Medicago falcata cold tolerance gene mfa p2-12 and application thereof

Abstract

The application discloses a medicago polymorpha cold-resistant gene MfAP2-12 and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the cold-resistant gene MfAP2-12 is shown in SEQ ID NO. 1. The application also discloses application of the medicago polymorpha cold-resistant gene MfAP2-12 in improving the cold resistance or low-temperature resistance of plants, and contributes to breeding of excellent cold-resistant plants.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a cold-resistant gene MfAP2-12 in alfalfa and its application. Background Technology

[0002] Low-temperature stress is a crucial abiotic stress in plant growth and development, limiting geographical distribution and yield by affecting plant growth and survival. Low-temperature stress can be divided into cold stress (<15℃) and freezing stress (<0℃). Under low-temperature conditions, plant physiology is typically affected, manifesting as stunted growth, dwarfing, wilting, yellowing and loss of green leaves, and deformed flowers and fruits. These factors lead to reduced photosynthetic rates, hindered nutrient absorption and transport, and varying degrees of alteration in organelle structure and function, resulting in increased energy consumption, accelerated aging, and even plant death. Against the backdrop of global climate change, improving alfalfa's cold resistance, drought resistance, and salt tolerance has become key to alfalfa breeding. Utilizing molecular technologies to enhance alfalfa's stress resistance remains a crucial issue that urgently needs to be addressed. Yellow alfalfa is a high-quality leguminous forage crop, exhibiting stronger tolerance to drought, cold, and soil salinization, providing valuable genetic resources for alfalfa breeding.

[0003] Therefore, studying the low-temperature resistance of alfalfa is of great economic and social value for improving crop low-temperature tolerance and increasing crop yield. Summary of the Invention

[0004] Therefore, the purpose of this invention is to provide a cold-resistant gene MfAP2-12 for alfalfa and its application, thereby breeding superior cold-resistant alfalfa varieties.

[0005] The present invention solves the above problems through the following technical solutions:

[0006] A cold-resistant gene MfAP2-12 for alfalfa, the nucleotide sequence of which is shown in Sequence 1.

[0007] Application of the cold-resistant gene MfAP2-12 in alfalfa: The application of the cold-resistant gene MfAP2-12 in alfalfa in improving the plant's resistance to cold or low temperatures.

[0008] Furthermore, the application of the alfalfa cold-resistant gene MfAP2-12 in improving the cold resistance or low-temperature resistance of alfalfa.

[0009] Furthermore, the application of the alfalfa cold-resistant gene MfAP2-12 in improving the cold resistance or low-temperature resistance of Arabidopsis thaliana.

[0010] The nucleotide sequence of MfAP2-12 is shown in Sequence 1:

[0011]

[0012] Beneficial effects:

[0013] The MfAP2-12 gene disclosed in this invention can reduce O2· - The study found that the levels of soluble protein and proline were increased to maintain redox and osmotic balance within the plant, and that the expression levels of CAT1, SOD1, ICE1, COR47, and PIP1 were negatively regulated to affect the low-temperature tolerance of alfalfa. These results provide new negative regulatory genes for alfalfa cold-resistance breeding and enrich the research on the molecular mechanisms of alfalfa's resistance to low temperatures. Attached Figure Description

[0014] Figure 1 Analysis of the expression pattern of the MfAP2-12 gene under 4℃ low temperature stress: A represents leaf, B represents stem, and C represents root;

[0015] Figure 2 Electrophoresis results: A: Total RNA electrophoresis; B: cDNA quality assessment; C: MfAP2-12CDS sequence electrophoresis band; M: 2000bp DNA marker; 1-3: Electrophoresis bands;

[0016] Figure 3 A three-dimensional model of the MfAP2-12 protein;

[0017] Figure 4 A: Total DNA electrophoresis (M: 15000bp DNAMaker), B: Chromosome walking electrophoresis (M: 2000bp DNAMaker);

[0018] Figure 5 MfAP2-12 gene promoter sequence;

[0019] Figure 6 Electrophoresis image validating the MfAP2-12 fragment in the transient expression vector;

[0020] Figure 7 Subcellular localization of the MfAP2-12 gene in tobacco. The MfAP2-12-GFP recombinant vector and the 35S:GFP empty vector were transformed into *Nicotiana benthamiana* epidermal cells. Scale bar, 25 μm;

[0021] Figure 8 Electrophoresis for screening mutant Arabidopsis thaliana. WT: wild-type Arabidopsis thaliana; HM1 and HM2: mutant Arabidopsis thaliana;

[0022] Figure 9 A: Double enzyme digestion image of pMDC123 expression vector; B: Electrophoresis image verifying the MfAP2-12 fragment of overexpression vector;

[0023] Figure 10 Screening of Arabidopsis thaliana in 20 mg / L Basta medium: A: Overexpression lines B: Complementary lines C: Wild-type lines D: Mutant lines;

[0024] Figure 11 Quantitative expression of MfAP2-12 in transgenic Arabidopsis thaliana lines. In the figure, "****" indicates significant difference between groups (P<0.0001), "**" indicates significant difference between each group (P<0.01), and "*" indicates significant difference between each group (P<0.05).

[0025] Figure 12 A: Changes in MDA content in transgenic Arabidopsis thaliana under 4℃ stress; B: Changes in O2·- content in transgenic Arabidopsis thaliana under 4℃ stress; C: Changes in SOD activity in transgenic Arabidopsis thaliana under 4℃ stress; D: Changes in POD activity in transgenic Arabidopsis thaliana under 4℃ stress. RT: room temperature. Different lowercase letters in the figure indicate significant differences between groups, the same applies below.

