A molecular marker associated with sheep body size traits and its application

Abstract

This invention provides a molecular marker associated with sheep body size traits and its application. Primers were designed based on the VAV1 gene sequence, and DNA was extracted from sheep blood. Through PCR amplification, DNA sequencing, and sequence analysis, a C / T polymorphism site was found at 150 bp of the amplified fragment. Further analysis using AQP... TM Primers were used to detect polymorphic loci in 947 Hu sheep, and a least-squares model was established. Association analysis between genotype and body size trait was performed, ultimately confirming that the VAV1 gene fragment amplified in this invention can serve as a molecular marker associated with sheep body size. This invention, by detecting the genotype of the molecular marker, guides the selection of sheep parents capable of breeding large-body-size sheep for mating, thereby breeding CT genotype sheep that can increase the body size of 180-day-old sheep, contributing to increased economic benefits.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a molecular marker related to sheep body size traits and its application. Background Technology

[0002] The Hu sheep is a unique white sheep species in my country, belonging to the coarse-wool sheep species that are used for both lambskin and meat, and occupies an important position in my country's sheep farming industry. It has been widely studied due to its advantages such as rapid growth and development and high reproduction rate. Sheep body size parameters are the main indicators for measuring sheep growth and development. Adult body size is closely related to body weight, which not only reflects the size and body structure of livestock, but also has a great influence on the production performance of livestock, and has a significant correlation with its meat production (He Xiaoyun et al. Correlation analysis between body size traits and slaughter performance of Luoping Huangshan goats. Anhui Agricultural Sciences. 2021. 49(19): 78-81). Therefore, it can be used as a basis for judging the genetic selection of meat sheep, reflecting the level of reproduction and selection of meat sheep and assessing its potential for production performance. In addition, livestock with excellent body shape have the characteristics of good production performance, high reproductive rate, low disease incidence and long life. Selecting superior breeds based on body shape can effectively shorten the breeding cycle (Niu Jinyu. Research on the method of measuring body size and predicting weight of dairy cows based on three-dimensional point cloud. [Master's thesis]. 2018. Shaanxi: Northwest A&F University).

[0003] VAV1The (vav guanine nucleotide exchange factor 1) gene is located on chromosome 5. The most well-known function of the Vav1 protein is as a GDP / GTP exchange factor (GEF) for the Rho / RacGTPase, which activates pathways leading to actin cytoskeleton rearrangement and transcriptional alterations. This function is strictly controlled by tyrosine phosphorylation (P. Crespo et al. Phosphotyrosine-dependent activation of Rac-1 GDP / GTP exchange by the vav proto-oncogene product, Nature 385 (6612) (1997) 169–172.). Vav1 is expressed exclusively in the hematopoietic system and has physiological activity in the hematopoietic system (S. Katzav et al. Vav, a novel human oncogene derived from alocus ubiquitously expressed in hematopoietic cells, EMBO J. 8 (8) (1989) 2283–2290.). The encoded protein is important in hematopoiesis and plays a role in the development and activation of T cells and B cells. Vav1 plays a crucial role in the development and function of many types of immune cells. It also plays a role in differentiation therapy using all-trans retinoic acid (ATRA), which induces tumor cells to complete neutrophil maturation, and has been successful in patients with promyelocytic leukemia (PML). In sheep, Vav1 is involved in myotube differentiation, myotube cell development, smooth muscle cell differentiation, and skeletal muscle cell differentiation. VAV1 It is unclear what traits of sheep genes are related to, or what their relationship is.

[0004] This invention, through the VAV1 The genes were sequenced and analyzed to explore the association between different genotypes and body size traits of sheep at 180 days of age. The aim was to provide genetic material for improving the growth performance of sheep and to accelerate the breeding process of new large-sized, high-quality meat sheep breeds with independent intellectual property rights. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker related to sheep body size traits and its application. This molecular marker is obtained by amplifying sheep... VAV1 The DNA sequence of the gene was obtained and sequenced. VAV1 By analyzing the correlation between different genotypes of the polymorphic locus and the body size of sheep at 180 days of age, a method for detecting molecular markers of the polymorphic locus can be established. This molecular marker can be applied to the breeding and raising of sheep with larger body sizes to enhance their growth performance.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: A molecular marker associated with sheep body size traits, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the Y at position 150 bp is C or T, and this mutation results in C / T polymorphism of the molecular marker.

