A biosulfoxide synthase for producing ergothioneine, a biological material, a production method and application
By modifying the sulfoxide synthase in the ergothioneine synthesis pathway through enzyme engineering and mutating its key sites, a highly efficient mutant strain was constructed, solving the problem of high production cost of ergothioneine and achieving high-yield and low-cost production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BLOOMAGE BIOTECHNOLOGY CORP LTD
- Filing Date
- 2023-03-23
- Publication Date
- 2026-07-14
AI Technical Summary
The preparation cost of ergothioneine in the existing technology is high and the enzyme conversion efficiency is low, making it difficult to meet the needs of large-scale mass production. In particular, the large amount of S-adenosylmethionine used in the whole-cell catalysis method leads to high production costs.
By modifying the sulfoxide synthase in the ergothioneine synthesis pathway through enzyme engineering, its key sites were mutated to improve catalytic performance. The modified sulfoxide synthase mutant nucleotide sequence was then converted into E. coli competent cells by electroconversion to construct a highly efficient mutant engineered strain.
It significantly increased the yield of ergothionein and reduced production costs. The mutant enzyme M8 (R389H) increased the yield by about 10% and 50% in E. coli EGT33 and BL21 (DE3) hosts, respectively, thus improving economic benefits.
Smart Images

Figure CN118685371B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and particularly relates to a sulfoxide synthase and biomaterial for producing ergothioneine, a method for producing ergothioneine using the sulfoxide synthase, and its application. Background Technology
[0002] Ergothioneine (EGT) is a rare natural amino acid with important physiological activities in the body. Studies have shown that ergothioneine has multiple physiological functions, including scavenging free radicals, anti-inflammation, maintaining DNA biosynthesis, normal cell growth, and cellular immunity.
[0003] Currently, the main methods for preparing ergothioneine include chemical synthesis, extraction, and microbial fermentation. Among these, the safety of products synthesized by chemical synthesis is difficult to guarantee, and its high synthesis cost limits its application. Meanwhile, ergothioneine extracted from natural biological raw materials such as edible fungi fruiting bodies, grains, and animal tissues still has very low content and suffers from problems such as high impurities, drug residues, and high extraction costs, making industrialization difficult. Utilizing metabolic engineering and synthetic biology techniques to construct a biosynthetic pathway for ergothioneine in model microorganisms and producing ergothioneine through microbial fermentation can effectively improve the yield of ergothioneine and achieve low-cost, large-scale production.
[0004] Existing technologies provide several genetically engineered strains for ergothioneine production. For example, patent CN112251392A describes the construction of a high-yield ergothioneine-producing strain. This technology integrates the Mycobacterium smegmatis ergothioneine synthesis gene cluster MsEgtBCDE and the E. coli-derived glutamylcysteine ligase gene gshA into the E. coli MG1655 genome, and regulates amino acid metabolism to construct a high-yield ergothioneine-producing strain. The ergothioneine yield reached 2.9 g / L after 52 hours of fermentation. Another example is patent CN114107326A, where researchers used two genes, tregt1 and tregt2, from Trichoderma reesei to prepare ergothioneine via whole-cell catalysis, achieving a yield of 4.5 g / L after 144 hours, which is the highest yield reported in existing technologies.
[0005] Although the yield of ergothioneine prepared by whole-cell catalysis has been significantly improved, the production cost remains high due to factors such as low enzyme conversion efficiency and large amounts of S-adenosylmethionine, failing to meet the needs for effective cost reduction and large-scale production. Therefore, how to utilize metabolic engineering techniques to regulate the metabolic flux of ergothioneine synthesis and achieve efficient ergothioneine synthesis remains a challenge to be solved in this field. Summary of the Invention
[0006] Studies have shown that histidine betaine (HER) accumulates in large quantities, confirming the rate-limiting step in the ergothioneine synthesis pathway through in vitro enzyme catalysis experiments. Therefore, the reaction catalyzed by sulfoxide synthase (EgtB) is the rate-limiting step in the ergothioneine synthesis pathway. Thus, the objective of this invention is to improve the performance of sulfoxide synthase, a key enzyme in the ergothioneine synthesis pathway, through enzyme engineering, thereby increasing the yield of ergothioneine in engineered bacteria and developing high-yielding strains.
[0007] On the one hand, this application provides a sulfoxide synthase for the production of ergothioneine, wherein:
[0008] A1) The sulfoxide synthase is an enzyme mutant obtained by mutating the arginine residue at position 389 of the wild-type sulfoxide synthase sequence to a histidine residue, a lysine residue, or a glutamine residue;
[0009] A2), the wild-type sulfoxide synthase contains the amino acid sequence shown in SEQ ID NO.1.
[0010] Preferably, the sulfoxide synthase is an enzyme mutant obtained by mutating the arginine residue at position 389 of the wild-type sulfoxide synthase sequence to a histidine residue.