[0026] Figure 13 A: Changes in CAT activity in transgenic Arabidopsis thaliana under 4℃ stress; B: Changes in soluble protein content in transgenic Arabidopsis thaliana under 4℃ stress; C: Changes in proline content in transgenic Arabidopsis thaliana under 4℃ stress; D: Changes in hydrogen peroxide content in transgenic Arabidopsis thaliana under 4℃ stress. RT: room temperature. Different lowercase letters in the figure indicate significant differences between groups, the same applies below.

[0027] Figure 14 A: CAT1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; B: SOD1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; C: ICE1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; D: CBF1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress.

[0028] Figure 15 A: COR47 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; B: CAS1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; C: TIP2 gene expression level in transgenic Arabidopsis thaliana under low temperature stress; D: PIP1 gene expression level in transgenic Arabidopsis thaliana under low temperature stress. Detailed Implementation

[0029] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings:

[0030] Unless otherwise specified, the experimental methods used in the embodiments of this invention are conventional methods. Unless otherwise specified, the materials and reagents used in the embodiments of this invention are commercially available.

[0031] The seeds of Hulunbuir alfalfa (Medicago falcata), Arabidopsis thaliana, and Nicotiana benthamiana used in this invention were provided by the Key Laboratory of Forage Germplasm Resources and Breeding of Heilongjiang Province, Northeast Agricultural University. The seeds of the Arabidopsis AP2-12 mutant were purchased from Fuzhou Baisente Technology Co., Ltd.

[0032] Escherichia coli Trans1-T1 and DH5 competent cells were purchased from Beijing TransGen Biotechnology Co., Ltd. and Shanghai Weidi Biotechnology Co., Ltd., respectively. Agrobacterium tumefaciens EHA105 was purchased from Shanghai Weidi Biotechnology Co., Ltd. The pCAMBIA1300-35S-sGFP vector and pMDC123 vector were donated by the Plant Genetic Engineering and Molecular Biology Laboratory of the College of Biological Sciences, Northwest A&F University and Northeast Agricultural University. The pEASY-Blunt Zero Cloning Vector was purchased from Beijing TransGen Biotechnology Co., Ltd. BamHI, PstI, Sacl, Spel, and XbaI restriction endonucleases were all purchased from Cassin Biotech Co., Ltd.

[0033] Example 1: Plant Cultivation

[0034] After selecting alfalfa seeds, they were disinfected by soaking them in a 70% ethanol solution for 45 seconds, followed by rinsing five times with distilled water. Then, the seeds were disinfected again in a 10% sodium hypochlorite (NaClO) solution for 5 minutes, and rinsed five more times with distilled water. The sterilized seeds were spread on moistened filter paper in glass dishes, which were then placed in an incubator at 25°C and 60% relative humidity. After 5 days of moderate watering, the seedlings were transferred to plug trays containing vermiculite for further cultivation. The day / night temperatures in the plug tray greenhouse were set at 25°C and 20°C, with relative humidity of 70% and 50%, respectively. Nutrient solution was applied every two days. The cultivated plants were then used for subsequent experiments.

[0035] Example 2: Expression analysis of MfAP2-12 in different tissues of alfalfa

[0036] Using uniformly growing five-leaf alfalfa seedlings cultured for four weeks as material, tissue samples were taken from the roots, stems, and leaves of the seedlings. The seedlings were divided into five groups, each subjected to low-temperature stress treatment. The low-temperature stress treatment was carried out at 4℃ in a light incubator. Samples from each treatment were stored in an ultra-low temperature freezer at -80℃ for subsequent experiments.

[0037] qRT-PCR method: RNA was extracted from alfalfa and reverse transcribed into cDNA. PCR amplification and electrophoresis verification were performed, and the verified cDNA was diluted. The internal reference gene MfActin was used to quantify transcription factors in the samples. Primer design for transcription factors and the internal reference gene is shown in Table 1, and the qRT-PCR reaction system is shown in Table 2. The relative expression level of the MfAP2-12 gene was calculated using the relative quantification formula (2-ΔΔCt).

[0038] Table 1 Primer sequences (Attached tab.1)

[0039]

[0040] Table 2. qRT-PCR Reaction System

[0041]

[0042] The reaction procedure is as follows:

[0043]

[0044] Results analysis:

[0045] like Figure 1 The MfAP2-12 gene was highly expressed in all tissues, and under 4°C low-temperature stress, MfAP2-12 was downregulated in all tissues, suggesting that the MfAP2-12 gene may be regulated in all tissues of alfalfa.

[0046] Example 3: MfAP2-12 gene

[0047] Total RNA was extracted from normally growing alfalfa plants, and its concentration was determined. The integrity of the RNA was verified by electrophoresis, and the RNA was stored at -80℃ for downstream experiments. The RNA was reverse transcribed into cDNA using the HiScript II Reverse Transcriptase kit (Vazyme, China). The reaction system is shown in Table 3.

[0048] Table 3. Reverse transcription system

[0049]

[0050] The reverse transcription procedure is as follows:

[0051]

[0052] Specific primers for the alfalfa MfAP2-12 gene were designed (Table 4). PCR amplification was performed using extracted alfalfa cDNA as a template, employing a Taq Mix reaction system (Table 5). PCR was performed again using the Max MasterMix high-fidelity enzyme. The high-fidelity PCR reaction system is detailed in Table 6. The PCR products were subjected to 1% agarose gel electrophoresis, followed by gel recovery using a kit. The concentration of the recovered products was measured, and the products were stored at -20°C.

