Catalase mutants

Abstract

The application belongs to the technical field of genetic engineering and protein modification, and specifically provides a catalase mutant. The mutant is a wild-type catalase with substitution of the 47th and / or 641th amino acid, and the heat resistance is significantly improved, which is conducive to the wide use of the mutant in the fields of food and textiles.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and protein modification technology, and specifically relates to a catalase mutant. Background Technology

[0002] Hydrogen peroxide oxidoreductase (catalase EC 1.11.1.6.) is an enzyme that catalyzes the decomposition of hydrogen peroxide into water and oxygen. This enzyme is one of the key enzymes in biological defense systems established during biological evolution. Hydrogen peroxide solution has wide applications as a disinfectant or bactericide. After sterilization, hydrogen peroxide solution can be easily removed with water and decomposes naturally over time. However, the reactive oxygen species produced by residual hydrogen peroxide may cause cell aging or cancer; therefore, it is desirable to completely decompose and remove hydrogen peroxide after use. Catalase is highly effective in decomposing hydrogen peroxide, and it can decompose hydrogen peroxide without adding new chemicals. In fact, catalase has been used to decompose and remove residual hydrogen peroxide after cotton bleaching and in food, and it has important applications in the food, pharmaceutical, textile, paper, and environmental protection industries.

[0003] To date, catalase is known to originate from both microbial and animal sources, such as pig and bovine livers. The location of catalase within the cell varies depending on its source. Animal erythrocytes, livers, and bacteria contain catalase in the cytoplasm, requiring cell disruption for extraction, thus making enzyme isolation and purification complex. While the thermal and alkaline stability of bacterial catalase varies depending on its source, its intracellular nature makes high-yield production and extraction inconvenient. Yeast catalase primarily accumulates intracellularly, while some filamentous fungi mainly secrete catalase extracellularly, though a certain amount is also present intracellularly.

[0004] Among the catalases mentioned above, Aspergillus niger, a filamentous fungus, is one of them. Aspergillus niger Catalase produced by Aspergillus terrestris and catalase derived from pig liver are commonly used in industrial applications. However, these catalases have low heat resistance; it is known that only about 10% of their activity remains after treatment at 70°C for 30 minutes. On the other hand, especially in applications such as fiber processing and food processing, high temperatures are required to decompose hydrogen peroxide, thus necessitating catalases with higher heat resistance than conventional products. To date, Aspergillus terrestris (…) has been reported as a heat-resistant catalase. Aspergillus terreus ), Alabama pyrophyllosis ( Acremonium alabamensis ), thermophilic ascomycetes ( Thermoascus aurantiacus ), thermophilic arthropods ( Scytalidium thermophilum ), specific humic mold ( Humicola insolens) and thermophilic filamentous fungi ( Thermomyces The catalase produced by )

[0005] To enable catalase to be better used in industries such as food, medicine, textiles, papermaking, and environmental protection, it is necessary to develop catalase with better heat resistance. Summary of the Invention

[0006] The purpose of this invention is to provide a catalase mutant with significantly improved heat resistance, which is beneficial for its widespread use in food, textile and other fields.

[0007] The present invention provides a catalase mutant comprising an amino acid sequence having at least 95% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of 47, 641 compared with SEQ ID NO:1.