[0011] Preferably, the wild-type sulfoxide synthase is derived from Mycobacterium smegmatis.
[0012] In one embodiment, the sulfoxide synthase comprises the amino acid sequence shown in SEQ ID NO.2.
[0013] On the other hand, this application provides a biomaterial, which is any one of the following B1) to B6):
[0014] B1) A nucleic acid molecule, wherein the nucleic acid molecule contains a nucleic acid molecule encoding the sulfoxide synthase;
[0015] B2) Expression cassette, the expression cassette containing a nucleic acid molecule encoding the sulfoxide synthase;
[0016] B3), a recombinant vector, wherein the recombinant vector contains the nucleic acid molecule described in B1) and / or contains the expression cassette described in B2);
[0017] B4) Recombinant microorganisms, wherein the recombinant microorganisms contain the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3);
[0018] B5), recombinant cells, wherein the recombinant cells contain the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3);
[0019] B6), whole-cell catalyst, wherein the whole-cell catalyst contains the recombinant microorganism described in B4) or the recombinant cell described in B5).
[0020] In one embodiment, the nucleic acid molecule described in B1) is any one of the following b11) to b13):
[0021] b11) A nucleic acid molecule formed by mutating the CGC base encoding arginine at position 389 of the nucleotide sequence encoding wild-type sulfoxide synthase to the CAT base encoding histidine.
[0022] b12) has 75% or more identity with the nucleotide sequence defined in b11) and encodes the DNA molecule of the sulfoxide synthase;
[0023] b13), under stringent conditions, hybridizes with any of the defined nucleotide sequences in b11) to b12) and encodes the genomic DNA molecule of the sulfoxide synthase.
[0024] The term "vector" as used herein refers to a vector capable of delivering exogenous DNA or a target gene into a host cell for amplification and expression. This vector can be a cloning vector or an expression vector, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), or viral vectors. Specifically, it can be the vector pET28(a), pETDuet, pGRB cloning vector, and / or pREDCas9 plasmid.
[0025] The term "microorganisms" as used in this article can refer to yeast, bacteria, algae, or fungi. Among them, bacteria can be derived from, but are not limited to, genera such as *Escherichia* sp., *Erwinia* sp., *Agrobacterium* sp., *Flavobacterium* sp., *Alcaligenes* sp., *Pseudomonas* sp., *Bacillus* sp., *Brevibacterium* sp., *Corynebacterium* sp., *Aerobacter* sp., *Enterobacteria* sp., *Micrococcus* sp., *Serratia* sp., *Salmonella* sp., *Streptomyces* sp., and *Providencia* sp.
[0026] Furthermore, the recombinant microorganism is one or more of Corynebacterium glutamicum, Bacillus subtilis, Escherichia coli, Saccharomyces cerevisiae, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum, or Pantoea, but is not limited thereto.
[0027] In one embodiment, the recombinant microorganism is one or more of Corynebacterium glutamicum, Bacillus subtilis, Escherichia coli, and Saccharomyces cerevisiae.
[0028] Preferably, the recombinant microorganism is Escherichia coli.
[0029] Optionally, the host of the recombinant microorganism can be Escherichia coli EGT33 and / or Escherichia coli BL21(DE3).
[0030] Preferably, the DNA molecule of b12) has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence defined in b11).
[0031] In one embodiment, the nucleotide sequence encoding the wild-type sulfoxide synthase is as shown in SEQ ID NO.3, or has at least 75% sequence identity with the nucleotide sequence shown in SEQ ID NO.3.
[0032] Optionally, the nucleic acid molecule has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO.3.
[0033] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO.4, or has at least 75% sequence identity with the nucleotide sequence shown in SEQ ID NO.4.
[0034] Optionally, the nucleic acid molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO.4.
[0035] Optionally, the method for constructing Escherichia coli EGT33 has been disclosed in the patent document with application number ZL202211546541.5, and the construction method described in that patent can be used.
[0036] On the other hand, this application provides the use of the sulfoxide synthase or the biomaterial in the production of ergothionein.
[0037] On the other hand, this application provides a method for producing ergothioneine, comprising the following steps:
[0038] Obtain recombinant cells expressing the sulfoxide synthase or containing the biological material;
[0039] The recombinant cells were cultured to obtain ergothionein.
[0040] The cells described herein may be plant cells or animal cells. These cells may be any biological cells capable of synthesizing the desired ergothioneine.
[0041] Preferably, the bacteria is Escherichia coli.
[0042] Preferably, the step of culturing recombinant biological cells includes shake-flask fermentation.
