Specific marker, primer, detection method, kit and application of insertion variation in the intron region of septin7 gene of rockfish

Abstract

The present invention relates to molecular biology technology, and more specifically to a specific marker, primer, detection method, kit and application of insertion variation in the intron region of the septin7 gene of striped rock sea bream. The specific marker of insertion variation in the intron region of the septin7 gene of striped rock sea bream is a DNA fragment of non-insertion and insertion specific markers in the intron region of the septin7 gene of striped rock sea bream, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1 and SEQ ID NO:2. The present invention significantly shortens the time for identification of intron insertion in the septin7 gene and improves the detection efficiency. The technology has important application value in the identification of male and female sex of striped rock sea bream, the preparation of male and female seedlings, and the study of the integrity and functional heterogeneity of the cytoskeleton of male and female cells.

Description

Technical Field

[0001] The present invention relates to molecular biology technology, and more particularly to a specific marker, primer, detection method, kit and application of insertion variation in the intron region of septin7 gene of rockfish. Background Art

[0002] Striped rock snapper Oplegnathus fasciatus ) belongs to the order Perciformes, family Oplegnathidae and genus Oplegnathus. Oplegnathus ), mainly distributed in the warm and tropical waters of the western Pacific Ocean, especially in rocky and coral reef environments. In 2004, China successfully broke through the reproductive regulation and artificial breeding technology of striped rock bream, making it an important object for marine cage and factory farming, marking an important progress in the farming technology of this fish. At present, the market price of striped rock bream has climbed to 200 yuan per catty, showing its significant economic value and farming potential. As a natural species native to my country, the resource development and sustainable utilization of striped rock bream are of far-reaching significance and have broad prospects for farming. Striped rock bream has a typical X1X1X2X2 / X1X2Y sex determination type, in which male fish have one less chromosome than female fish, but have an anomalous chromosome Y, and the male sex type is X1X2Y. During the breeding process, the fish of the family of bream show significant male and female growth dimorphism, and the growth rate of male fish is usually faster than that of female fish. This characteristic provides a good direction for genetic breeding research. Therefore, the development of the preparation technology of Kaohsiung seedlings and all-male seedlings will provide strong support for the improvement of quality and efficiency of the striped sea bream breeding industry. In addition, the development of rapid genetic sex identification technology for striped sea bream seedlings will not only help to efficiently reserve high-quality male germplasm, but also improve the scientificity and pertinence of breeding decisions, thereby promoting the sustainable development of the striped sea bream industry and improving its market competitiveness.

[0003] The septin7 gene is a member of the septin family of GTP-binding proteins that play a crucial role in a variety of cellular processes, including cell division, cytoskeletal organization, and membrane dynamics. As part of a large class of septin proteins that are conserved among eukaryotic species, septin7 is associated with the formation of filamentous structures that contribute to the integrity and functionality of the cytoskeleton. Septin proteins are able to oligomerize into heteromeric complexes and thus can serve as scaffolding proteins to facilitate interactions between different cellular components. Recent studies have highlighted the importance of septin7 in several pathological conditions. For example, its dysfunction has been associated with neurodegenerative diseases such as Alzheimer's disease and certain types of cancer. Abnormal expression or mutation of septin7 can disrupt normal cellular functions, leading to blocked cell division and increased tumorigenesis. In addition, studies have shown that septin7 may affect signaling pathways that are critical for cell survival and proliferation, highlighting its potential as a therapeutic target. There are no reports on the detection of intron insertions in the septin7 gene on male chromosomes of striped sea bream and its application in genetic sex identification of females and males. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the existing detection technology of DNA insertion variation in the intron region of the septin7 gene of striped rock sea bream, and to provide a specific marker, primer, detection method, kit and application in the genetic sex identification of male and female of the septin7 gene of striped rock sea bream for insertion variation in the intron region.