[0007] The application of molecular markers as described above in sheep breeding is used to select sheep with larger body sizes. Sheep with the CT genotype at the polymorphic locus have a significantly larger body size than sheep with the CC genotype. During the breeding process, CC and TT genotype parents can be mated to breed CT genotype sheep for breeding, which helps to expand the breeding benefits.

[0008] The application of a primer pair for detecting the molecular markers associated with sheep body size traits in sheep breeding, preferably, the primer pair sequences for detecting the molecular markers associated with sheep body size traits are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] The application of an AQP primer pair for detecting the molecular markers associated with sheep body size traits in sheep breeding, preferably, the sequence of the AQP primer pair is shown in SEQ ID NO.4-6.

[0010] The application of a kit for detecting the above-mentioned molecular markers related to sheep body size traits in sheep breeding, preferably, the kit includes ordinary PCR primer pairs or AQP sequence pairs, the nucleotide sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequences of the AQP primer pairs are shown in SEQ ID NO.4-6.

[0011] A method for detecting the aforementioned molecular markers associated with sheep body size traits includes the following steps: 1) Amplify sheep genomic DNA using the above-mentioned ordinary PCR primer pairs, AQP primer pairs, or kits containing the above primer pairs; 2) The polymorphic sites of the amplification products obtained in step 1) are identified by typing.

[0012] In step 2), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0013] Furthermore, preferably, when using ordinary PCR primer pairs for amplification, the polymorphic sites of the amplification products are identified by direct sequencing.

[0014] Furthermore, preferably, when using AQP primer pairs for amplification, the fluorescence signal is detected and the genotyping results are viewed using a C1000 Touch Thermal Cycler instrument.

[0015] The above-described method is applied to the detection of sheep body size traits. By analyzing the types of polymorphic loci, the height of sheep body size can be determined, and sheep with tall body size can be screened out. When the genotype of the polymorphic locus is CT, its body size is significantly larger than that of the CC genotype.

[0016] The application of the molecular marker PCR primer pairs, AQP primers, or kits described above in sheep breeding involves amplifying and detecting the genomic DNA of sheep using the aforementioned primer pairs or kits to determine the genotype of the molecular markers in the sample to be tested. This allows for the selection of tall-sized sheep for breeding and can also be used to breed tall-sized sheep.

[0017] The beneficial effects of this invention are as follows: This invention provides molecular markers related to sheep body size traits and their C / T polymorphic sites. By detecting the genotype of these polymorphic sites, it is possible to effectively identify whether the parent sheep is capable of breeding sheep with larger body size, and whether the sheep is of larger body size, thus providing an effective detection method for screening fast-growing sheep.

[0018] This invention selects CC and TT parents by detecting molecular markers and the genotype of the polymorphic site, thereby breeding sheep with the CT genotype. It can also be used to select sheep with the CT gene as high-efficiency sheep for breeding, thereby improving the body size of sheep and helping to improve the economic benefits of sheep farming. Attached Figure Description

[0019] Figure 1 The sheep in Example 1 VAV1 Gel electrophoresis image of gene amplification.

[0020] Figure 2 The sheep in Example 1 VAV1 Gene g. 487C>T Sequencing results of the mutation site.

[0021] Figure 3 For the sheep in Example 2 VAV1 AQP genotyping results of the gene. Detailed Implementation

[0022] This invention analyzes the Hu sheep VAV1 The relationship between single nucleotide polymorphisms (SNPs) of genes and body size traits. In addition, [further research was conducted]. VAV1 The expression levels of genes in sheep with different genotypes. This invention can provide valuable molecular markers for sheep breeding.

[0023] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0024] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0025] Example 1 VAV1 Gene amplification sheep VAV1 Using the genetic DNA (GenBank accession number: NC_056078.1) as a template, a pair of primers, R-F and R-R, were designed using Oligo 7.0 software. The primer sequences are as follows: R -F is SEQ ID NO.2: 5'- CCTTCACAAGCACCTGAAGT- 3' R -R is SEQ ID NO.3: 5'- GCACAGAGTCGGACACT- 3' (2) VAV1 Gene amplification and sequencing Genomic DNA was extracted from sheep blood using a DNA extraction kit and used as a DNA template. The total volume of the PCR reaction was 35 μL, including: 17.5 μL of 2×PCR Master Mix, 1.1 μL of 10 μmol / L upstream primer RF, 1.1 μL of 10 μmol / L downstream primer RR, 1.3 μL of DNA template, and 14 μL of ddH2O.

[0026] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 57.6℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, and finally 72℃ extension for 10 min.