[0043] More preferably, the step of culturing recombinant biological cells using shake-flask fermentation includes:
[0044] The recombinant microorganism was cultured overnight in LB medium at 37°C and 200 rpm to obtain a seed culture. The seed culture was then transferred to a resistant fermentation medium at an inoculum of 10% and cultured at 37°C and 200 rpm for 0.5 h. Isopropyl-β-D-thiogalactoside IPTG was added to a final concentration of 0.2 mM and the culture was induced at 37°C for 10-12 h to synthesize ergothionein.
[0045] On the other hand, this application provides the use of the sulfoxide synthase, the biomaterial, and the method in the preparation of pharmaceuticals, food, or cosmetics containing ergothioneine.
[0046] Optionally, the dosage forms of the medicines, food, or cosmetics include, but are not limited to, powders, tablets, capsules, gels, or topical application agents such as lotions, creams, and masks, or daily necessities such as shampoos, conditioners, and hair masks.
[0047] The present invention has the following beneficial effects:
[0048] 1. This application targets the sulfoxide synthase MsEgtB derived from Mycobacterium smegmatis. Through computer simulation and rational design, two potential sites in its amino acid sequence were identified for enzyme engineering mutation modification to enhance catalytic performance and further increase ergothioneine yield. Based on the rational analysis results, this invention designed a total of 9 mutants, and after experimental screening, one beneficial mutation was obtained: M8(R389H), thus obtaining a new sulfoxide synthase mutant with significantly improved catalytic performance.
[0049] 2. This application uses electroporation to transform a recombinant plasmid containing the nucleotide sequence of the sulfoxide synthase mutant into competent Escherichia coli cells, thereby obtaining a mutant engineered strain that can efficiently express the sulfoxide synthase mutant. This results in an increase in ergothioneine production using this engineered strain to over 90 mg / L, and up to over 150 mg / L. Furthermore, the M8 (R389H) mutation of the sulfoxide synthase has almost no impact on the growth of the host cells.
[0050] 3. The sulfoxide synthase mutant provided in this application has a mutation effect that is not limited by the expression host. When Escherichia coli EGT33 is used as the host, the mutant enzyme M8 can increase the yield of ergothioneine by about 10% under the same culture conditions. When BL21(DE3) is used as the expression host, the M8 mutation can increase the yield of ergothioneine by about 50% under the same conditions.
[0051] 4. This application, through enzyme engineering modification, can not only increase ergothioneine yield, but also reduce production costs under the same productivity conditions, thereby improving economic efficiency. Attached Figure Description
[0052] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments of this application and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:
[0053] Figure 1 This is a diagram showing the PCR amplification results of the target gene.
[0054] Figure 2 This is a diagram showing the sequencing results of the M1-M9 mutant plasmid;
[0055] Figure 3 This is a diagram showing the results of shake-flask culture of the M1-M9 mutant strain;
[0056] Figure 4 This is a graph showing the PCR screening results;
[0057] Figure 5 This is a graph showing the results of the M8 mutation effect verification. Detailed Implementation
[0058] To more clearly illustrate the overall concept of this application, a detailed description is provided below with reference to the accompanying drawings and embodiments. Numerous specific details are set forth in the following description to provide a more thorough understanding of the invention. However, it will be apparent to those skilled in the art that the invention can be practiced without one or more of these details. In other instances, certain technical features well-known in the art have not been described to avoid confusion with the invention.
[0059] Unless otherwise specified in the examples, the conditions shall be performed according to the standard conditions or the conditions recommended by the manufacturer.
[0060] Unless otherwise specified, in the following embodiments, reagents or instruments whose manufacturers are not indicated are all conventional products that can be purchased commercially.
[0061] The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations were performed according to the kit instructions.
[0062] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. Specifically, they can be performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).
[0063] In the following examples, the wild-type sulfoxide synthase was derived from Mycobacterium smegmatis, which was purchased from the China General Microbiological Culture Collection Center (CGMCC) under strain number 1.562.
[0064] For ease of experimental operation, the following examples directly involve enzyme engineering modification of an engineered bacterium containing the MsEgtB gene that produces ergothioneine (named engineered strain B, strain pETDuet-Ptac-MsEgtB / EGT33, which our company has constructed). The effectiveness of the enzyme engineering modification is evaluated by detecting the ergothioneine yield. The construction method of strain pETDuet-Ptac-MsEgtB (approximately 6500 bp in size) includes the following steps:
[0065] (1) Target gene amplification and recovery
[0066] use Max DNA Polymerase (purchased from Takara, model R045A) was used as the amplification enzyme. The genome of Mycobacterium smegmatis (purchased from CGMCC, catalog number 1.562) was used as a template. Primers BF (nucleotide sequence CTTTAAGAAGGAGATAT ACCATGGGCTTGATCGCACGCGAGACACTG) and BR (nucleotide sequence CGATA TCCAATTGAGATCTGCCATATGTCAGACGTCCCAGGCCAGG) were used as amplification primers to amplify the target gene MsEgtB.