[0008] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0009] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0010] In some embodiments of the present invention, the catalase mutant comprises a substitution or combination of substitutions for any one of the following amino acids: D47A; D47F; D47G; D47K; D47L; D47P; D47R; D47S; D47V; D47W; G641A; G641D; G6 41E; G641F; G641M; G641N; G641P; G641R; G641S; G641T; G641V; G641W; G641Y; D47A / G641A; D47A / G641D; D47A / G641E; D47A / G641F; D47A / G641M; D47A / G641N; D47A / G641P; D47A / G641R; D47A / G641S; D47A / G641T; D47A / G641V; D47A / G641W; D47A / G641Y; D47F / G641A; D47F / G641D; D47F / G641E; D47F / G641F; D47F / G641M; D47F / G641N; D47F / G641P; D47F / G641R; D47F / G641S; D47F / G641T; D47F / G641V; D47F / G641W; D47F / G641Y; D47G / G641A; D47G / G641D; D47G / G641E; D47G / G641F; D47G / G641M; D47G / G641N; D47G / G641P; D47G / G641R; D47G / G641S; D47G / G641T; D47G / G641V; D47G / G641W; D47G / G641Y; D47K / G641A; D47K / G641D; D47K / G641E; D47K / G641F; D47K / G641M; D47K / G641N; D47K / G641P; D47K / G641R; D47K / G641S; D47K / G641T; D47K / G641V; D47K / G641W; D47K / G641Y; D47L / G641A; D47L / G641D; D47L / G641E; D47L / G641F; D47L / G641M; D47L / G641N; D47L / G641P; D47L / G641R; D47L / G641S; D47L / G641T; D47L / G641V; D47L / G641W; D47L / G641Y; D47P / G641A; D47P / G641D; D47P / G641E; D47P / G641F; D47P / G641M; D47P / G641N; D47P / G641P; D47P / G641R; D47P / G641S; D47P / G641T; D47P / G641V; D47P / G641W; D47P / G641Y; D47R / G641A; D47R / G641D; D47R / G641E; D47R / G641F; D47R / G641M; D47R / G641N; D47R / G641P; D47R / G641R; D47R / G641S; D47R / G641T; D47R / G641V; D47R / G641W; D47R / G641Y; D47S / G641A; D47S / G641D; D47S / G641E; D47S / G641F; D47S / G641M; D47S / G641N; D47S / G641P; D47S / G641R; D47S / G641S; D47S / G641T; D47S / G641V; D47S / G641W; D47S / G641Y; D47V / G641A; D47V / G641D; D47V / G641E; D47V / G641F; D47V / G641M; D47V / G641N; D47V / G641P; D47V / G641R; D47V / G641S; D47V / G641T; D47V / G641V; D47V / G641W; D47V / G641Y; D47W / G641A; D47W / G641D; D47W / G641E; D47W / G641F; D47W / G641M; D47W / G641N; D47W / G641P; D47W / G641R; D47W / G641S; D47W / G641T; D47W / G641V; D47W / G641W; D47W / G641Y.

[0011] The present invention also relates to DNA molecules encoding the above-mentioned catalase mutant.

[0012] The present invention also relates to recombinant expression vectors having the above-described DNA molecules.

[0013] The present invention also relates to a host cell comprising the above-described recombinant expression vector.

[0014] The host cell is Pichia pastoris ( Pichia shepherds ).

[0015] The host cell is Aspergillus niger ( Aspergillus niger ).

[0016] The host cell is *Trichoderma reesei* ( Trichoderma reesei ).

[0017] The present invention also relates to the application of the above-mentioned catalase mutant in the fields of food and textiles.

[0018] Compared with the wild type, the catalase mutants provided by this invention generally exhibit improved heat resistance. Specifically, the single-point mutant of catalase with substitution at amino acid position 47 or 641 retains 48.35%-69.73% of enzyme activity after treatment at 80℃ for 3 min, and still maintains a high residual enzyme activity of 6.65%-39.52% after treatment at 80℃ for 10 min. The two-point mutant of catalase with simultaneous substitution at amino acids 47 and 641 achieves a maximum residual enzyme activity of 84.38% after treatment at 80℃ for 3 min, and a maximum residual enzyme activity of 57.32% after treatment at 80℃ for 10 min, demonstrating significantly higher heat resistance than the corresponding single-point mutants, achieving unexpected technical results.

[0019] The catalase mutant provided by this invention has significantly improved heat resistance, making it more suitable for industrial production applications than the wild type, and has broad market prospects. Detailed Implementation

[0020] The method of the present invention will be further illustrated below with examples. Experimental methods in the following examples that do not specify specific conditions can generally be operated under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention through these examples. However, the protection and scope of the claims of the present invention are not limited to the specific examples provided, but should include the scope of protection that can be extended by those skilled in the art based on this specification without inventive effort.

[0021] Experimental materials and reagents: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, and vector pPIC9k were purchased from Invitrogen.

[0022] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutation kits from Beijing Bomais Biotechnology Co., Ltd.