[0005] To achieve the above purpose, the present invention adopts the following technical solution:

[0006] A specific marker for insertion variation in the intron region of a gene of striped porgy. The specific marker for insertion variation in the intron region of the septin7 gene of striped porgy is a DNA fragment of a non-insertion and insertion specific marker in the intron region of the septin7 gene of striped porgy. The nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] The non-insertion and insertion specific marker nucleotide sequences of the septin7 gene intron region DNA fragment of the striped rock bream are shown in SEQ ID NO:1, and the bases are X 1 The chromosomes share a homologous fragment in the intron region of the septin7 gene that has not undergone DNA insertion variation, which is a DNA characteristic marker shared by individuals with non-insertion and insertion bases in the intron region of the septin7 gene of the striped sea bream; and the deleted fragment (3bp) between the 277th and 281st sites of the base sequence shown in SEQ ID NO:1 and the inserted sequence fragment (674bp) between the 350th and 351st sites are the base sequence shown in SEQ ID NO:2.

[0008] An application of a specific marker for insertion variation in an intron region of a gene of a striped rock sea bream, and an application of the specific marker in identifying the genetic sex of male and female striped rock sea bream.

[0009] A method for identifying the genetic sex of male and female mullet using the specific marker of insertion mutation in the intron region of the mullet gene,

[0010] 1) PCR amplification: Take the striped porgy to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the septin7 gene of the striped porgy to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker;

[0011] 2) Result judgment: two DNA fragments of 374 bp and 1045 bp are amplified from the genomic DNA of the tested striped rock bream, which means that the tested striped rock bream is judged to be an individual with a DNA fragment insertion mutation in the intron region of the septin7 gene; 374 bp is the base shown in SEQ ID NO: 1, and 1045 bp is the base shown in SEQ ID NO: 2;

[0012] 3) Only a single DNA fragment of 374 bp was amplified from the genomic DNA of the tested striped rock seabream, which means that the tested striped rock seabream is an individual with no DNA fragment insertion mutation in the intron region of the striped rock seabream septin7 gene; 374 bp is the base shown in SEQ ID NO: 1.

[0013] The specific primers in step 1) are:

[0014] Ch septin7 _F:1:5'-GGACCGGGGCAAGGGACCCACAC-3';

[0015] Ch septin7 _R:2: 5'-CTAACATCTGAGTGCAGGAGGCT-3';

[0016] In step 2), the individual of the tested rock snapper is a male fish X 1 X 2 Y;

[0017] In step 3), the individual of the tested rock bream is a female X 1 X 1 X 2 X 2 .

[0018] A primer for detecting the specific marker for detecting insertion variation in the intron region of the gene of the striped sea bream:

[0019] Chseptin7 _F:1:5'-GGACCGGGGCAAGGGACCCACAC-3';

[0020] Ch septin7 _R:2:5'-CTAACATCTGAGTGCAGGGAGCT-3'.

[0021] An application of the primers for detecting insertion variation of intron regions of striped sea bream genes, and the application of the primers in detecting the genetic sex of male and female striped sea breams.

[0022] A kit for identifying the genetic sex of male and female rock porgy, the kit containing the primers.

[0023] The advantages of the present invention are:

[0024] The present invention compares the septin7 gene on the fusion chromosome Y of the male striped rock sea bream with the septin7 gene intron located on the homologous chromosome X of the female fish to produce a large sequence insertion, thereby efficiently, quickly and accurately identifying whether the septin7 gene intron of the striped rock sea bream has a DNA insertion variation. This has important significance and application value for revealing the functional heterogeneity of various cellular processes such as female and male cell division, cytoskeleton organization and membrane dynamics of the striped rock sea bream, realizing the rapid identification of female and male genetic sex, and improving the genetic breeding process of the striped rock sea bream and the large-scale production of high-quality seedlings.