[0053] Table 4 Primer sequences

[0054]

[0055]

[0056] Table 5. Taq enzyme PCR reaction system

[0057]

[0058] The Taq enzyme PCR reaction procedure is as follows:

[0059]

[0060] Table 6. High-fidelity PCR reaction system.

[0061]

[0062] The high-fidelity PCR reaction procedure is as follows:

[0063]

[0064] Based on the results, we can conclude that:

[0065] Total RNA was extracted from alfalfa seedlings, and electrophoresis results showed that the extracted total RNA met the experimental requirements. Figure 2 A). After reverse transcription of RNA using a reverse transcription kit, cDNA quality was assessed using the MfActin gene as an internal reference primer, yielding uniform bands. Figure 2 B). Gene-specific primers (F / R) were designed using the alfalfa transcript sequence as a template. The reversed alfalfa DNA was successfully amplified by PCR to obtain the CDS sequence of MfAP2-12 from alfalfa, named MfAP2-12. Agarose gel electrophoresis was then performed to verify the DNA quality. Figure 2 C).

[0066] The total length of MfAP2-12 is 1,779 bp, and its nucleotide sequence is shown in Sequence 1. Protparam analysis showed that the protein encoded by MfAP2-12 contains 20 basic amino acids, with Ala (7.4%) being the most abundant and Trp (0.7%) being the least abundant. It contains 71 positively charged amino acid residues (Arg, Lys) and 88 negatively charged amino acid residues (Asp, Glu). The molecular formula of MfAP2-12 is C1. 2789 H 4452 N 816 O 943 S 23 It has a molecular weight of 65.24 kDa, a theoretical isoelectric point of 5.43, an extinction coefficient of 42,860-43,235, and an instability coefficient of 54.31, classifying it as an unstable protein. Its lipid coefficient is 64.94, and its average hydrophilicity coefficient is -0.775, classifying it as a hydrophilic protein.

[0067] Sequence 1:

[0068] The nucleotide sequence of the gene MfAP2-12 is as follows:

[0069] ATGAGTGAAGATCCGCTTTGGAAGACAATGGAGGATGTCTCTGCACCT

[0070] AACATGCCGGTCCATGCTAGTCTTGAAAATGGAGGTTCTGAGTCGAAAGAG

[0071] ACGATTCCCCATGTTTCTGATGCTCTCTTCAACTTGCCAAATGAAGACGAGC

[0072] TTCTGTTTGTGAATATAGACAAGAAAGACGAGACTGCAGTGAAAAAACAG

[0073] TCTGATGCGAATGTTGATTCCATTCTTTTGCGTTCTTCTTGTGACATTCAAGG

[0074] TGAGGATATGTCTGTTGTTGGTGAGTCTCAGAAGTTGGTTGCAGAAACACG

[0075] ACTTTCTATGGCAAATGGTCCGTCTGCTGAGTTAGAGGTTGTTGCTGACTCG

[0076] CCGGCTAGCAGTCATGGGGATTCCGGTTTTGTTGCTGATTGTGGAAATGAA

[0077] GTCCAATCATCTGGTGCTGCGCATGGTTCTCACCCTAAGCCTGCTAATGAAT

[0078] TTAGGGTCTGTTCATTGAACACTGAAGATAGTGTCCCATCCCCGACCGATGG

[0079] CATTGATGATGTAAACGAATCCACTGTAGTTCCTAATTCTGTGAACGTATCTG

[0080] CTGTAGTAGTTCCTAATTCTGCGACTCCGAAACCCATATCAATTGTTAAAGA

[0081] GGTGGGTTATCCAGATTCCTCCATCAGTAATAAAAAAAGAAATGAACCAGAT

[0082] AGAAGTTCGAAATCAAGCAAGGTTCATGCTGCTGCTGTAAAGAAAAGAAA

[0083] AGACATTCCTTCGAACTCTTCCGCGGCTTTGCAGTCAGATCAACCAGGATT

[0084] AGTGCCTAATATAAGCAAGGAAAACCCTGTTGCTGCTGTACCGAAAACTGA

[0085] AAATCCCCCAAAGAATTTGATTTCTGCAGTTTCTAGACAGAGTAACAATTTC

[0086] ATTGCCAATACCAATCAAAGTCAAAGCAGATTAGTTCATGCAACTATGAAGC

[0087] ATGCCTCATATGGACAACCAACACAAGAGGTAATTGTTGCTCTGCCTTCACC

[0088] TGGCAATACAGATCCAAAGAAAGAGGAACATAAGACTTTACCTGATTCAGA

[0089] AGCAAAATTATGCATCAATCAGGAAATAGGCGATGATGATGATGATGATGAG

[0090] AGTGATGATGAGAAAGAGATTCCTTACTTTTCTGATGTTGAGGGAATGATTC

[0091] TTGAAATGGACTTAGGTCCAACCGATCAAGATACTGATGCAAGTACCGAAG

[0092] TTTCGAGATTCCAAACAAAGAAACTAAGAGGACCATCATAAGATTGGAGC

[0093] AATCTTCTCAGGCCATGACGCGAAGAGCCATGGATTCTTGCGGTGCACTTG

[0094] CAGTATTGTATGGGCGCACTATGAAGGATATATTATACAACCCAAGAATATG

[0095] TCATCTGCTGTTGTTGAAAATTCTGTTGCTATGGATACAAAGAAAAGAGGA

[0096] AGTGAAAAATTTGAGCAGAAGCAAATTGTTCATAGGAAATCTATTGATACTT

[0097] TTGGTCAAAGAACCTCTCAATATAGAGGTGTAACAAGGCATAGATGGACTG

[0098] GCAGATATGAAGCTCATCTATGGGACAACAGTTGCAAGAAAGAAGGCCAA

[0099] AGCAGAAAAGGAAGACAAGTTTATCTTGGGGGTTATGATATGGAAGAAAA

[0100] AGCTGCTAGAGCTTATGATCAAGCAGCACTCAAGTATTGGGGACCATCCAC

[0101] TCACATAAACTTCCCTTTGGAAAATTATCAAAATCAACTTGAGGAAATGAA

[0102] GAATATGACAAGACAGGAATATGTTGCTCATTTAAGAAGAAAAAGCAGTGG

[0103] ATTCTCAAGAGGGCTTCCATGTACAGAGGAGTAA

[0104] The secondary structure of the MfAP2-12 protein was predicted using SOPMA. The prediction results showed that the MfAP2-12 protein contains 174 α-helices (29.38%), 33 β-sheets (5.56%), 103 extended strands (17.37%), and 283 random coils (47.72%). The three-dimensional structure of the protein was predicted using SWISS-MODEL. Figure 3 ).

[0105] Genomic DNA was extracted from alfalfa according to the requirements of the DNA extraction kit. Figure 4 A). Based on the obtained cDNA fragment, three specific primers SP1, SP2, and SP3 were designed upstream. Using alfalfa genomic DNA as a template, three walking reactions were performed using a chromosome walking kit. Figure 4 B). The products from the latter two processes were recovered by gel extraction, transformed into the T vector, and then into DH5α competent cells. Colony PCR was performed to identify the cells, and positive clones were selected for sequencing. The obtained sequences were aligned and assembled to yield a sequence length of 759 bp.

[0106] After sequence alignment of the chromosome walking results, the optimal sequence was selected to design promoter cloning primers. Using alfalfa genomic DNA as a template, a 759 bp promoter sequence was cloned. The promoter sequence was analyzed using the online software PlantCARE. Figure 5 The MfAP2-12 promoter sequence contains five light-responsive elements, including Box II, GA-motif, GATA-motif, GT1-motif, and I-box; two gibberellin-responsive elements (ABRE and ABRE2); one AT-TATA-box element involved in the jasmonic acid cycle response; one MYB binding site (MYB recognition site); one MYB-related element; one cell cycle regulatory element (MSA-like); and eight TATA-boxes and five CAAT-boxes.

[0107] Example 4: Construction of overexpression and transient expression vectors

[0108] Primers for transient and overexpression were designed, with the transient expression primers lacking a stop codon at the R end. The vector plasmid was extracted using a plasmid extraction kit as a template. PCR amplification was performed using one-step cloning-specific primers for both TE and OE expression vectors. The reaction system in Table 7 was used, and the PCR amplification process was identical to that of high-fidelity PCR. The amplified products were detected by 1% agarose gel electrophoresis, and the insert fragment was obtained and its concentration determined before storage at -20°C.

[0109] Table 7 One-step cloning PCR reaction system

[0110]

[0111] After overnight culture of *E. coli* containing the target vector at 37°C and 180 rpm, plasmid was extracted. Using the enzyme digestion system shown in Table 8, the digestion reaction was carried out at 37°C for 4 h. After the reaction was terminated, 7 μL of loading buffer was added. The target long fragment was recovered after electrophoresis detection, and a one-step cloning of the recombinant plasmid was performed. The reaction system is shown in Table 9. The reaction was carried out at 37°C for 30 min, followed by cooling on ice for 5 min. 5 μL of the product was transformed into Trans1-T1 competent cells. Single clones of *E. coli* were selected for PCR and electrophoresis detection. After alignment, the plasmid was extracted and transformed into *Agrobacterium* competent cells. The bacterial culture was evenly spread on YEB plates containing 50 μg / mL kanamycin and 20 μg / mL rifampin, and incubated upside down for 48 h. Single clones were selected, and the cells were then shaken for another 60 h. After PCR detection, the cells were stored at -80°C with glycerol for later use.

[0112] Table 8 Enzyme digestion system

[0113]

[0114] Table 9 Recombination reaction system

[0115]

[0116] After constructing overexpression and transient expression vectors, the pCAMBIA1300 vector was digested with BamH1 and SacI restriction endonucleases. The resulting vector fragments were recovered and purified by electrophoresis and gel extraction. Subsequently, transient expression was performed using the one-step cloning primer MfAP2-12-TE-F / R, and the MfAP2-12 insert was recombined with the linearized vector. The recombinant vector was transformed into a T vector and then into DH5 competent cells. After obtaining the bacterial culture, PCR identification of the MfAP2-12 gene fragment was performed. Figure 6 After successful recombination was verified by agarose gel electrophoresis, the next step of the experiment was carried out.

[0117] A MfAP2-12-GFP fusion vector was constructed from the transient expression vector pCAMBIA1300. This vector was then transformed into *Nicotiana benthamiana* via Agrobacterium-mediated transformation. Fluorescence imaging of GFP in tobacco leaves was observed using a laser confocal microscope. Observation and photographic analysis confirmed that the MfAP2-12 gene is located in the cell nucleus. Figure 7 ).

