Use of active peptide composition in the preparation of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells

CN118750576BActive Publication Date: 2026-08-11北京易优联科技有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-19
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

然而,脐带造血干细胞的增殖能力有限,一定程度上制约了其在临床上的应用范围

Benefits of technology

[0019]This invention provides the application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells. This composition does not contain animal serum, reducing allergic reactions caused by allogeneic serum. The MOTS-c peptide and thymic peptide in the active peptide composition work synergistically to promote the growth of umbilical cord hematopoietic stem cells and enhance their proliferative activity. Simultaneously, it exhibits good biocompatibility and high safety, making it suitable for clinical treatment. It has key theoretical guiding significance and practical application value for promoting the in vitro expansion capacity of umbilical cord hematopoietic stem cells, contributing to the development of umbilical cord blood stem cells in the biological field.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118750576B_ABST
    Figure CN118750576B_ABST
Patent Text Reader

Abstract

This invention relates to the field of biology, and more particularly to the application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells. The active peptide composition comprises MOTS-c polypeptide and thymopentin. The MOTS-c polypeptide and thymopentin in this composition exert a synergistic effect, promoting the growth of umbilical cord hematopoietic stem cells and enhancing their proliferative activity. Simultaneously, it exhibits good biocompatibility and high safety, making it suitable for clinical treatment. This invention has key theoretical guiding significance and practical application value for promoting the in vitro expansion capacity of umbilical cord hematopoietic stem cells, and contributes to the development of umbilical cord blood stem cells in the biological field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biology, and more particularly to the use of active peptide compositions in the preparation of drugs that promote the proliferation of umbilical cord hematopoietic stem cells. Background Technology

[0002] With the rapid development of cell technology, hematopoietic stem cells have shown broad application prospects in the treatment of various diseases. Hematopoietic stem cells are a special type of cell in the blood system that are relatively primitive and have the potential for self-renewal and multi-directional differentiation. They play a vital role in maintaining the homeostasis of the human blood system, repairing damaged tissues, and treating various diseases, and are one of the most promising cell types in the medical field.

[0003] Umbilical cord hematopoietic stem cells have the advantage of convenient collection. Compared to bone marrow and peripheral blood hematopoietic stem cells, the collection process is simpler and safer, with no interference to the mother or infant. Furthermore, umbilical cord hematopoietic stem cells have low immunogenicity, significantly reducing immune rejection during transplantation, resulting in no side effects and a high success rate. Umbilical cord hematopoietic stem cells can differentiate not only into red blood cells, white blood cells, and platelets in the blood system, but also into other tissue cells such as cardiomyocytes and nerve cells. Umbilical cord blood hematopoietic stem cells possess strong regenerative and repair capabilities, making them a promising candidate for treating various diseases and offering new technological approaches for the treatment of hematological disorders, tissue repair, and regeneration.

[0004] In clinical applications, for example, in the treatment of hematologic malignancies such as leukemia, hematopoietic stem cell transplantation can replace the damaged hematopoietic system in patients, restoring normal hematopoietic function. Furthermore, hematopoietic stem cell transplantation can promote the regeneration of cardiomyocytes and improve cardiac function. Most importantly, hematopoietic stem cells can also be used for the repair of the nervous system, playing a significant role in the treatment of diseases such as brain injury and spinal cord injury.

[0005] With the continuous development of umbilical cord hematopoietic stem cells in clinical applications, the demand for drugs to promote their proliferation is becoming increasingly urgent. However, the limited proliferative capacity of umbilical cord hematopoietic stem cells restricts their clinical application to some extent. Furthermore, research on some drug compositions and culture media for umbilical cord hematopoietic stem cell proliferation is still in its early stages, and most suffer from poor proliferation effects and significant side effects.

[0006] Therefore, there is an urgent need and broad application prospects for developing a highly efficient and safe drug to promote the proliferation of umbilical cord hematopoietic stem cells, which is of great significance for promoting the progress of umbilical cord hematopoietic stem cells in the biological field. Summary of the Invention

[0007] To overcome the shortcomings of existing technologies, the present invention aims to provide the application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells. This active peptide composition can effectively enhance the in vitro expansion capacity of umbilical cord hematopoietic stem cells.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] The application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells, wherein the active peptides are MOTS-c polypeptide and thymopentin.

[0010] Furthermore, the amino acid sequence of the MOTS-c polypeptide is shown in SEQ ID NO: 1:

[0011] Met-Arg-Trp-Gln-Glu-Met-Gly-Tyr-Ile-Phe-Tyr-Pro-Arg-Lys-Leu-Arg,

[0012] The amino acid sequence of the thymopentin is shown in SEQ ID NO: 2: Arg-Lys-Asp-Val-Tyr.