[0025] The present invention screens and obtains homologous segments of the septin7 gene introns of the X and Y chromosomes of the striped rock porgy from the whole genome sequence of the striped rock porgy and has a large DNA insertion marker sequence, and further establishes a rapid detection method for DNA insertion variation of the septin7 gene intron of the striped rock porgy. The method can be used to quickly, accurately and efficiently identify whether DNA insertion occurs in the septin7 gene intron of the striped rock porgy to be detected. The method uses a pair of primers to amplify two bands of 374bp and 1045bp with a difference of 671bp in the septin7 gene intron DNA insertion individuals, and only amplifies a single band of 1045bp in the septin7 gene intron DNA insertion individuals, and can be distinguished by agarose gel electrophoresis, shortening the time for accurate identification of the septin7 gene intron variation of the striped rock porgy and improving the detection efficiency. It has important significance and application value in the study of female and male cell division and cytoskeleton based on the septin7 gene of the striped rock porgy, the identification of male and female sex, the preparation of high male seedlings and the selection of families. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1A nucleotide sequence comparison diagram of the septin7 gene of the X chromosome and the septin7 gene of the Y chromosome provided in an embodiment of the present invention; the modules connected by connecting lines in the figure represent highly homologous regions of the septin7 gene on chromosomes X and Y, wherein the marked region is the target sequence ChrX1 of the present invention septin7 and ChrY septin7 The location.

[0027] Figure 2 ChrX1 provided in the embodiment of the present invention septin7 and ChrY septin7 Specific location information on chromosomes X and Y; 374bp represents ChrX1 septin7 The length of the fragment, 1045 bp represents ChrY septin7 Length; ChrY septin7 The middle lower region represents the inserted 671 bp nucleotide sequence, which is closely related to ChrX1 septin7 The fragment has no homologous matching sequence.

[0028] Figure 3 The obtained X chromosome ChrX1 provided in the embodiment of the present invention septin7 ChrY septin7 Nucleotide sequence alignment, the positions of the primers at both ends are indicated by black thick underlines; *: represents ChrX1 septin7 and ChrY septin7 Sequence consistency, the blank area indicates the base sequences are inconsistent between the two; _ _ _ _: represents the inserted sequence; the black underline represents the area where the inserted sequence is located.

[0029] Figure 4 The X chromosome ChrX1 provided in the embodiment of the present invention septin7 ChrY septin7 Schematic diagram of nucleotide sequence homologous insertion difference DNA fragments; the black area represents the homologous region, the gray area represents the insertion region and site information, and the blank area represents the deletion region and site information.

[0030] Figure 5 The figure shows the results of 1.5% agarose gel electrophoresis of PCR products of male and female individuals of striped sea bream provided in an embodiment of the present invention, M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish; the individual showing two bands (374bp and 1045bp) in the figure is an individual with DNA insertion in the intron of the septin7 gene, which is also a genetic male fish, and the physiological sex histological identification is male fish, and the individual showing a single band (374bp) is an individual with no DNA insertion in the intron of the septin7 gene, which is also a genetic female, and the physiological sex histological identification is female. DETAILED DESCRIPTION

[0031] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0032] The present invention firstly completed the whole genome sequencing and assembly of female and male striped rock bream by using the third-generation PacBio whole genome sequencing technology, and obtained high-quality genomes at the chromosome level of female and male striped rock bream (SRP160016, SRP220007, Xiao et al., 2019, 2020). By comparative genomic bioinformatics analysis methods, it was found that compared with the female fish X 1 In the intron region of the septin7 gene on the chromosome, a large DNA sequence insertion mutation occurred in the intron region of the homologous septin7 gene on the Y chromosome of male striped sea bream ( Figure 1 ). Select female fish X 1 The 5000bp~5400bp region of the intron region of the septin7 gene on the chromosome and the 5000bp~6100bp region of the Y chromosome of male fish with homology and DNA sequence insertion are the research target regions ( Figure 1 ). 1 The length of the DNA fragment on the chromosome is 374bp and is named ChrX1 septin7 , whose sequence is X septin7 ID No: 1; the length of the DNA fragment on the Y chromosome is 1045bp, including 1 The homologous sequence in the intron region of the septin7 gene on the chromosome was named ChrY septin7 , whose sequence is Y septin7 ID No:1;ChrY septin7 ChrX1 septin7 Homologous sequence alignment revealed that septin7r A 3bp DNA fragment was missing between the corresponding 277th and 281st sites, and a 674bp DNA fragment was inserted between the 350th and 351st sites ( Figure 2 and Figure 3 ), the male fish Y chromosome septin7 gene intron region in the 5000bp ~ 6100bp region compared to the female fish X1 chromosome septin7 gene intron region homologous region inserted 671bp DNA sequence, this fragment is the DNA marker for detecting whether the striped rock bream septin7 gene intron region has a DNA fragment insertion mutation; at the same time, because the marker is located on the male fish Y chromosome, with male-associated genetic characteristics, this fragment is also a DNA marker unique to the male fish Y chromosome, and ChrY septin7It is a DNA characteristic marker shared by male and female striped sea bream.