[0027] The PCR amplification products were detected by 1% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M: molecular weight 3000 marker, lanes 1-10: VAV1 Gene amplification results. The amplified PCR fragment was sequenced, and the sequencing results were viewed using Chromas software. The nucleotide sequence of this amplified fragment is shown in SEQ ID NO.1, totaling 455 bp. A polymorphic site exists within this fragment, specifically at position 150 bp where the Y is either C or T, indicating that the amplified gene... TNNT1The gene fragment (SEQ ID NO.1) exhibits a C / T polymorphism at the 150bp site (see [link]). Figure 2 ).

[0028] Among them, SEQ ID NO.1: CCTTCACAAGCACCTGAAGTGCTCAGCTCACAAGGGGAAACAGCCAGGAAAGAAGAAAATTACTTAATGCTGATGGCAAATTCTGCAGCATCCTTCACCCTCTGCCGCACCAAGAACGTCCCATCCGAGCGGTTGGTAAGAATGCTTTCYGCCCCGGCTCGCTCCATGGGGCCAGCGTACCTGTCAAAACATACCAAGAAGAGAGGTTCACATAACTCTGATAGGTAA ACCTGGGGGAGGCAGTGGCCATTAGACACCTTAAGTCACACCCAAGCTTTCACAATTGGATTGCAGGAGACAACACAAGCCTTTGTGTGTAGCTATGTCTCAGTGCGATACAGGAAGAAATATATTTGCTCTCTATGCTCTCCACCCTTTCCTAGCATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTAAGTCGCTTCAGTAGTGTCCGACTCTGTGC.

[0029] DNA sequence homology retrieval and identification: The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained was similar to that of sheep... VAV1 The partial sequence homology of the gene DNA (GenBank accession number: NC_056078.1) reached 99%.

[0030] Example 2: Establishment of a Genotyping Detection Method 1. Primer sequence design AQP primer pairs were designed targeting the C / T polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism site. The nucleotide sequences of the optimized AQP primer pairs include: The forward primer A1 used to detect AlleleC is shown in SEQ ID NO.4, wherein: SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTCGGTTGGTAAGAATGCTTTCC; The forward primer A2 used to detect AlleleT is shown in SEQ ID NO.5, where: SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTGCGGTTGGTAAGAATGCTTTCT; The universal reverse primer C is shown in SEQ ID NO.6, wherein: SEQ ID NO. 6: GTATGTTTTGACAGGTACGCTGGC.

[0031] The primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the above AQP primers was diluted to 100 μmol / L.

[0032] 2. Extracted genomic DNA and subjected to quality control. Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then subjected to quality testing using 1% agarose gel electrophoresis and Nanodrop 2100. The extracted DNA must meet the following requirements: (1) Agarose gel electrophoresis shows a single DNA band without significant dispersion; (2) Nanodrop 2100 analysis shows A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. DNA that does not meet these requirements needs to be re-extracted until it meets the requirements; and the AQP of Beijing Jiacheng Biotechnology Co., Ltd. must be followed. TM The detection technology and genome size calculations determined the DNA usage to be 2-50 ng / sample. The extracted genomic DNA was then diluted to a concentration of 2-50 ng / μL to serve as a DNA template.

[0033] 3. Perform genotyping First, mix each primer (100 μmol / L) of the AQP primer pair with sterile water in a volume ratio of primer A1:primer A2:primer C:stere water of 12:12:30:46 to prepare a primer mixture. Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2× Probe Mix, and 2 μL of diluted DNA template (2~50 ng / μL) to each well of a 384-well plate. After adding the primer mixture, seal the plate, centrifuge with shaking, and place it on a C1000 Touch™ Thermal Cycler instrument for PCR amplification. The specific procedure is as follows: Pre-denaturation at 95℃ for 10 minutes; 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle; 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0034] After amplification, fluorescence signals were detected and genotyping was performed using a C1000 Touch™ Thermal Cycler instrument at 37°C. Some results are shown below. Figure 3 As shown in the figure. FAM is the horizontal axis and HEX is the vertical axis. Each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "CC"; the green triangle near the middle indicates that the locus is heterozygous genotype "CT"; and the orange dot near the right indicates that the locus is homozygous genotype "TT".

[0035] 4. Application of the molecular markers of this invention in sheep body size correlation analysis The experiment examined the polymorphism of 947 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and body size traits.