[0013] Furthermore, umbilical cord hematopoietic stem cells were seeded into a culture medium supplemented with MOTS-c peptide and thymopentin for expansion culture.

[0014] Furthermore, the concentration of the MOTS-c polypeptide in the culture medium is 60-105 μg / mL, and the concentration of the thymopentin in the culture medium is 4-8 μg / mL.

[0015] Furthermore, the culture medium is AIM-V medium, which also contains 5-20 ng / mL IL-3, 1-5% FBS, 1-3% penicillin, and 1-3% streptomycin.

[0016] Furthermore, the seeding density of the umbilical cord hematopoietic stem cells is 1-3 × 10⁻⁶. 4 per mL.

[0017] Furthermore, the culture conditions are 37°C and 5% CO2.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] This invention provides the application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells. This composition does not contain animal serum, reducing allergic reactions caused by allogeneic serum. The MOTS-c peptide and thymic peptide in the active peptide composition work synergistically to promote the growth of umbilical cord hematopoietic stem cells and enhance their proliferative activity. Simultaneously, it exhibits good biocompatibility and high safety, making it suitable for clinical treatment. It has key theoretical guiding significance and practical application value for promoting the in vitro expansion capacity of umbilical cord hematopoietic stem cells, contributing to the development of umbilical cord blood stem cells in the biological field. Attached Figure Description

[0020] Figure 1 This image shows the growth morphology of umbilical cord hematopoietic stem cells after treatment with an active peptide composition.

[0021] Figure 2 Figure showing the effect of treatment with active peptide composition on the expression level of proliferation genes in umbilical cord hematopoietic stem cells;

[0022] Figure 3 The figure shows the expression results of Ang1 protein in umbilical cord hematopoietic stem cells after treatment with the active peptide composition. Detailed Implementation

[0023] The present invention will now be further described with reference to the accompanying drawings and specific embodiments. It should be noted that, without conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments. Specific conditions not specified in the embodiments are performed according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all reagents or instruments used are conventional products obtained through commercial channels.

[0024] Example 1

[0025] CD34+ cells were sorted using immunomagnetic beads: Umbilical cord blood samples were collected, heparin was added as an anticoagulant, and the samples were diluted with an equal volume of PBS buffer. The diluted umbilical cord blood was slowly added to half a volume of Ficoll density gradient separation buffer, and centrifuged (2000 rpm, 15 min). The supernatant was then carefully aspirated, and the white membrane layer between the plasma layer and the Ficoll layer was identified as mononuclear cells. The cell suspension was collected in a new centrifuge tube, an equal volume of PBS buffer was added, and the mixture was gently mixed. The cells were centrifuged again (2000 rpm, 15 min), and the supernatant was aspirated. The cells were then resuspended in FcRIgG, MACS buffer, and anti-human CD34 magnetic bead antibody, mixed thoroughly, and incubated at 4°C in the dark for 30 min to allow the magnetic beads to specifically bind to the CD34 antigen on the cell surface. The cells were then washed three times with MACS buffer to remove cell debris. Then add MASC buffer, centrifuge at 1000 rpm for 10 min, discard the supernatant, resuspend in MASC buffer again, filter to obtain a single-cell suspension, place at 4℃, and then place the cell suspension in a magnetic separator through a separation column. After magnetic separation, collect the cells into centrifuge tubes, wash the magnetic beads and separated cells with PBS buffer and resuspend, collect the cell suspension and centrifuge at 1000 rpm for 10 min, discard the supernatant to obtain CD34+ cells for subsequent experiments.

[0026] Example 2

[0027] The application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells, wherein the active peptides are MOTS-c polypeptide and thymopentin. The amino acid sequence of the MOTS-c polypeptide is as follows:

[0028] Met-Arg-Trp-Gln-Glu-Met-Gly-Tyr-Ile-Phe-Tyr-Pro-Arg-Lys-Leu-Arg (SEQ ID NO: 1), the amino acid sequence of the thymopentin is: Arg-Lys-Asp-Val-Tyr (SEQ ID NO: 2).

[0029] The changes in the growth status of umbilical cord hematopoietic stem cells after treatment with the above-mentioned active peptide composition were detected: The umbilical cord hematopoietic stem cells isolated in Example 1 were resuspended in the culture medium of experimental groups 1-3 and control groups 1-3, and cultured at a ratio of 1×10⁻⁶. 4 Inoculate 1 / mL of the sample into 96-well plates and carry out proliferation culture according to the following grouping:

[0030] Experimental group 1: AIM-V medium containing 95 μg / mL MOTS-c peptide, 6 μg / mL thymopentin, 15 ng / mL IL-3, 1% FBS, 1% penicillin, and 1% streptomycin.