[0067] After amplification, the PCR products were detected by agarose gel electrophoresis. The target band was cut off from the agarose gel and its DNA was purified and recovered using a gel recovery kit (Omega, model D2500-02).
[0068] (2) Expression vector digestion and recovery
[0069] The expression vector pETDuet-Ptac (constructed and preserved by our company) was double-digested with restriction endonucleases NcoI-HF (purchased from NEB, model R3193S) and NdeI (purchased from NEB, model R0111V) and reacted at 37℃ for 2 h. Then, the DNA was purified and recovered using a recovery kit (purchased from Tiangen, model DP214-03).
[0070] (3) Gibson connection
[0071] The purified and recovered single DNA fragments and the expression vector pETDuet-Ptac, which contain partially repetitive sequences at their ends, can be ligated head-to-tail using a Gibson kit (TransGen, model CU201-03) to form circular plasmids. After the reaction system is prepared, ligation can be completed by reacting in a 50°C water bath for 15 minutes, allowing for subsequent transformation experiments.
[0072] (4) Chemical transformation of Escherichia coli
[0073] E. coli competent cells (trans10, purchased from TransGen, model CD101-02) were placed in an ice bath. After the competent cells thawed, 4-10 μl of Gibson ligation product was added for chemical transformation. After thawing, 100 μl of the bacterial culture was spread onto LB agar plates containing 100 mg / ml Amp resistance and incubated overnight at 37°C to obtain transformants.
[0074] (5) Sequencing verification
[0075] PCR screening and verification were performed using Green Taq Mix (purchased from Novizan, model P131-01). The screening primers were Ptac-F (nucleotide sequence GACAATTAATCATCGGCTCG) and T7ter (nucleotide sequence GCTAGTTATTGCTCAGCGG). Positive clones were obtained and cultured for sequencing.
[0076] Three single clones were picked and added to 4 ml of LB liquid medium containing 100 mg / ml Amp resistance. The culture was carried out overnight at 37°C and 200 rpm. The bacterial cells were then collected and plasmids were extracted using the Tiangen Plasmid Mini-Prep Kit DP103-03 for sequencing verification. The sequencing primers selected were Ptac-F and T7ter.
[0077] The method for constructing E. coli EGT33 includes the following steps:
[0078] The method for constructing E. coli EGT33 has been disclosed in patent application number 202211546541.5, specifically including: using E. coli as the host, heterologously overexpressing the egtD gene from Microcoleus sp. PCC 7113, the egtB gene from Methylobacterium pseudosasicola, the egt2 gene from Neurospora crassa, and the hisG* gene encoding the ATP transphosphoribosylase mutant from Corynebacterium glutamicum; and overexpressing the hisDBCHAFI gene cluster, the gene encoding the serine transacetylase mutant CysE (M201R), the gene encoding the phosphoglycerate dehydrogenase mutant SerA (H344A / N364A), and the gene encoding the adenosylmethionine synthase mutant MetK (I303V); and not expressing the tryptophanase gene tnaA. This strain systematically modified the ergothioneine synthesis module and the precursor histidine, cysteine and S-adenosylmethionine synthesis modules to achieve efficient and stable production of ergothioneine in Escherichia coli.
[0079] Transforming the above pETDuet-Ptac-MsEgtB into the above EGT33 will yield an engineered bacterium B containing the MsEgtB gene that produces ergothionein. Those skilled in the art can choose the transformation method according to the actual situation.
[0080] In the following embodiments:
[0081] The wild-type amino acid sequence of the sulfoxide synthase MsEgtB is shown in SEQ ID NO.1;
[0082] The amino acid sequence of the mutant MsEgtB-M8 obtained by the M8 mutation (R389H) of sulfoxide synthase is shown in SEQ ID NO.2;
[0083] The nucleotide sequence encoding the wild-type sulfoxide synthase MsEgtB is shown in SEQ ID NO.3;
[0084] The nucleotide sequence of the mutant obtained by the M8 mutation (R389H) encoding sulfoxide synthase is shown in SEQ ID NO.4, that is, the base CGC encoding arginine at position 389 in the amino acid sequence shown in SEQ ID NO.3 is mutated to the base CAT used to encode histidine;
[0085] The nucleotide sequence encoding the wild-type sulfoxide synthase MsEgtBCDE gene cluster is shown in SEQ ID NO.5;
[0086] The nucleotide sequence of the mutant obtained by the M8 mutation (R389H) encoding the sulfoxide synthase MsEgtBCDE is shown in SEQ ID NO.6, that is, the base CGC for arginine at position 389 in the nucleotide sequence shown in SEQ ID NO.5 is mutated to the base CAT for histidine.