[0033] The invention is based on the characteristic marker of long DNA insertion sequence found at the position of 5000bp-6100bp in the intron region of septin7 gene of Y chromosome of male striped porgy to determine whether DNA fragment insertion variation occurs in the intron region of septin7 gene of striped porgy, and invents a rapid detection method of DNA insertion variation in the intron region of septin7 gene of striped porgy, and applies the method to the rapid identification of genetic sex of female and male striped porgy; the specific detection method is to determine whether the striped porgy to be detected has Y septin7 ID No: 1 nucleotide fragment (1045bp); rapid identification by PCR primers; the invention is based on the sequence of the intron region of the septin7 gene on the Y chromosome of the striped rockfish and the X 1 and X 2 Comparative analysis of homologous gene sequences on chromosomes revealed 1 Septin7 gene intron region on chromosome X septin7 ID No:1 Nucleotide sequence homologous to Y chromosome septin7 ID No: 1 nucleotide sequence, using the feature that a large fragment is inserted in the Y chromosome of striped bream in the homologous region of the septin7 gene intron region, two primers were designed. The method of detecting PCR products by 1.5% agarose gel electrophoresis was used to quickly determine whether a DNA fragment insertion mutation occurred in the intron region of the striped bream septin7 gene; at the same time, the marker was located on the Y chromosome of male fish and had male-associated genetic characteristics, which was used for the accurate identification of the genetic sex of striped bream. The upstream and downstream primer sequences were:

[0034] Ch septin7 _F:1 : 5'- GGACCGGGGCAAGGGACCCACAC-3' (X septin7 ID No:2)(SEQ ID NO:3)

[0035] Ch septin7 _R:2: 5'-CTAACATCTGAGTGCAGGGAGGGCT-3' (X septin7 ID No:3) (SEQ ID NO:4).

[0036] The steps of using the above primers to identify the insertion variation of DNA fragments in the intron region of the septin7 gene of striped bream mainly include: extracting high-quality whole genome DNA of striped bream, amplifying the specific marker DNA fragment of the insertion variation of DNA in the intron region of the septin7 gene of the Y chromosome, and detecting the PCR product DNA by agarose gel electrophoresis; 1 X2 Y) Y chromosome and X 1 Two DNA fragments of 1045 bp and 374 bp were amplified from the chromosomes. The 1045 bp fragment was a unique marker fragment in the intron region of the septin7 gene where DNA insertion mutation occurred. 1 X 1 X 2 X 2 ) individuals, only a single DNA fragment of 374 bp was amplified.

[0037] The present invention is based on the whole genome sequencing of male and female striped rock seabream, the positioning of the intron region of the septin7 gene of female and male individuals, and the DNA sequence comparison analysis. It can be seen that a long DNA fragment insertion mutation has occurred in the intron region of the septin7 gene on the Y chromosome of male striped rock seabream. Then, the intron region of the septin7 gene on the Y chromosome of the male striped rock seabream is used as a DNA marker specific for the base insertion mutation in the intron region of the septin7 gene on the Y chromosome of the striped rock seabream, and the insertion mutation of the DNA sequence in the intron region of the septin7 gene of the striped rock seabream is used to quickly identify the male and female striped rock seabream. The method can quickly, accurately and efficiently distinguish whether the tested striped rock seabream has a sequence insertion mutation in the intron region of the septin7 gene. This method will amplify two bands of 1045bp and 374bp in individuals with DNA insertion in the intron region of the septin7 gene, of which the 1045bp band is a specific target band, while only a single band (374bp) is amplified in individuals with no DNA insertion in the intron region of the septin7 gene. The above target band can be quickly and accurately distinguished by agarose gel electrophoresis, so as to achieve rapid identification of whether DNA sequence insertion occurs in the intron region of the septin7 gene of the striped rock bream. At the same time, since the specific target band (1045bp) is located on the Y chromosome of male fish and has male-associated genetic characteristics, this fragment is also a DNA marker unique to the Y chromosome of male striped rock bream, which can be used for rapid identification of the genetic sex of female and male striped rock bream.