[0031] Experimental group 2: AIM-V medium containing 60 μg / mL MOTS-c polypeptide, 4 μg / mL thymopentin, 20 ng / mL IL-3, 5% FBS, 2% penicillin, and 2% streptomycin.

[0032] Experimental group 3: AIM-V medium containing 105 μg / mL MOTS-c polypeptide, 8 μg / mL thymopentin, 5 ng / mL IL-3, 3% FBS, 3% penicillin, and 3% streptomycin.

[0033] Control group 1: The only difference from experimental group 1 is that the MOTS-c peptide is omitted.

[0034] Control group 2: The only difference from experimental group 1 is that thymopentin is omitted.

[0035] Control group 3: The only difference from experimental group 1 is that MOTS-c peptide and thymopentin are omitted at the same time.

[0036] Each experimental group had three parallel wells, each with a volume of 150 μL. The culture medium was changed every two days. Cells from all groups were cultured at 37°C and 5% CO2 for three days. Changes in the morphology and number of CD34+ umbilical cord hematopoietic stem cells were observed under a microscope. The results are as follows: Figure 1 As shown.

[0037] Depend on Figure 1 Images a and f show the morphology of umbilical cord hematopoietic stem cells cultured in experimental groups 1-3 and control groups 1-3, respectively. As can be seen from the images, the umbilical cord hematopoietic stem cells in experimental groups 1-3 are round, translucent, and have good refractive properties, with increased cell density. In contrast, control group 1 (omitting MOTS-c peptide), control group 2 (omitting thymopentin), and control group 3 (omitting both MOTS-c peptide and thymopentin) showed significantly fewer cells compared to experimental group 1. These morphological results confirm that treatment with the active peptide composition can better promote the proliferation of umbilical cord hematopoietic stem cells.

[0038] Example 3

[0039] Umbilical cord hematopoietic stem cells obtained from experimental groups 1-3 and control groups 1-3 after 3 days of culture were collected, and the expression level of Ang-1 gene in umbilical cord hematopoietic stem cells was detected by real-time quantitative PCR (qRT-PCR).

[0040] (1) Total RNA extraction: Umbilical cord hematopoietic stem cell samples treated with bioactive peptide proliferating drugs in experimental groups 1-3 and control groups 1-3 were collected, washed twice with ice-cold PBS solution, and Trizol reagent was added. The samples were then incubated on a shaker for 10 min. Chloroform was added, and the mixture was thoroughly mixed before centrifugation (12000 rpm, 15 min). In a separate centrifuge tube, the supernatant was added, followed by an equal volume of isopropanol (isopropanol to supernatant volume ratio = 1:1). The mixture was incubated at room temperature for 15 min, then centrifuged (4℃, 12000 rpm, 10 min). The supernatant was discarded, and 75% ethanol was added and gently shaken. The mixture was then centrifuged again (4℃, 5000 rpm, 10 min). The supernatant was discarded, and the precipitate was dried. The precipitate was resuspended in cold DEPC ethanol solution and placed on ice for further analysis.

[0041] (2) Determination of RNA concentration: The absorbance value of the sample was detected in a UV spectrophotometer, and the RNA concentration and purity were judged according to the ratio of A260 / A280 to determine whether they met the experimental requirements.

[0042] (3) Synthesis of cDNA template: The reverse transcription reaction system was prepared on ice using conventional techniques. The extracted RNA was reverse transcribed into the corresponding cDNA using a reverse transcription kit, and qRT-PCR reaction was performed immediately.

[0043] (4) Real-time PCR (qRT-PCR) amplification: β-Actin was used as an internal reference gene and RT-PCR detection was performed using the following primers.

[0044] Ang-1 upstream primer: TGGGAATCCCTCTGGTGAAT (SEQ ID NO: 3);

[0045] Ang-1 downstream primer: CACCAACCTCCTGTTAGCAT (SEQ ID NO: 4);

[0046] β-Actin upstream primer: GATCCACATCTGCTGGAAGG (SEQ ID NO: 5);

[0047] β-Actin downstream primer: AAGGTGTGACGTTGACATCCG (SEQ ID NO: 6).

[0048] The primers were synthesized and purified by Sangon Biotech Co., Ltd. (Shanghai, China).

[0049] (5) Prepare the PCR reaction system: 10 μL of SYBR Green Master Mix (ROX), 1 μL of template mixture (upstream and downstream primers), 4 μL of cDNA template, and 5 μL of ddH2O. Place the mixture into the fluorescent PCR instrument, start the PCR instrument, and begin the PCR reaction. Reaction conditions: (1) 95℃ denaturation for 45 s; (2) 58℃ annealing for 45 s; (3) 72℃ extension for 60 s, for a total of 30 cycles; (4) 72℃ extension for 10 min.