[0087] Example 1: Rational Design and Modification of Sulfoxide Synthetase MsEgtB
[0088] In this embodiment, computer simulation analysis was used to rationally design and modify the sulfoxide synthase MsEgtB, a key enzyme in the ergothioneine synthesis pathway, to improve its activity. The computer simulation analysis revealed two potential sites and a total of nine mutation directions. The mutation information of the engineered bacteria involved in this embodiment is shown in Table 1 below.
[0089] Table 1 Information on M1-M9 mutant strains
[0090] Nomenclature of engineered bacteria mutation site mutation information B none - M1 H80T The histidine at position 80 of MsEgtB is mutated to threonine. M2 H80Q The histidine at position 80 of MsEgtB is mutated to glutamine. M3 H80N The histidine at position 80 of MsEgtB is mutated to asparagine. M4 H80K The histidine at position 80 of MsEgtB is mutated to lysine. M5 H80Y The histidine at position 80 of MsEgtB is mutated to tyrosine. M6 H80F The histidine at position 80 of MsEgtB is mutated to phenylalanine. M7 R389K The arginine at position 389 of MsEgtB is mutated to lysine. M8 R389H The arginine at position 389 of MsEgtB is mutated to histidine. M9 R389Q The arginine at position 389 of MsEgtB is mutated to glutamine.
[0091] Example 2: Construction process of engineered bacteria
[0092] In this embodiment, enzyme engineering was performed on the ergothioneine-producing engineered bacterium (named engineered bacterium B, pETDuet-Ptac-MsEgtB / EGT33) containing the MsEgtB gene. The effectiveness of the enzyme engineering was evaluated by detecting the ergothioneine yield. The specific method is as follows:
[0093] (1) Target gene amplification and recovery
[0094] Using the recombinant plasmid pETDuet-Ptac-MsEgtB as a template, GXL (Premix) DNA polymerase (purchased from Takara, R051A) was used as the amplification enzyme. The vector pETDuet-Ptac-MsEgtB was amplified by PCR using the primers listed in Table 2 below, and the specified mutation sites were introduced into pETDuet-Ptac-MsEgtB.
[0095] Table 2 Primers for PCR amplification
[0096]
[0097]
[0098] After amplification, 1 μL of DpnI enzyme (purchased from NEB, model R0176L) was added to 50 μL of PCR product, mixed well, and incubated at 37°C for 1 hour to digest the template. The PCR product was then detected by agarose gel electrophoresis. The results are shown below. Figure 1 As shown. The target band was cut from the agarose gel and its DNA was purified and recovered using a gel extraction kit (Omega, model D2500-02).
[0099] (2) Gibson connection
[0100] The purified and recovered single DNA fragments contained partially repetitive sequences at their ends. These fragments could be ligated head-to-tail using a Gibson reagent kit (TransGen, model CU201-03) to form circular plasmids, as shown in Table 3. After preparation, the reaction mixture was incubated in a 50°C water bath for 15 minutes to complete the ligation, allowing for subsequent transformation experiments.
[0101] Table 3 Gibson System
[0102] name Added amount 2*Basic Assembly Mix 5μL gene fragments 50-200ng Deionized water To 10μL
[0103] (3) Chemical transformation of Escherichia coli
[0104] E. coli competent cells trans10 (purchased from TransGen, model CD101-02) were placed in an ice bath. After the competent cells thawed, 4-10 μL of Gibson ligation product was added for chemical transformation. After thawing, 100 μL of the bacterial culture was spread onto LB solid medium (formulation as shown in Table 4) containing 100 mg / mL Amp resistance and incubated overnight at 37°C to obtain transformants.
[0105] Table 4 LB solid culture medium formulation
[0106] Reagent Name Dosage (g / L) source yeast powder 5 Oxoid trypsin 10 Oxoid NaCl 5 Sinopharm Group Agar powder 15 Sinopharm Group
[0107] (4) Sequencing verification
[0108] Because PCR amplification introduces mutation sites, we directly selected bacteria for sequencing verification. Three single clones were selected and added to 4 mL of LB liquid medium containing 100 mg / mL Amp resistance (formulation shown in Table 5), and cultured overnight at 37°C and 200 rpm. Afterwards, the bacterial cells were collected, and plasmids were extracted using the Tiangen Plasmid Mini-Prep Kit DP103-03 for sequencing verification. M1-M6 were sequenced using primer Ptac-F (nucleotide sequence GACAATTAATCATCGGCTCG), and M7-M9 were sequenced using the universal primer T7ter. The sequencing results are attached. Figure 2 As shown.
[0109] Table 5 LB liquid culture medium formulation
[0110] Reagent Name Dosage (g / L) source yeast powder 5 Oxoid trypsin 10 Oxoid NaCl 5 Sinopharm Group
[0111] (5) Electroporation of Escherichia coli
[0112] The specific steps include:
[0113] 1. Preparation of competent Escherichia coli cells
[0114] Ergothioneine-producing E. coli EGT33 was streaked onto antibiotic-free LB agar plates and incubated overnight at 37°C. After activation, single colonies were picked and inoculated into 4 mL of antibiotic-free LB medium and incubated overnight at 37°C and 200 rpm to prepare seed culture.