[0023] Culture medium formulation: Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; LB+Amp medium: LB medium with 100 μg / mL ampicillin; LB+Kanamycin medium: LB medium supplemented with 50 μg / mL kanamycin; HMM medium: 12% maltose, 0.85% soybean meal, 0.5% ammonium sulfate, 0.125% sodium citrate, 0.35% magnesium sulfate, 0.35% potassium sulfate, 1.2% potassium dihydrogen phosphate, 0.37% dipotassium hydrogen phosphate, 0.02% calcium chloride.

[0024] The present invention will now be described in detail with reference to the embodiments.

[0025] Example 1: Screening of thermostable catalase mutants 1.1 Amplification of the catalase gene Using the amino acid sequence of catalase (named CATP) shown in SEQ ID NO:1 as a reference, the gene was artificially synthesized at Shanghai Jierui Biotechnology Co., Ltd., and its encoding nucleic acid sequence is SEQ ID NO:2.

[0026] PCR primers were designed based on the 5' end of the gene, containing a KpnI restriction enzyme site, and PCR primers were designed based on the 3' end, containing an XbaI restriction enzyme site. The primer sequences are as follows: CATP-F1: TCC GAATTC ATGCGCGGCCTCTACTCCCTGGG (The underlined part is the EcoR I restriction enzyme recognition site). CATP-R1: ATA GCGGCCGC TTACTCGTCGACGGCGAAGCG (The underlined part is the Not I restriction enzyme recognition site).

[0027] Using the synthesized catalase CATP gene SEQ ID NO:2 as a template, PCR amplification was performed using the above primers. The PCR amplification system consisted of: 1 μL template, 1 μL upstream primer CATP-F1, 1 μL downstream primer CATP-R1, 10 μL 5×PS Buffer, 4 μL dNTPs (2.5 mM), 1 μL Primer-Star DNA polymerase, and 32 μL ddH2O, with a total reaction volume of 50 μL. The PCR cycling program was as follows: 95℃ pre-denaturation for 5 min, 30 cycles: 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, and 72℃ for 10 min. The PCR products were recovered from the gel, digested with KpnI and XbaI, and then ligated with the pET-28a vector digested with the same enzymes overnight at 16℃. The ligation was then performed on E. coli DH5α, plated on LB+Amp plates, and incubated upside down at 37℃. After the transformants appeared, the colony PCR was used to verify the positive clones. After sequencing verification, the correct recombinant plasmid pET-CATP was finally obtained.

[0028] 1.2 Amplification and Screening of Catalase Mutant Genes To improve the heat resistance of the aforementioned catalase CATP, the applicant conducted extensive mutation screening of the enzyme using directed evolution technology. Using the CATP gene as a template, and with the aforementioned primers CATP-F1 and CATP-R1, PCR amplification was performed using the GeneMorph II random mutation PCR kit (Stratagene). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET-28a vector that had undergone the same digestion. The transformed cells were then transformed into E. coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well, and the cells were incubated at 37°C and 220 rpm for about 6 hours. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to obtain E. coli cell lysate containing catalase.

[0029] 10 μL of lysis buffer was taken into two new 96-well plates. One plate was treated at 80 °C for 3 min. Then, 40 μL of 30% hydrogen peroxide substrate was added to both 96-well plates and reacted at 30 °C for 10 min. The absorbance of hydrogen peroxide was read by a UV spectrophotometer, and the relative enzyme activity of the high-temperature treated enzyme solution compared with the untreated enzyme solution was calculated.

[0030] Experimental results showed that some mutations had no effect on the thermostability of catalase CATP, while others even worsened its thermostability or enzyme activity. Additionally, some mutations, although improving the temperature tolerance of catalase, significantly altered its enzymatic properties, which did not meet the requirements. Ultimately, the applicant identified mutation sites that could significantly improve the thermostability of catalase CATP without affecting its enzyme activity and original enzymatic properties: D47S and G641R.

[0031] The catalase mutant containing the D47S single-point mutation was named CATP1, and its amino acid sequence is SEQ ID NO: 3; the catalase mutant containing the G641R single-point mutation was named CATP2, and its amino acid sequence is SEQ ID NO: 4.