[0038] Example 1 Screening and verification of DNA markers specific to sequence variation in the intron region of the septin7 gene of rock bream

[0039] The discovery of homologous segments in the intron region of the septin7 gene on the Y and X chromosomes of the striped bream and containing a large fragment of the target DNA sequence: the DNA sequence of the male fish heterochromatin (neo-Y) and the female fish X 1The chromosome DNA sequence comes from Li Jun's research team at the Marine Fish Aquaculture and Breeding Technology Laboratory of the Institute of Oceanology, Chinese Academy of Sciences. The team commissioned Wuhan Fraser Gene Information Co., Ltd. to use the third-generation PacBio whole genome sequencing technology to complete the sequencing and assembly of the male and female whole genomes of striped sea bream. The assembly results have been published (SRP160016, SRP220007, Xiao et al., 2019, 2020). Comparative genomic bioinformatics analysis of the male and female genome sequences of striped sea bream can be seen (see Figure 1 ), the intron region of the septin7 gene on the heteromorphic chromosome Y of male striped bream and the intron region of the septin7 gene on the heteromorphic chromosome X of female striped bream 1 The intron region of the septin7 gene of the chromosome is homologous, and there is a large DNA insertion fragment, among which X 1 The target DNA fragment in the intron region of the septin7 gene on the chromosome is 374 bp in length and is named ChrX1 septin7 , whose sequence is SEQ ID NO:1:

[0040] GGACCGGGGCAAGGGACCCACACAATCGATGATCAAGTGTTCAAAAGGCTGTCCAATTGCAGGGATTGGATGCAAGGGAGCAGGTTTAACAACTTGATTAGGCTTGCCAGTGATCTGACAGGTATGGCATGTTTTGATGAAGAGAGCGACGTTGCATGGCCAGAAGAAATATTGCAGTATACGATGG TAGGTTTTATGGATGCCAAGATGACCTGCCACATCACCATGTGACGTCTGGAGTACTTTACTGCGACAGTTGGTAGGAACAACAACTTTAAAAATTGGCTCTCCTACAAACTGTTCACCATGGGGCATTCACTTTCTAACCAGGTTACTGGTTAGAAAGTGAAAGCCTCCCTGCACTCAGATGTTAG.

[0041] The target DNA fragment homologous to the intron region of the septin7 gene on the male fish heteromorphic chromosome Y is 1045 bp long, which contains the 1 Homologous sequence, named ChrY septin7 , whose sequence is SEQ ID NO:2:

[0042]

[0043] The whole genome scanning of male and female individuals and the location of the intron region of the septin7 gene in female and male individuals and DNA sequence comparison analysis showed that the septin7 gene in the X 1 ChrX1, an intronic fragment of the septin7 gene septin7 Homologous ChrY septin7 (Y chromosome) There are two DNA sequence deletions and insertions, corresponding to ChrX1 septin7 Between the 277th and 281st positions (3bp deletion), and between the 350th and 351st positions (674bp insertion) ( Figure 2 and Figure 3 ). The target region is the intronic region of the septin7 gene on chromosome Y (ChrY septin7 ) DNA sequence ratio with X 1 Chromosomal homologous DNA region (ChrX1 septin7 ) inserted a 671bp DNA sequence, which is a DNA marker specific to the base insertion mutation in the intron region of the septin7 gene of the striped rock bream. Its presence or absence can be used to identify whether a DNA sequence insertion mutation has occurred in the intron region of the septin7 gene of the striped rock bream. At the same time, since this marker is located on the Y chromosome of male fish and has male-associated genetic characteristics, ChrY septin7 This fragment is also a DNA marker unique to the Y chromosome of male striped sea bream, and ChrX1 septin7 It is the common DNA characteristic marker of the genetic sex of male and female striped bream, such as Figure 1 and Figure 2 shown.