[0115] Take 2 mL of seed culture and inoculate it into a 250 mL Erlenmeyer flask containing 50 mL of antibiotic-free LB medium. Incubate at 37 °C and 200 rpm until the biomass reaches the target (absorbance at 600 nm, i.e., OD). 600When the bacterial culture reaches 0.6-0.8 (2-2.5h), centrifuge at 5000rpm and 4℃ for 4min to collect the bacterial cells for preparing competent cells. Wash the bacterial cells 4 times with sterile 10% glycerol, and finally resuspend the bacterial cells in 1mL of sterile 10% glycerol. Aliquot the cells into sterile 1.5mL centrifuge tubes for later use, with 100μL in each tube.
[0116] 2. Electroporation preparation of engineered bacteria B and M1-M9
[0117] The correctly sequenced plasmid pETDuet-Ptac-MsEgtB and the mutant plasmids pETDuet-Ptac-M1, pETDuet-Ptac-M2, pETDuet-Ptac-M3, pETDuet-Ptac-M4, pETDuet-Ptac-M5, pETDuet-Ptac-M6, pETDuet-Ptac-M7, pETDuet-Ptac-M8, and pETDuet-Ptac-M9 were electroporated in 1 μL into the prepared E. coli competent cells EGT33 to prepare engineered bacteria B and M1-M9, as shown in Table 6.
[0118] Table 6 Information on engineered bacteria
[0119]
[0120] After resuscitation, the bacterial culture was spread onto LB solid medium plates containing 100 mg / mL Amp resistance and incubated overnight at 37°C. Single colonies were inoculated into 4 mL of LB liquid medium containing 100 mg / mL Amp resistance and incubated overnight at 37°C and 200 rpm. The bacterial culture was then stored in 30% or higher glycerol at -80°C.
[0121] Example 3: Mutation effect detection of engineered bacteria M1-M9 in shake flask culture.
[0122] (1) Streaking activation of engineered bacteria and preparation of seed culture
[0123] The engineered bacteria constructed in Example 2 (see Table 6) were streaked onto LB agar plates containing 100 mg / mL Amp resistance and incubated overnight at 37°C. After activation by streaking, three single clones of each engineered bacteria were picked and inoculated into 4 mL of LB medium containing the corresponding resistance. The culture was then incubated overnight at 37°C and 200 rpm to prepare seed culture for subsequent shake-flask culture.
[0124] (2) Shake flask culture of engineered bacteria
[0125] Take 3 mL of the above seed culture and add it to a 500 mL Erlenmeyer flask containing 30 mL of 100 mg / mL Amp-resistant fermentation medium (formulation shown in Table 7). Incubate at 37℃ and 200 rpm for 0.5 h. Then add isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.2 mM and induce culture at 37℃ for 10-12 h to synthesize the target product, ergothioneine. During the culture, use ammonia to adjust the pH to maintain it at approximately 7.0. After the culture is complete, centrifuge at 12000 rpm for 2 min to collect the fermentation supernatant and determine the ergothioneine content. It is also necessary to detect the biomass at the end of the culture (absorbance at 600 nm, i.e., OD). 600 ).
[0126] Table 7 Fermentation medium formulation
[0127] name concentration factory Yeast Extract 4g / L Oxoid Tryptone 5g / L Oxoid Sodium citrate 2g / L McLean <![CDATA[KH2PO4]]> 2g / L McLean <![CDATA[MgSO4·7H2O]]> 2g / L McLean <![CDATA[FeSO4·7H2O]]> 20mg / L McLean <![CDATA[MnSO4·7H2O]]> 10mg / L McLean Methionine 1g / L Solarborg Cysteine 0.5g / L Solarborg <![CDATA[VB1、VB3、VB5、VB 12 、In H ]]> 2mg / L Solarborg <![CDATA[V6]]> 10mg / L Solarborg
[0128] (3) Detection of ergothionein yield by high performance liquid chromatography (HPLC)
[0129] The concentration of ergothioneine in fermentation broth was determined by high performance liquid chromatography (HPLC). Detection conditions: Kromasil C18 column (250 mm × 4.60 mm, 5 μm); mobile phase: acetonitrile:water = 2:98 (v / v); flow rate: 0.7 mL / min; column temperature: 30 °C; UV detection wavelength: 257 nm.
[0130] (4) Analysis of the effects of mutants
[0131] Control strain B and mutant strains M1-M9 were cultured in shake flasks. After the culture was completed, the OD of the harvested bacteria was measured. 600 The values and concentrations of ergothioneine in the fermentation supernatant are shown in Table 8 below, and the results are plotted as follows: Figure 3 As can be seen from the figure, the MsEgtB gene mutation not only affects the yield of ergothioneine in engineered bacteria, but also affects bacterial growth. Only the mutant strain M8 is a favorable mutation, which can increase the yield of ergothioneine by about 6%, and the bacterial growth is almost unaffected. However, other mutation directions all significantly reduce the yield of ergothioneine.