[0032] The two mutants were amplified by PCR using primers CATP-F2 and CATP-R2, with XbaI sites introduced at both ends of the primers. The PCR reaction conditions were: denaturation at 94℃ for 5 min; followed by denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 2 min, for 30 cycles, and then incubation at 72℃ for 10 min.

[0033] The primer sequences are as follows: CATP-F2: GCA GGTACC ATGCGCGGCCTCTACTCCCTGGG (The underlined part is the restriction endonuclease KpnI recognition site). CATP-R2:GGC TCTAGA TTACTCGTCGACGGCGAAGCG (The underlined part is the recognition site of the restriction endonuclease XbaI).

[0034] The gene fragment of wild-type catalase CATP was amplified using the same PCR method described above.

[0035] 1.3 Construction of engineered Aspergillus niger strains 1. Construction of expression carrier The catalase mutant gene obtained by cloning above was linked to the expression vector pSE through the Xba I site to construct a recombinant expression vector.

[0036] 2. Preparation of Aspergillus niger protoplasts: Inoculate Aspergillus niger host M-1 onto PDA+U plates and incubate at 30°C for 5-7 days. Cut 2cm × 2cm mycelial blocks and inoculate into 100ml of liquid PDA+U medium, incubating at 30°C for 24 hours to grow mycelium for transformation. Filter the grown mycelium, resuspend it in 20ml of 1.2M magnesium sulfate solution, and add 0.2g of lysozyme. Incubate at 30°C and 100rpm for 2-3 hours. Filter the lysed mycelium through two layers of lens paper and centrifuge at 3000rpm for 10 minutes to obtain protoplasts.

[0037] 3. Transformation by Aspergillus niger: The protoplasts were washed twice with 1.2M sorbitol solution, and then resuspended in an appropriate amount of sorbitol solution to achieve a protoplast concentration of 10. 8 Add 10 μL of the prepared recombinant expression vector to 200 μL of protoplasts, add 50 μL of 25% PEG6000, incubate on ice for 20 min, then add 2 mL of 25% PEG6000 and incubate at room temperature for 5 min. Add 4 mL of sorbitol solution and mix by inversion. Pour 50 mL of transformation medium into 4 transformation plates. After the upper layer of medium has solidified, incubate upside down in a 30°C incubator for 5 days.

[0038] 4. Screening of Aspergillus niger transformants: After 5 days of cultivation, the grown colonies were selected and inoculated onto the lower layer of transformation plates for secondary screening, and then incubated at 30℃ for 2 days. Normally growing transformants were then inoculated onto fresh PDA plates and incubated at 30℃ for 5-7 days. A 2cm × 2cm piece of bacteria was cut from each transformant and inoculated into 50ml of liquid shake flask culture medium for fermentation, incubated at 32℃ for 5 days, with a suitable amount of ammonia added daily to maintain the pH at approximately 4.5. After 5 days of cultivation, the supernatant obtained by centrifugation was the crude enzyme solution, and catalase activity was detected to screen for transformants expressing catalase.

[0039] The transformants expressing catalase single-point mutants CATP1 and CATP2 obtained through screening were named Aspergillus niger, respectively. Aspergillus niger CATP1) and Aspergillus niger CATP2 ( Aspergillus niger CATP2 was transferred to HMM medium and cultured at 30℃ and 220 rpm for 5 days with shaking. The bacterial cells were removed by centrifugation, yielding fermentation supernatants containing catalase mutants CATP1 and CATP2, respectively. These supernatants were then analyzed by SDS-PAGE electrophoresis. The results showed that the molecular weights of the catalase mutants CATP1 and CATP2 in the fermentation supernatant were approximately 80 kDa, consistent with the theoretical molecular weights.

[0040] The same method described above was used to construct a recombinant Aspergillus niger strain expressing wild-type catalase CATP, which was named Aspergillus niger CATP( Aspergillus niger The strain was cultured at 30℃ and 220 rpm with shaking for 5 days; the bacterial cells were removed by centrifugation to obtain a fermentation supernatant containing wild-type catalase CATP.