[0044] Sequence verification of DNA markers specific to sequence variation in the intron region of the septin7 gene: Based on the nucleotide sequence of SEQ ID NO:2 in the intron region of the Y chromosome septin7 gene and the X chromosome 1 Based on the nucleotide sequence characteristics of the homologous gene SEQ ID NO:1 on the chromosome, two primers were designed ( Figure 3 ). Female and male striped bream of known physiological sex were selected and high-quality DNA was extracted from them. septin7 _F:1,Ch septin7 _R:2 two primers for PCR amplification, the reaction conditions and procedures are as follows: PCR reaction system 20μL: 10×Buffer 5.8μL, dNTP 4.0μL, rTaq enzyme (5U / μL) 0.2μL, upstream and downstream primers (Ch septin7 _F:1 and Ch septin7 _R:2) 0.4µL each, DNA template 2.0µL, ddH 2O 7.2µL. Touch down PCR amplification program: 94℃3mins, 59.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 57.5℃ 1min, 72℃ 1min30s, 30 cycles; 72℃ 10min, stored at 15℃. 1.5% agarose gel electrophoresis of PCR products can distinguish the differences between the DNA fragments inserted and non-inserted into the intron region of the septin7 gene. The difference fragment products of the inserted and non-inserted DNA sequences in the intron region of the septin7 gene were recovered by gel cutting and transformed into competent cells through the PMD18-T vector, and the positive clones were picked and sent to Qingdao Paisonno Gene Biotechnology Co., Ltd. for sequencing. The sequencing results verified that the intron region of the homologous septin7 gene of the X and Y chromosomes of the striped sea bream contained a large fragment inserted into the target DNA sequence fragment, such as Figure 3 and Figure 4 shown.

[0045] Example 2 Establishment and application of DNA fragment insertion mutation identification technology in the intron region of the septin7 gene of rock bream

[0046] Genetic identification was conducted on the striped sea bream (of which 12 were female and 12 were male) farmed by Haihe Aquatic Breeding Co., Ltd. in Wendeng District, Weihai City, Shandong Province.

[0047] High-quality DNA extraction: The fin ray DNA of rockfish was extracted using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured by a UV spectrophotometer. The DNA concentration was adjusted to 60 ng / µL and stored at -20°C for later use.

[0048] PCR reaction system and PCR amplification identification: using DNA fragment primers Ch specific for large fragment sequence variation in the intron region of the septin7 gene of striped bream septin7 _F:1 and Ch septin7 _R:2 Detect whether the DNA fragment in the intron region of the septin7 gene of the striped rock bream has inserted or not by PCR. The PCR reaction system is 20µL: 10×Buffer 5.8µL, dNTP 4.0µL, rTaq enzyme (5U / µL) 0.2µL, upstream and downstream primers (Ch septin7 _F:1 and Ch septin7 _R:2) 0.4µL each, DNA template 2.0µL, ddH 2O7.2µL. Touch down PCR amplification program: 94℃ 3mins, 63℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 61℃ 1min, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. Add 2.0µL of 10× Loading Buffer to each PCR sample to be tested, use 1.5% agarose gel electrophoresis at a constant voltage of 110V for 30 minutes, gel imaging can clearly distinguish between DNA insertion and non-insertion mutation individuals in the intron region of the septin7 gene of striped rock bream (see Figure 5 ).