[0118] Example 5: Validation of transgenic Arabidopsis thaliana

[0119] Based on the mutant information (SALK_058441C) published on TAIR (https: / / www.arabidopsis.org / ), mutant seeds were purchased from the AraShare scientific website for cultivation and subculturing to the T3 generation. The three-primer method was used for identification. Three specific primers, AP2-12-LP, AP2-12-RP, and AP2-12-BP (Table 4), were designed for PCR. The reaction was performed using the aforementioned Taq enzyme procedure and system (Table 5) for mutant screening. PCR verification of the AP2-12 mutant Arabidopsis thaliana yielded the following results: Figure 8 As shown, WT is a large fragment of wild type around 900bp, while HM1 and HM2 have obvious single small fragment bands around 500bp. Therefore, we determined that the mutant Arabidopsis strain is homozygous, and all mutants used in subsequent studies were from this strain.

[0120] Simultaneously, the pMDC123 expression vector was double-digested using SpeI and XbaI. Figure 9 A) The target fragment and the vector fragment were used to construct the overexpression vector pMDC123-35S-MfAP2-12 using the one-step cloning primer MfAP2-12-OE-F / R. Successful recombination was confirmed by PCR and agarose gel electrophoresis. Figure 9 B). Simultaneously, preliminary experiments determined that the optimal concentration of Basta herbicide for screening Arabidopsis thaliana in the culture medium was 20 mg / L. Wild-type, overexpressed, complementary, and mutant plants were screened for Basta herbicide. Figure 10Significant changes were observed 8 days after sowing. Wild-type Arabidopsis thaliana ( Figure 10 C) and mutant Arabidopsis thaliana ( Figure 10 D) All were withered and dying, while Arabidopsis thaliana overexpressed ( Figure 10 A) and complementary strains ( Figure 10 B) All are growing well and can be used for subsequent experiments.

[0121] The results obtained after quantitative detection of the expression of MfAP2-12 in the T3 generation transgenic Arabidopsis thaliana were obtained by Figure 11 Quantitative analysis of WT, overexpressing, mutant, and complementary Arabidopsis thaliana lines revealed that the expression level of MfAP2-12 in the overexpressing line was significantly higher than that in the WT line (P < 0.001), more than five times that of WT. The expression level of MfAP2-12 in the complementary line was significantly higher than that in WT. The expression level of the ap2-12 mutant was 4.21% of that in WT.

[0122] Example 6:

[0123] Based on Example 5, WT, overexpression, mutant, and complementary Arabidopsis seedlings were constructed. Plants with consistent growth after 22 days of culture were subjected to 4℃ stress for 6 hours, while Arabidopsis seedlings grown at room temperature served as controls. Leaves from each treatment were collected and stored at -80℃ for subsequent physiological index determination (resistance physiological indicators were measured using an ELISA reader and spectrophotometer; detailed methods can be found in the kit instructions from Suzhou Keming Biotechnology Co., Ltd.).

[0124] The results are as follows:

[0125] 1. Changes in MDA content in transgenic Arabidopsis thaliana under low-temperature stress

[0126] Depend on Figure 12 As shown in Figure A, at room temperature, overexpression of MfAP2-12 significantly increased the MDA content in Arabidopsis thaliana. The MDA content in both the overexpressing and complementary lines was significantly higher than that in the wild-type and mutant lines. The overexpressing line had the highest MDA content, at 1.22 nmol·g⁻¹. -1 The FW strain had 2.98 times the MDA content of the wild type; the complementary strain had the second highest MDA content at 1.08 nmol·g⁻¹. -1 The FW mutant was 2.65 times that of the wild type; the mutant had the lowest MDA content, at 0.11 nmol·g⁻¹. -1 FW (Farmer's Weakness) accounts for 27.41% of the wild-type.

[0127] Under 4℃ low-temperature stress, the MDA content increased in all strains. The MDA content was highest in the MfAP2-12 overexpression strain, reaching 2.46 nmol·g. -1FW was 2.01 times, 1.73 times, and 2.88 times that of wild-type, complementary, and mutant lines, respectively.

[0128] 2. Transgenic Arabidopsis thaliana under low temperature stress and O2· - Changes in content

[0129] Depend on Figure 12 As shown in B, overexpression of MfAP2-12 can significantly reduce O2· in transgenic plants. - Content. At room temperature, the O2·- content of the MfAP2-12 overexpression line was 46.69 nmol·g. -1 FW, respectively, represents 61.52% of the wild type, 51.12% of the complementary line, and 78.55% of the mutant line.

[0130] Under 4℃ low temperature stress, the O2· - The contents of all increased. Although the MfAP2-12 overexpression strain O2· - The increase in content was higher than that of other strains, but its O2· - The content was still significantly lower than that of the wild type and complementary lines, at 74.88 nmol·g. - 1 The fractional oxidase (FW) content was 84.24% and 69.40% of that in the wild-type and complementary lines, respectively. The mutant line had the lowest O2·- content, at 63.45 nmol·g. -1 FW.

[0131] 3. Changes in SOD activity in transgenic Arabidopsis thaliana under low-temperature stress

[0132] Depend on Figure 12 As shown in Figure C, at room temperature, overexpression of MfAP2-12 significantly increased SOD activity in Arabidopsis thaliana. The SOD activity of both the MfAP2-12 overexpressing and complementary lines was higher than that of the wild type, with the SOD activity in the overexpressing lines reaching 58.01 U·g. -1 The FW strain showed 1.22 times the activity of the wild type; the complementary strain had an SOD activity of 61.17 U·g. -1 The FW strain showed 1.29 times the activity of the wild type; the SOD activity of the mutant strain was significantly lower than that of other strains, at 30.78 U·g. -1 FW represents 64.92% of the wild-type strain.