[0036] Y ijk =μ+ G i + P j + S k +F l + ε ijkl Among them, Y ijk Let G be the observed body size, μ be the population mean, and G be the population size. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, F l For the field effect, ε ijkl Assuming random error, let ε ijkl They are mutually independent and obey N(0, σ).2 )distributed.

[0037] Genotyping results showed that among 947 individuals, there were 181 individuals with the CC genotype, 504 individuals with the CT genotype, and 262 individuals with the TT genotype. The results of the association analysis between genotype and body size traits are shown in Table 1. The data in Table 1 are the average body height and body length of Hu sheep measured at 180 days of age.

[0038] Table 1 Sheep VAV1 Association analysis between gene polymorphism and body size traits at 180 days of age

[0039] Note: Different lowercase letters in the same row indicate significant differences (P<0.05), while the same letter indicates no significant differences (P>0.05).

[0040] The results showed that the mutation site at position 150 bp shown in SEQ ID NO.1 was significantly associated with sheep body size. This indicates that sheep carrying the CT genotype had significantly larger body sizes than sheep carrying the CC genotype (P<0.05), and compared to sheep with the TT genotype, sheep with the CC genotype tended to have smaller body sizes. Therefore, the CT genotype is the dominant genotype. The C>T mutation site at position 150 of the VAV1 gene, as shown in SEQ ID NO.1, can serve as a potential molecular marker affecting sheep body size (P<0.05). By selecting CC and TT genotype parents for mating during breeding to produce CT genotype sheep for raising, the body size of sheep at 180 days of age can be increased, resulting in a dominant flock with larger body sizes.

Claims

1. The application of a reagent for detecting molecular markers related to body size traits in Hu sheep in assisted breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 150bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker; the breeding is to screen for Hu sheep with larger body size, and when the genotype of the polymorphic site is CT, the Hu sheep have a significantly larger body size than the Hu sheep with the CC genotype.

2. The application of a primer for detecting molecular markers related to body size traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 150 bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker; sheep carrying the CT genotype have a significantly larger body size than sheep carrying the CC genotype, and compared with sheep carrying the TT genotype, sheep with the CC genotype tend to have a smaller body size; the breeding is to select Hu sheep with larger body size, and the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. The application of an AQP primer pair for detecting molecular markers related to body size traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 150bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker; sheep carrying the CT genotype have a significantly larger body size than sheep carrying the CC genotype, and compared with sheep carrying the TT genotype, sheep with the CC genotype tend to have a smaller body size; the breeding is to select Hu sheep with larger body size, and the nucleotide sequence of the AQP primer pair is shown in SEQ ID NO.4-6.

4. The application of a kit for detecting molecular markers related to body size traits in Hu sheep in assisted breeding of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at position 150 bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the CT genotype have significantly larger body sizes than sheep carrying the CC genotype, and compared with sheep carrying the TT genotype, sheep with the CC genotype tend to have smaller body sizes. The breeding is to screen for larger-sized Hu sheep. The kit includes ordinary PCR primer pairs or AQP sequence pairs. The nucleotide sequences of the ordinary PCR primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequences of the AQP primers are shown in SEQ ID NO.4-6.

5. The application of a method for detecting molecular markers associated with body size traits in Hu sheep in the screening of Hu sheep for large body size traits, characterized in that, It includes the following steps: 1) Using the ordinary PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, the AQP primer pairs with sequences as shown in SEQ ID NO.4-6, or a kit containing the above ordinary PCR primer pairs or AQP primer pairs, amplify the C or T sequence at position 150 bp in the genomic DNA of the Hu sheep as shown in SEQ ID NO.1; 2) Genotyping the amplification product obtained in step 1) at the polymorphic site at 150 bp as shown in SEQ ID NO.1; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 150bp is C or T, and this mutation leads to C / T polymorphism of the molecular marker; sheep carrying the CT genotype have a significantly larger body size than sheep carrying the CC genotype, and compared with sheep carrying the TT genotype, sheep with the CC genotype tend to have a smaller body size.

6. The application as described in claim 5, characterized in that, When amplification was performed using the ordinary PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, the polymorphic sites of the amplification products were identified by direct sequencing.

7. The application as described in claim 5, characterized in that, When amplification was performed using AQP primer pairs with sequences as shown in SEQ ID NO.4-6, the fluorescence signal was detected and the genotyping results were viewed using a C1000 TouchThermal Cycler instrument.

8. The application as described in claim 5, characterized in that, Select Hu sheep parents with CC and TT genotypes for mating, and then breed Hu sheep with larger body size and CT genotype for breeding.

Images