[0049] Depend on Figure 5 It can be seen that two target bands (1045 bp and 374 bp) were amplified in the individuals of striped porgy with DNA insertion in the intron region of the septin7 gene, of which the 1045 bp band was the specific target band ChrY septin7 However, in individuals without DNA fragment insertion into the intronic region of septin7 gene, only a single band type ChrX1 could be amplified. septin7 (374 bp). septin7 The marker is located on the Y chromosome of male fish and has male-linked genetic characteristics. Therefore, ChrY septin7 This fragment is also a DNA marker unique to the Y chromosome of male striped sea bream, and ChrX1 septin7 It is a DNA characteristic marker shared by male and female genetic sexes of striped rock seabream, and the selected striped rock seabream can be distinguished. The method of the present invention can not only quickly, accurately and efficiently identify whether a DNA fragment insertion mutation occurs in the intron region of the septin7 gene of the striped rock seabream to be tested, but also has important significance and application value in the study of the functional heterogeneity of various cellular processes such as female and male cell division, cytoskeleton organization and membrane dynamics based on the intron region of the septin7 gene of striped rock seabream, as well as in the identification of male and female sexes, the preparation of high male seedlings and family breeding.

Claims

1. A specific marker for insertion variation in the intron region of the septin7 gene of rockfish, characterized in that: The specific markers for insertion variation in the intron region of the septin7 gene of the striped rock sea bream are DNA fragments of non-insertion and insertion specific markers in the intron region of the septin7 gene of the striped rock sea bream, and the nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:

2.

2. The specific marker for insertion variation in the intron region of the septin7 gene of rockfish according to claim 1, characterized in that: The nucleotide sequence SEQ IDNO:1 of the non-insertion and insertion specific markers of the DNA fragment in the intron region of the septin7 gene of the striped rock sea bream is a homologous fragment in the X1 chromosome of female and male striped rock sea bream that has not undergone DNA insertion mutation in the intron region of the septin7 gene. It is a DNA characteristic marker shared by non-insertion and insertion individuals in the intron region of the septin7 gene of the striped rock sea bream.

3. An application of a specific marker for insertion mutation in the intron region of a gene of a rock bream according to claim 1, characterized in that: The specific marker is used to identify the genetic sex of male and female striped porgy.

4. A method for identifying the genetic sex of male and female octopus using the specific marker of insertion variation in the intron region of the septin7 gene of octopus according to claim 1, characterized in that: 1) PCR amplification: Take the striped porgy to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the septin7 gene of the striped porgy to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker described in claim 1; 2) Result judgment: two DNA fragments of 374 bp and 1045 bp were amplified from the genomic DNA of the striped bream to be tested, which means that the striped bream to be tested is an individual with a DNA fragment insertion mutation in the intron region of the septin7 gene, that is, a male striped bream X1X2Y; 374 bp is the base shown in SEQ ID NO: 1, and 1045 bp is the base shown in SEQ ID NO: 2; 3) Only a single DNA fragment of 374 bp was amplified from the genomic DNA of the striped rock seabream to be tested, which means that the striped rock seabream to be tested is an individual with no DNA fragment insertion mutation in the intron region of the striped rock seabream septin7 gene, that is, a female striped rock seabream X1X1X2X2; 374 bp is the base shown in SEQ ID NO:

1.

5. The method for identifying the genetic sex of male and female rock porgy according to claim 4, characterized in that: The specific primers in step 1) are: Ch septin7 _F:1 : 5’- GGACCGGGGCAAGGGACCCACAC-3’; Ch septin7 _R:2 : 5'- CTAACATCTGAGTGCAGGGGAGGCT-3'。 6. A primer for detecting a specific marker for detecting insertion variation in the intron region of a gene of a striped porgy according to claim 1, characterized in that: Ch septin7 _F:1 : 5’- GGACCGGGGCAAGGGACCCACAC-3’; Ch septin7 _R:2 : 5'- CTAACATCTGAGTGCAGGGGAGGCT-3'。 7. Use of a specific labeled primer for detecting insertion variation in the intron region of a gene of a rock bream according to claim 6, characterized in that: The primers are used in detecting the genetic sex of male and female rock bream.

8. A kit for identifying the genetic sex of male and female rock bream, characterized in that: The kit contains the primers described in claim 6.

Images