[0133] Under 4℃ low-temperature stress, the SOD activity of wild-type, complementary, and mutant lines all increased. Only the SOD activity of the MfAP2-12 overexpression line decreased to 49.93 U·g. -1 FW represents 97.99% and 57.48% of the wild-type and complementary lines, respectively. The mutant line has the lowest SOD activity, at 47.75 U·g. -1 FW.

[0134] 4. Changes in POD activity in transgenic Arabidopsis thaliana under low-temperature stress

[0135] Depend on Figure 12 As shown in Figure D, under normal temperature, overexpression of MfAP2-12 significantly reduced the POD activity of Arabidopsis thaliana plants. The POD activity of the overexpressing lines was 1,116.73 U·g. -1 FW was 89.71% of the wild type; the complementary line had significantly higher POD activity than other lines, at 2,308.20 U·g. -1 The FW mutant was 1.85 times that of the wild type; the POD activity of the mutant line was 1,281.59 U·g. -1 FW is 1.03 times that of wild type.

[0136] Under 4℃ low-temperature stress, the POD activity of wild-type, overexpressing, and mutant lines all increased. The POD activity of the overexpressing line reached 1,389.31 U·g. -1 The FW strain was 1.02 times that of the wild type; the mutant line had a POD activity of 1,642.69 U·g. -1 The FW strain was 1.21 times that of the wild type; although the POD activity of the complementary strain decreased, it was still higher than that of other strains at 1,696.80 U·g. -1 FW is 1.25 times that of wild type.

[0137] 5. Changes in CAT activity in transgenic Arabidopsis thaliana under low-temperature stress

[0138] Depend on Figure 13 A indicates that, at room temperature, the CAT activity of the MfAP2-12 overexpression line is 83.06 μmol·min⁻¹. -1 ·g -1 FW is 99.50% of the wild type; the complementary line has a higher CAT activity of 86.14 μmol·min⁻¹. -1 ·g -1 FW was 1.03 times that of the wild type; the CAT activity of the mutant line was significantly lower than that of the other three lines by 70.40 μmol·min⁻¹. -1 ·g -1 FW, which is 84.32% wild type.

[0139] Under low temperature stress of 4℃, the CAT activity of all strains increased significantly, with the overexpression strain reaching 85.86 μmol·min⁻¹. -1 ·g -1 FW was 97.86% of the wild type; the complementary line's CAT activity was still higher than the other three lines by 96.34 μmol·min. -1 ·g -1The FW level was 1.10 times that of the WT level; the mutant line showed a significant increase in CAT activity compared to the normal temperature level, but it was still lower than the wild type at 87.49 μmol·min⁻¹. -1 ·g-1FW, which is 99.71% of the wild type.

[0140] 6. Changes in soluble protein content in transgenic Arabidopsis thaliana under low-temperature stress

[0141] Depend on Figure 13 As shown in Figure B, overexpression of MfAP2-12 significantly increased the soluble protein content in Arabidopsis thaliana, with the overexpressing line exhibiting a significantly higher soluble protein content than the other three lines, reaching 18.87 mg / g. -1 The FW strain had 1.35 times the soluble protein content of the wild-type strain; the complementary strain had a soluble protein content of 13.78 mg / g. -1 FW is 98.24% of the wild type; the soluble protein content of the mutant line is 15.58 mg / g. -1 FW is 1.11 times that of the wild-type strain.

[0142] Under 4℃ low-temperature stress, the soluble protein content of wild-type, overexpressed, and mutant lines was significantly increased. The overexpressed line remained higher than the other three lines, reaching 22.33 mg / g. -1 The FW strain had 1.15 times the soluble protein content of the wild-type strain; the complementary strain had a soluble protein content of 13.35 mg / g. -1 FW represents 68.81% of the wild type; the soluble protein content of the mutant line is 20.80 mg / g. -1 FW is 1.07 times that of the wild-type strain.

[0143] 7. Changes in proline content in transgenic Arabidopsis thaliana under low-temperature stress

[0144] Depend on Figure 13 As shown in Figure C, the proline content in Arabidopsis thaliana overexpressing MfAP2-12 was significantly increased. At room temperature, the proline content in the overexpression line was relatively higher at 24.86 μg·g⁻¹. -1 FW was 1.33 times that of the wild type; the proline content of the complementary line was 20.76 μg·g. -1 FW was 1.11 times that of the wild type; the mutant line was 20.44 μg·g -1 FW is 1.09 times that of wild type, slightly higher than wild type.

[0145] Under 4℃ low-temperature stress, the proline content in wild-type, overexpressed, and mutant lines increased significantly, reaching 39.25 μg·g in the overexpressed line. -1 FW was 1.76 times that of the wild type; the mutant line had a strength of 24.13 μg·g⁻¹. -1The FW strain was 1.08 times that of the wild type, slightly higher than the wild type. The complementary strain remained essentially unchanged at 21.23 μg·g⁻¹ relative to normal temperature. -1 FW represents 95.16% of the wild type. In summary, the MfAP2-12 gene may have a significant positive regulation of proline, while potentially exhibiting negative regulation of soluble proteins to cope with plant abiotic stress.

