic culture medium. After 2 days, single clones are picked, streaked again, and cultured for 1 day.

[0043] 4) Collect the bacterial cells from the culture medium, vortex them in NBC1 medium containing acetylsyringone (AS), and adjust the OD to about 0.1-0.2;

[0044] 5) Transformation: Select healthy callus tissue into a sterile Erlenmeyer flask, add the above-prepared suspension, gently shake at room temperature for about 10 minutes, discard the bacterial solution, place the callus tissue on sterile filter paper, absorb the excess bacterial solution, and place it in a laminar flow hood to blow air until the callus tissue turns slightly white. Then transfer the callus tissue to NBC2 medium with a layer of sterile filter paper, and co-culture at 22°C in the dark for 2 days.

[0045] 6) Screening: Transfer the co-cultured callus to NBS1 medium containing the corresponding antibiotic, incubate in the dark at 28°C for 10-12 days, then transfer it to NBS2 medium and continue incubation in the dark at 28°C for 10-12 days.

[0046] 7) Differentiation: After transferring the callus to NBR1 medium, culture it in the dark at 28°C for 6 days, then transfer it to an artificial climate incubator with 15h light / 9h darkness and culture it at 28°C for 15-20 days. During this period, callus tissue with green spots is transferred to NBR2 medium and cultured until it differentiates into seedlings.

[0047] 8) Cut the roots and leaves of the transgenic seedlings that are about 5cm tall, transfer them to the rooting medium, and culture them at 28°C in an artificial climate incubator with 12h light / 12h darkness.

[0048] 9) Hardening off seedlings: Once the root system of the transgenic seedlings is sufficiently developed, open the culture bottle for about 2 days, wash off the culture medium, place the seedlings in water for 1 week, and then transfer them to the soil for planting.

[0049] The culture medium formulations used in the above genetic transformation process are shown in Table 3; the preparation of hormone and antibiotic storage solutions in the culture medium is shown in Table 4.

[0050] Table 3 Genetic transformation culture medium

[0051]

[0052] Table 4. Preparation of Hormone and Antibiotic Storage Solutions

[0053] NAA 1 mg / ml (initial dissolved in ethanol) 4℃ IAA 1 mg / ml (initial dissolved in ethanol) -20℃ KT 1 mg / ml (initial dissolved NaOH) -20℃ 6-BA 2 mg / ml (initial dissolved in NaOH) -20℃ 2,4-D 2 mg / ml (initial dissolved in 95% ethanol) 4℃ Rifampicin 50 mg / ml (soluble in methanol) -20℃ Kanamycin 50mg / ml -20℃ Temetin 50mg / ml 4℃ Hygromycin 50mg / ml 4℃ Acetyleugenol 100 μM / L (DMSO) -20℃

[0054] Example 4 Molecular Identification of Transgenic Plants

[0055] The resulting T0 generation transgenic seedlings were validated by PCR and propagated. T1 generation transgenic seeds were harvested, and homozygous mutant materials were obtained through positive validation and sequencing. These homozygous mutant materials were then propagated, and the offspring were screened using hygromycin (50 mg / L) to obtain homozygous Cas9-free mutant materials. These materials were then propagated again, and the offspring were screened using hygromycin (50 mg / L) to obtain homozygous Cas9-free mutant materials.

[0056] The primers used for molecular identification of transgenic plants, including those for overexpression and mutant line identification, are shown in Table 5.

[0057] Table 5 Primers for molecular identification of transgenic plants (5'-3')

[0058]

[0059]

[0060] Example 5 Molecular Identification of Transgenic Plants

[0061] (1) Seeds of T3 generation CDPK20 knockout mutant and wild-type Zhonghua 11 were selected.

[0062] (2) Rice cultivation in soil: After the newly harvested seeds break dormancy, soak them in a 28℃ incubator for 3 days until they germinate, and then sow them. Select seeds with uniform germination and sow them evenly in a mixture of nutrient soil and vermiculite prepared in a ratio of 3:1. Cover the surface with a layer of vermiculite and then let them grow normally in a 28℃ incubator. Water them once every 2-3 days during this period.

[0063] (3) Rice hydroponics: Select seeds with consistent germination and sow them in a 96-well PCR plate with the bottom removed. Place the plate in a 28℃ incubator and grow. Change the water every 2-3 days. Add an appropriate amount of nutrient solution when the third leaf just emerges. Change the water to clean water after the third leaf has fully unfolded.

[0064] (4) After the disinfected rice seeds germinate at room temperature, they are sown. Each experimental group has at least 3 replicates. After two weeks of cultivation under light at 28℃, the seeds are treated at 12℃ for 2-4 days (depending on the actual situation), and then transferred to 28℃ to resume growth for one week.

[0065] (5) For the identification of mutants, the genome near the target site was amplified as shown in SEQ ID NO.3 and sent to Sangon Biotech Co., Ltd. for sequencing. The mutation type was determined by comparing the sequencing results, which were mutation type 1 (CDPK20-1) and mutation type 2 (CDPK20-2).

[0066] Example 6: Identification of stress resistance (preferably cold tolerance) during rice germination.

[0067] Select 30 healthy, plump rice seeds. Soak them in a 50% bleach solution for 10 minutes to sterilize. Rinse them with clean distilled water until there is no disinfectant smell. Place two clean filter papers (9cm in diameter) in a 9cm petri dish and add 10mL of sterile distilled water to thoroughly moisten the filter papers. Then, blot the surface of the rinsed seeds dry and spread them evenly on the moistened filter paper. Place the dish in a dark incubator and wait for the seeds to germinate.

[0068] At room temperature, seed germination and seedling emergence were recorded every half day. Simultaneously, at a low temperature of 12℃, records were recorded every other day starting from day 7. Germination was defined as a coleoptile length of 2 mm or more, and was completed when all seeds had germinated or the number of germinating seeds remained constant across three consecutive records. Seedling emergence was defined as a root length of 2 mm or more, and was completed when all seeds had reached seedling stage or the number of seedlings remained constant across three consecutive records.

[0069] Germination rate (Gt) calculation formula:

[0070] Gt = D t / 30

[0071] Germination Index (GI) calculation formula:

[0072]

[0073] Gt represents the daily germination rate, and Dt represents the daily number of germinated buds.

[0074] The results are as follows Figure 4-5 As shown, at room temperature, there were no significant differences in germination rate, germination index, and seedling rate between the mutant and the wild type. Figure 4 However, at low temperatures, the mutant showed significantly higher germination rate, germination index, and seedling survival rate from day 12 to day 11 than the wild type. Figure 5 ).

[0075] Unless otherwise specifically stated, the numerical values ​​set forth in these embodiments do not limit the scope of the invention. In all examples shown and described herein, any specific value should be interpreted as merely exemplary and not as a limitation, unless otherwise specified; therefore, other examples of exemplary embodiments may have different values.

Claims

1. The application of knocking out the CDPK20 protein-coding gene in rice to improve seed germination rate and seedling emergence rate under low temperature stress, characterized in that... The amino acid sequence of the CDPK20 protein is the sequence shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, Specifically, it includes: (1) Constructing rice CDPK20 Recombinant rice expression vectors with gene loss of function; (2) Transform the constructed recombinant rice expression vector into rice tissues or rice cells; (3) Cultivate and screen rice varieties with improved seed germination rate and seedling rate under low temperature stress.

3. The application according to claim 2, characterized in that, The low-temperature stress temperature is 12°C.

Images