[0041] The results of enzyme activity assays in the fermentation supernatant showed that the enzyme activity of the fermentation supernatant of Aspergillus niger CATP, which recombinantly expressed wild-type catalase, was 28082 U / mL, while the enzyme activities of the fermentation supernatant of Aspergillus niger CATP1 and Aspergillus niger CATP2, which recombinantly expressed catalase mutants, reached 29386 U / mL and 30251 U / mL, respectively.

[0042] (1) Definition of catalase activity unit The amount of enzyme required to decompose 1 μmol of hydrogen peroxide per minute under conditions of 30℃ and pH 7.0 is defined as one enzyme activity unit (U).

[0043] (2) Enzyme activity assay procedure The substrate solution is prepared by diluting commercially available 30% hydrogen peroxide 400 times with a 0.2 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution.

[0044] Add 5.0 ml of substrate solution to a 100 ml Erlenmeyer flask and incubate at 30°C for 5 min. Add 1.0 ml of diluted enzyme solution and start timing immediately. Shake well and react for 5 min. Add 2.0 ml of sulfuric acid solution (30 ml of concentrated sulfuric acid diluted with water to 1000 ml) and shake well to stop the reaction. Add 1.0 ml of potassium iodide solution (100 g / L), 1 drop of ammonium molybdate solution (1%), and 2-3 drops of starch indicator (10 g / L). Titrate the free iodine with sodium thiosulfate solution (0.01 mol / L) and record the volume consumed in milliliters as V1.

[0045] To prepare a blank control, add 5.0 ml of substrate solution to a 100 ml Erlenmeyer flask and incubate at 30°C for 5 min. Add 2.0 ml of sulfuric acid solution (30 ml of concentrated sulfuric acid diluted with water to 1000 ml), and shake well for 5 min. Then add 1.0 ml of the diluted enzyme solution, 1.0 ml of potassium iodide solution (100 g / L), 1 drop of ammonium molybdate solution (1%), and 2-3 drops of starch indicator (10 g / L). Titrate the free iodine with sodium thiosulfate solution (0.01 mol / L), and record the volume consumed in milliliters as V2, which is approximately 22 ml.

[0046] (3) Enzyme activity calculation Catalase activity is calculated using the following formula: U=(V2-V1)×f×1000×N / 2 / 5.

[0047] U – Catalase activity, U / g or U / ml; V2 — Volume of sodium thiosulfate consumed in the blank, ml; V1 — Volume of sodium thiosulfate consumed by the sample, in ml; f—0.01 mol / L, the concentration of sodium thiosulfate solution; 1000 — Conversion factor, 1 mmol = 1000 μmol; N – Dilution factor; 2-2 mmol / L sodium thiosulfate is equivalent to 1 mmol of hydrogen peroxide; 5 — Reaction time, min.

[0048] Example 2: Determination of the enzymatic properties of a catalase thermostable mutant 1. Optimal pH Catalase activity was determined in the fermentation supernatants of Aspergillus niger CATP, Aspergillus niger CATP1, and Aspergillus niger CATP2 at 30°C using disodium hydrogen phosphate-citric acid buffer solutions with pH values ​​of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, and 12.0. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated.

[0049] The results showed that the optimal pH for wild-type catalase CATP and mutants CATP1 and CATP2 was 6.0, and the relative enzyme activity levels under different pH conditions were not significantly different.

[0050] 2. Optimal operating temperature The catalase activity of fermentation supernatants of Aspergillus niger CATP, Aspergillus niger CATP1, and Aspergillus niger CATP2 was determined at 20℃, 25℃, 30℃, 35℃, 40℃, 50℃, 60℃, 70℃, and 80℃, and pH 6.0. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated.

[0051] The results showed that the optimal temperature for wild-type catalase CATP was 30℃, while the optimal temperature for catalase mutants CATP1 and CATP2 was 35℃.

[0052] 3. Thermal stability analysis Fermentation supernatants of Aspergillus niger CATP, Aspergillus niger CATP1, and Aspergillus niger CATP2 were diluted with acetate-sodium acetate buffer at pH 6.0 and treated at 80℃ for 3 min and 10 min, respectively. The catalase activity was measured, and the enzyme activity of the untreated sample was taken as 100% to calculate the residual enzyme activity rate.