[0146] 8. Changes in hydrogen peroxide content in transgenic Arabidopsis thaliana under low-temperature stress

[0147] Depend on Figure 13 As shown in D, MfAP2-12 overexpression significantly increased the hydrogen peroxide content in Arabidopsis thaliana. At room temperature, the hydrogen peroxide content in the MfAP2-12 overexpressing and complementary lines was 3.90 μmol·g⁻¹. -1 FW, 3.92 μmol·g -1 The hydrogen peroxide content in the mutant was 1.20 times that of the wild type. The mutant had the highest hydrogen peroxide content at 4.34 μmol·g⁻¹. -1 FW is 1.33 times that of wild type.

[0148] Under 4℃ low-temperature stress, the hydrogen peroxide content increased in wild-type, MfAP2-12 overexpressing, and complementary lines. The hydrogen peroxide content in the MfAP2-12 overexpressing line was 4.13 μmol·g⁻¹. -1 The FW strain was 1.14 times that of the wild type; the hydrogen peroxide content in the complementary strain was significantly increased to 4.46 μmol·g⁻¹. -1 The FW strain had a hydrogen peroxide content 1.28 times higher than the wild type; while the mutant strain had a hydrogen peroxide content reduced to 4.24 μmol·g⁻¹. -1 The FW (free-flop) form is 1.17 times more potent than the wild-type. It is speculated that the deletion of the MfAP2-12 gene reduces hydrogen peroxide production, thereby enhancing antioxidant capacity.

[0149] Example 7:

[0150] Based on Example 6, stress response gene expression analysis was further performed on Arabidopsis thaliana.

[0151] The expression of MfAP2-12 and eight stress-response genes in transgenic Arabidopsis thaliana under low-temperature stress was detected by qRT-PCR. The specific functions of the stress-response genes are shown in Table 10. Following the qRT-PCR method, AtActin2 was selected as an internal control gene for the quantitative detection of stress-response genes. Primer design is shown in Table 11.

[0152] Table 10 Summary of stress response genes

[0153]

[0154]

[0155] Table 11 Primer sequences

[0156]

[0157] Using wild-type, overexpressing, complementary, and mutant lines subjected to low-temperature stress as materials, eight stress-response genes were selected and their expression patterns under low-temperature stress were analyzed. The results are as follows:

[0158] 1. Quantitative expression of CAT1 in transgenic Arabidopsis thaliana under low temperature stress

[0159] Depend on Figure 14 As shown in Figure A, at room temperature, the expression level of the CAT1 gene in the MfAP2-12 overexpression line was 1.36, 2.51, and 4.61 times higher than that in the wild-type, complementary, and mutant lines, respectively. Under 4℃ low-temperature stress, the expression level of the CAT1 gene in the wild-type and complementary lines increased significantly, while the expression level of the overexpressed CAT1 gene decreased significantly. The mutant line showed no significant change, but its CAT1 gene expression level was significantly lower than that in the other three lines. The CAT1 gene expression level in the wild-type line was 5.70, 2.90, and 23.69 times higher than that in the overexpression, complementary, and mutant lines, respectively.

[0160] 2. Quantitative expression of SOD1 in transgenic Arabidopsis thaliana under low temperature stress

[0161] Depend on Figure 14 As shown in Figure B, at room temperature, the SOD1 gene expression level in the MfAP2-12 overexpression line was higher than that in other lines (P<0.05), being 1.30, 1.81, and 1.55 times higher than that in the wild-type, complementary, and mutant lines, respectively. Under low-temperature stress, the SOD1 gene expression level in the wild-type, overexpression, and complementary lines increased significantly, while the SOD1 gene expression level in the mutant line decreased, but the change was not significant compared to that at room temperature. The wild-type SOD1 gene expression level was significantly higher than that in other lines, being 1.23, 2.23, and 4.04 times higher than that in the overexpression, complementary, and mutant lines, respectively.

[0162] 3. Quantitative expression of ICE1 in transgenic Arabidopsis thaliana under low temperature stress

[0163] Depend on Figure 14As shown in Figure C, at room temperature, the expression level of the ICE1 gene in the wild-type strain was slightly higher than that in other strains, while the expression level in the mutant strain was the lowest, at 64.58% of that in the wild-type strain. Under low-temperature stress, the expression levels of the ICE1 gene in the wild-type, overexpression, and complementary strains increased significantly, while the expression level of the ICE1 gene in the mutant strain showed no significant change. The highest expression level of the wild-type ICE1 gene was 1.45, 1.66, and 3.85 times that of the overexpression, complementary, and mutant strains, respectively.

[0164] 4. Quantitative expression of CBF1 in transgenic Arabidopsis thaliana under low temperature stress

[0165] Depend on Figure 14 As shown in Figure D, at room temperature, the CBF1 expression level in the MfAP2-12 overexpression line was significantly higher than that in the other three lines (P<0.05), being 2.61, 12.12, and 6.47 times higher than that in the WT, complementary, and mutant lines, respectively. The CBF1 expression level in the complementary line was significantly lower than that in the other lines. After low-temperature stress, except for the ap2-12 mutant line, the CBF1 expression level increased in all three lines. The wild-type CBF1 expression level increased significantly and was higher than that in the other three lines (P<0.05), being 1.06, 2.93, and 10.49 times higher than that in the overexpression, complementary, and mutant lines, respectively. The complementary line showed the largest increase in CBF1 expression level compared to room temperature, while the mutant line showed no significant change.