[0132] Table 8. Data on the effects of M1-M9 mutations
[0133] B M1 M2 M3 M4 M5 M6 M7 M8 M9 OD600 11.76 8.81 9.97 9.11 9.92 10.75 10.57 1.90 11.70 8.89 EGT mg / L <![CDATA[140.17 * ]]> 55.99 67.69 68.20 62.93 78.27 81.47 22.55 <![CDATA[158.15 * ]]> 66.63
[0134] Note: *P < 0.01
[0135] Example 4: Effect of M8 (R389H) mutation on BL21 (DE3) host
[0136] To verify that the beneficial mutant M8 (R389H) in Example 3 is not host-restricted and is a result of improved mutant enzyme performance, we constructed an ergothionein-producing BL21(DE3) engineered bacterium in this example to further validate its mutant effect. The construction process is as follows:
[0137] (1) Target gene amplification and recovery
[0138] This embodiment uses the genome of Mycobacterium smegmae (purchased from CGMCC, catalog number 1.562) as a template. Max DNA Polymerase (purchased from Takara, model R045A) was used as the amplification enzyme. PCR amplification was performed using the primers listed in Table 9 below to amplify the MsEgtBCDE gene cluster. To obtain the gene cluster containing the R389H mutation site, the specified mutation site was introduced using M8-F & M8-R listed in Table 2.
[0139] Table 9 Primers for PCR amplification
[0140] Primer name nucleotide sequence Ms-F CTTTAAGAAGGAGATATACCATGGGCTTGATCGCACGCGAGACAC Ms-R CGGTTTCTTTACCAGACTCGAGTTTTTCAGGGCGCCTCACGC
[0141] After amplification, the PCR products were detected by agarose gel electrophoresis. The target band was cut off from the agarose gel and its DNA was purified and recovered using a gel recovery kit (Omega, model D2500-02).
[0142] (2) Expression vector digestion and recovery
[0143] The expression vector pETDuet-1 (purchased from UBO Biotechnology, model VT1237) was double-digested with restriction endonucleases NcoI-HF (purchased from NEB, model R3193S) and XhoI (purchased from NEB, model R0146V). The digestion system is shown in Table 10. The reaction was carried out at 37℃ for 2 h. After that, the DNA was purified and recovered using a recovery kit (purchased from Tiangen, model DP214-03).
[0144] Table 10 Double Enzyme Digestion System
[0145] name Added amount pETDuet-1 1-2μg NcoI-HF 2.5μL XhoI 2.5μL <![CDATA[10*CutSmart TM Buffer]]> 5μL Deionized water To 50μL
[0146] (3) Gibson connection
[0147] The purified and recovered single DNA fragments and the enzyme-digested expression vector pETDuet-1, which contain partially repetitive sequences at their ends, can be ligated head-to-tail using a Gibson kit (TransGen, model CU201-03) to form a circular plasmid. After the reaction system is prepared, ligation can be completed by reacting in a 50°C water bath for 15 minutes, allowing for subsequent transformation experiments.
[0148] (4) Chemical transformation of Escherichia coli
[0149] E. coli competent cells (trans10, purchased from TransGen, model CD101-02) were placed in an ice bath. After the competent cells thawed, 4-10 μL of Gibson ligation product was added for chemical transformation. After thawing, 100 μL of the bacterial culture was spread onto LB agar plates containing 100 mg / mL Amp resistance and incubated overnight at 37°C to obtain transformants.
[0150] (5) Sequencing verification
[0151] PCR screening and validation were performed using Green Taq Mix (purchased from Novizan, model P131-01). The screening primers were MsE-F (nucleotide sequence ATGATGCTCGCGCAGCAGTG) and T7ter (nucleotide sequence GCTAGTTATTGCTCAGCGG). Twenty-four single clones from each construction were selected for screening and validation. The results are shown in the attached figure. Figure 4 As shown in the figure, suitable positive clones were obtained from all screenings.
[0152] Three single clones were picked and added to 4 mL of LB liquid medium containing 100 mg / mL Amp resistance. The culture was carried out overnight at 37°C and 200 rpm. The bacterial cells were then collected and plasmids were extracted using the Tiangen Plasmid Mini-Prep Kit DP103-03 for sequencing verification. Universal primers T7 and T7ter were selected for sequencing.