[0053] The results showed that the residual enzyme activity of wild-type catalase CATP was only 5.21% after treatment at 80℃ for 3 min, and dropped to 0 after treatment at 80℃ for 10 min. In contrast, the residual enzyme activity of the catalase mutant CATP1 remained as high as 52.16% and 22.61% after treatment at 80℃ for 3 min and 10 min, respectively; and the residual enzyme activity of the catalase mutant CATP2 remained as high as 53.87% and 23.82% after treatment at 80℃ for 3 min and 10 min, respectively. This demonstrates that the D47S and G641R mutation sites provided in this invention can significantly improve the heat resistance of catalase CATP.

[0054] Example 3: Screening for saturation mutations of catalase 1. Single-point saturation mutation screening To further improve the thermostability of catalase CATP, the thermostable mutant screening method described in Example 1 was used to screen for saturation site mutations at amino acids 47 and 641 of catalase CATP, and the obtained thermostable single-point mutants were subjected to thermostability experiments. The single-point mutants with significantly improved thermostability and their thermostability results are shown in Table 1.

[0055] Table 1. Heat resistance analysis of single-point mutants of catalase. Equipment CATP 5.21% 0 D47A 58.32% 28.82% D47F 49.82% 19.32% D47G 51.45% 21.54% D47K 60.36% 30.36% D47L 55.39% 25.93% D47P 48.35% 6.65% D47S 52.16％ 22.61％ D47V 63.28% 33.82% D47W 59.60% 29.63% G641A 48.56% 18.86% G641D 54.97% 24.91% G641E 69.73% 39.52% G641F 62.40% 32.46% G641M 58.87% 28.47% G641N 61.12% 31.62% G641P 49.55% 19.75% G641R 53.87％ 23.82％ G641S 55.49% 25.39% G641T 65.38% 35.18% G641V 64.26% 34.16% G641W 59.39% 29.09% G641Y 50.86% 20.06% As shown in Table 1, when the 47th amino acid of catalase CATP is mutated from D to A, F, G, K, L, P, S, V, or W, it exhibits better heat resistance than the wild type. When mutated to other amino acids, the heat resistance decreases or does not change significantly. When the 641st amino acid is mutated from G to A, D, E, F, M, N, P, R, S, T, V, W, or Y, it exhibits better heat resistance than the wild type. When mutated to other amino acids, the heat resistance decreases or does not change significantly.

[0056] The above-mentioned catalase single-point mutants still had an enzyme activity residual rate of 48.35%-69.73% after treatment at 80℃ for 3 min, and an enzyme activity residual rate of 6.65%-39.52% after treatment at 80℃ for 10 min, achieving unexpected technical results.

[0057] 2. Screening of combinations of heat-resistant mutation sites To further improve the thermostability of catalase CATP, the thermostable single-point mutants obtained from the above screening were combined and screened, and the thermostability of the two-point mutants obtained were tested separately.

[0058] The results showed that, compared with the wild type, the catalase two-point mutant with simultaneous substitution of amino acids at positions 47 and 641 provided by this invention exhibited further improved heat resistance. The two-point mutant showed a maximum enzyme activity residual rate of 84.38% after treatment at 80℃ for 3 minutes and a maximum enzyme activity residual rate of 57.32% after treatment at 80℃ for 10 minutes, significantly higher than the heat resistance of the corresponding single-point mutant, achieving unexpected technical results.

[0059] In summary, the catalase mutant obtained by screening in this invention has stronger heat resistance and is more suitable for widespread use in food, textile and other fields than the wild type, with broad market prospects.

Claims

1. A catalase mutant, characterized in that, The mutant is a substitution of any one of the following amino acids at position 641 of the catalase with the amino acid sequence SEQ ID NO:1: G641E, G641F, G641N, G641T, G641V.

2. A DNA molecule encoding the catalase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell contains the recombinant expression plasmid as described in claim 3.

5. The host cell as described in claim 4, characterized in that, The host cell is Pichia pastoris ( Pichia pastoris ).

6. The host cell as described in claim 4, characterized in that, The host cell is Aspergillus niger ( Aspergillus niger ).

7. The host cell as described in claim 4, characterized in that, The host cell is *Trichoderma reesei* ( Trichoderma reesei ).