[0166] 5. Quantitative expression of COR47 in transgenic Arabidopsis thaliana under low temperature stress

[0167] Depend on Figure 15 As shown in Figure A, at room temperature, the COR47 gene expression level in the MfAP2-12 overexpression line was higher than that in the other three lines, being 1.91, 2.32, and 2.77 times higher than that in the wild-type, complementary, and mutant lines, respectively. After low-temperature stress, the COR47 gene expression level in all lines increased compared to room temperature. The COR7 gene expression level in the wild-type, overexpression, and complementary lines increased significantly, reaching 25.18 times that at room temperature in the wild-type, and 1.23, 1.97, and 18.35 times that in the overexpression, complementary, and mutant lines, respectively. The expression levels in the overexpression and mutant lines were 10.66 and 15.49 times that at room temperature, respectively, while the expression level in the mutant did not increase significantly compared to room temperature.

[0168] 6. Quantitative expression of CAS1 in transgenic Arabidopsis thaliana under low temperature stress

[0169] Depend on Figure 15As shown in Figure B, at room temperature, the CAS1 gene expression level in the MfAP2-12 overexpression line was higher than that in the other three lines, being 1.67, 2.09, and 2.92 times higher than that in the wild-type, complementary, and mutant lines, respectively. After low-temperature stress, except for the mutant line, the CAS1 gene expression level in all other lines increased compared to room temperature, with significant increases in the wild-type and complementary lines. However, the CAS1 gene expression level in the overexpression line was still higher than that in the other lines, being 1.02, 1.18, and 4.20 times higher than that in the wild-type, complementary, and mutant lines, respectively. The expression level in the mutant line did not change significantly compared to room temperature.

[0170] 7. Quantitative expression of TIP2 in transgenic Arabidopsis thaliana under low temperature stress

[0171] Depend on Figure 15 As shown in Figure C, at room temperature, the expression level of the TIP2 gene in the wild-type line was higher than that in the other three lines, being 1.19, 2.14, and 3.62 times higher, respectively, than that in the overexpression line, the complementary line, and the mutant line. After low-temperature stress, only the TIP2 gene expression level in the complementary line significantly increased compared to room temperature, reaching 1.43 times that at room temperature. The TIP2 gene expression levels in the other three lines all decreased, with the wild-type TIP2 gene expression level being significantly lower than that in the overexpression line, reaching 79.67% of the overexpression line's expression level.

[0172] 8. Quantitative expression of PIP1 in transgenic Arabidopsis thaliana under low temperature stress

[0173] Depend on Figure 15 As shown in D, at room temperature, the expression level of the PIP1 gene in the mutant line was significantly higher than that in the other three lines, being 2.70, 2.99, and 1.77 times higher, respectively, than that in the wild-type, overexpression, and mutant lines. After low-temperature stress, the expression levels of the PIP1 gene in the wild-type and overexpression lines increased significantly, while the expression level in the complementary line did not change significantly, and the expression level of the PIP1 gene in the mutant line decreased sharply. The wild-type PIP1 gene expression level was the highest, being 1.88, 1.80, and 3.99 times higher, respectively, than that in the overexpression, complementary, and mutant lines.

[0174] Based on the above conclusions, we can conclude that:

[0175] 1. MfAP2-12 was downregulated in the leaves and roots of alfalfa under low-temperature stress. The transient expression vector MfAP2-12-GFP was successfully constructed, and transient expression of MfAP2-12 was performed using tobacco leaf cells. The results showed that the subcellular localization of the MfAP2-12 gene was located in the cell nucleus.

[0176] 2. The overexpression vector pMDC123-35S-MfAP2-12 was constructed and genetically transformed into Arabidopsis thaliana WT and ap2-12 mutants using Agrobacterium to obtain MfAP2-12 overexpressing and complementary lines. Physiological index analysis showed that under 4℃ stress, MfAP2-12 overexpression reduced SOD activity and O2·- content, significantly increased MDA, soluble protein, and proline content, but H2O2, POD, and CAT showed no significant changes. In the study, under 4℃ low-temperature stress, the SOD activity of the MfAP2-12 overexpressing lines was lower than that of the wild-type lines and lower than that of the wild-type lines, while the POD and CAT activities showed no significant changes. These results indicate that the MfAP2-12 gene may negatively regulate SOD and CAT activities, while the POD activity did not change significantly, which may mediate the regulation of their activities to achieve the plant's homeostasis.

[0177] 3. By analyzing the expression patterns of eight stress response genes, including ICE1, CBF1, COR47, CAS1, TIP2, PIP1, CAT1 and SOD1, under low temperature stress, it was found that overexpression of MfAP2-12 can induce downregulation of CAT1, SOD1, ICE1, COR47 and PIP1.

[0178] In summary, MfAP2-12 can reduce O2· - The study found that the alfalfa's low-temperature tolerance was influenced by increasing the content of soluble protein and proline, maintaining redox and osmotic balance within the plant, and negatively regulating the expression levels of CAT1, SOD1, ICE1, COR47, and PIP1. These results provide new negative regulatory genes for cold-resistant breeding of alfalfa and enrich the research on the molecular mechanism of alfalfa's resistance to low temperatures.

[0179] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. An application of the alfalfa gene MfAP2-12, characterized in that, The nucleotide sequence of the MfAP2-12 gene is shown in Sequence 1. The application of knocking out or silencing the MfAP2-12 gene in improving the low-temperature resistance of alfalfa, wherein the plant is Arabidopsis thaliana.

Images