[0153] (6) Chemical transformation to prepare engineered bacteria
[0154] 1 μL of each of the correctly sequenced plasmids pETDuet-MsEgtBCDE (containing the MsEgtBCDE gene cluster) and pETDuet-MsEgtB*CDE (containing the MsEgtBCDE gene cluster with the R389H mutation site) was transformed into *E. coli* BL21(DE3) competent cells (purchased from TransGen, model CD601-02). After resuscitation, the bacterial culture was plated onto LB agar plates containing 100 mg / mL Amp resistance and incubated overnight at 37°C. Single colonies were inoculated into 4 mL of LB liquid medium containing 100 mg / mL Amp resistance and incubated overnight at 37°C and 200 rpm. The bacterial culture was then stored in 30% glycerol at -80°C.
[0155] The information of the engineered bacteria constructed in this embodiment is shown in Table 11 below.
[0156] Table 11 Information on the constructed engineered bacteria
[0157] Engineered bacteria name plasmid / host resistance BL21-B pETDuet-MsEgtBCDE / BL21(DE3) 100mg / mL Amp BL21-M8 pETDuet-MsEgtB*CDE / BL21(DE3) 100mg / mL Amp
[0158] (7) Verification by shake flask culture
[0159] The engineered bacteria of this embodiment were cultured in shake flasks and tested according to the method described in Example 3. The results are shown in the attached figure. Figure 5 As shown in Table 12 below, the data indicates that the M8 mutation site R389H remains a favorable mutation in the BL21(DE3) host, increasing ergothioneine production by approximately 50%.
[0160] Table 12 Data from shake-flask culture of mutant strains
[0161] BL21-B BL21-M8 OD600 17.59 18.13 EGT mg / L 63.02* 94.74*
[0162] Note: *P < 0.01
[0163] In summary, the M8 (R389H) mutation of sulfoxide synthase significantly improves its catalytic performance and increases the yield of ergothioneine without affecting the growth of the host cell, making it a favorable mutation direction for MsEgtB.
[0164] The above description is merely an embodiment of this application and is not intended to limit the scope of this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the scope of the claims of this application.
Claims
1. A sulfoxide synthase for the production of ergothioneine, characterized in that, The sulfoxide synthase is an enzyme mutant obtained by mutating the arginine residue at position 389 of the wild-type sulfoxide synthase sequence to a histidine residue. The amino acid sequence of the wild-type sulfoxide synthase is shown in SEQ ID NO.
1.
2. The sulfoxide synthase according to claim 1, characterized in that, The amino acid sequence of the sulfoxide synthase is shown in SEQ ID NO.
2.
3. A biomaterial, characterized in that, The biomaterial is any one of the following B1) to B4): B1) A nucleic acid molecule, wherein the nucleic acid molecule encodes the sulfoxide synthase as described in claim 1 or 2; B2) Expression cassette, the expression cassette containing a nucleic acid molecule encoding the sulfoxide synthase as described in claim 1 or 2; B3), a recombinant vector, wherein the recombinant vector contains the nucleic acid molecule described in B1) and / or contains the expression cassette described in B2); B4) Whole-cell catalyst, wherein the whole-cell catalyst contains the nucleic acid molecule described in B1), the expression cassette described in B2), and / or the recombinant vector described in B3).
4. The biomaterial according to claim 3, characterized in that, The whole-cell catalyst is a recombinant cell.
5. The biomaterial according to claim 4, characterized in that, The recombinant cells are recombinant microorganisms.
6. The biomaterial according to claim 3, characterized in that, The nucleic acid molecule described in B1) is a nucleic acid molecule formed by mutating the CGC base, which encodes wild-type sulfoxide synthase and is used to encode arginine at position 389, to the CAT base, which encodes histidine.
7. The biomaterial according to claim 3, characterized in that, The nucleic acid molecule is shown in SEQ ID NO.
4.
8. The biomaterial according to claim 5, characterized in that, The recombinant microorganism is one or more of Corynebacterium glutamicum, Bacillus subtilis, Escherichia coli, and Saccharomyces cerevisiae.
9. The biomaterial according to claim 8, characterized in that, The recombinant microorganism is Escherichia coli.
10. The use of the sulfoxide synthase as described in claim 1 or 2, or the biomaterial as described in any one of claims 3-9, in the production of ergothioneine.
11. A method for producing ergothioneine, characterized in that, Includes the following steps: Step 1: Obtain recombinant biological cells expressing the sulfoxide synthase as described in claim 1 or 2, or containing biological materials as described in any one of claims 3-9; Step 2: Cultivate the recombinant biological cells to obtain ergothionein.
12. The method according to claim 11, characterized in that, The biological cells are bacteria, algae, fungi, plant cells, or animal cells that can synthesize ergothioneine.
13. The method according to claim 12, characterized in that, The bacteria in question is Escherichia coli.
14. The use of the sulfoxide synthase of claim 1 or 2, the biomaterial of any one of claims 3-9, or the method of any one of claims 11-13 in the preparation of pharmaceuticals, food or cosmetics containing ergothioneine.