[0050] (6) Calculation of relative expression levels: The relative expression levels of the Ang1 gene in hematopoietic stem cells of experimental groups 1-3 and control groups 1-3 after treatment were calculated and analyzed using the 2-ΔΔct method. The results are as follows: Figure 2 As shown.

[0051] Depend on Figure 2 It is evident that the active peptide composition of this invention can significantly enhance the expression level of the Ang-1 gene. In experimental group 1, the relative gene expression level of umbilical cord hematopoietic stem cells obtained after 3 days of culture reached 3.15. In control groups 1-3, the content of the peptides in the composition was adjusted, resulting in varying degrees of decrease in the relative gene expression levels. Specifically, omitting both MOTS-c peptide and thymic peptide significantly reduced the Ang-1 gene expression level in umbilical cord hematopoietic stem cells, indicating that MOTS-c peptide and thymic peptide can upregulate the expression level of the Ang-1 gene and enhance the proliferation of umbilical cord hematopoietic stem cells. Therefore, the results of the quantitative real-time PCR experiment on umbilical cord hematopoietic stem cells in this embodiment demonstrate that this active peptide composition can provide strong technical support for the in vitro proliferation methods and applications of umbilical cord hematopoietic stem cells as a proliferation drug.

[0052] Example 4

[0053] Western blot assay: Umbilical cord hematopoietic stem cells were cultured for 3 days using the same methods as experimental groups 1-3 and control groups 1-3 in Example 2 to obtain umbilical cord hematopoietic stem cells. An appropriate amount of RIPA cell lysis buffer was added, and the cells were lysed on ice for 40 min, followed by centrifugation at 10000 rpm for 20 min. The supernatant was collected to obtain the protein sample, which was stored at -80℃. Protein quantification was performed using the BCA method, and the protein concentration was calculated and adjusted to be consistent. The protein sample was mixed with 5× Loading Buffer at a ratio of 4:1 and denatured in a 98℃ water bath for 10 min.

[0054] Denatured protein samples were added to an SDS-PAGE gel for electrophoresis until bromophenol blue reached the bottom of the electrophoresis tank. After electrophoresis, the protein samples were transferred to a PVDF membrane using a wet transfer method. The PVDF membrane was then placed in blocking buffer containing 5% skim milk and incubated at 4°C for 2 hours. Primary antibodies (Ang1 and β-Actin) were then added, and the membrane was incubated overnight at 4°C. The membrane was washed three times with TBST solution for 6 minutes each time. The next day, secondary antibodies were added, and the membrane was incubated on a shaker at room temperature for 1 hour. The membrane was washed three times again with TBST solution for 6 minutes each time. ECL mixture was added to the membrane, spread evenly, and reacted for 2 minutes. Development was then performed, and the results are shown below. Figure 3 As shown.

[0055] Depend on Figure 3 The results of the Western blot experiment show that the expression level of Ang1 protein in umbilical cord mesenchymal stem cells after treatment in experimental groups 1-3 was higher than that in control groups 1-3. Among them, the expression level of Ang1 protein in umbilical cord hematopoietic stem cells in control group 3, which omitted both MOTS-c peptide and thymosin peptide, was the lowest, followed by control groups 1 and 2. This further illustrates that MOTS-c peptide and thymosin peptide can synergistically regulate the expression of Ang1 protein and enhance the proliferative activity of umbilical cord hematopoietic stem cells.

[0056] In summary, this invention provides the application of an active peptide composition in the preparation of a drug that promotes the proliferation of umbilical cord hematopoietic stem cells. The MOTS-c peptide and thymic peptide in this active peptide composition can exert a synergistic effect, promoting the growth of umbilical cord hematopoietic stem cells and enhancing their proliferative activity; furthermore, they can influence hematopoietic stem cell proliferation by upregulating the expression level of the Ang1 gene. Simultaneously, the active peptide composition of this invention exhibits good biocompatibility and high safety, providing crucial theoretical guidance and practical application value for promoting the in vitro expansion capacity of umbilical cord hematopoietic stem cells, and contributing to the development of umbilical cord blood stem cells in the biological field.

[0057] The above embodiments are merely preferred embodiments of the present invention and should not be construed as limiting the scope of protection of the present invention. Any non-substantial changes and substitutions made by those skilled in the art based on the present invention shall fall within the scope of protection claimed by the present invention.

Claims

1. Use of an active peptide composition for the manufacture of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells, characterized in that, The active peptides are MOTS-c polypeptide and thymopentin; The amino acid sequence of the MOTS-c polypeptide is shown in SEQ ID NO: 1: Met-Arg-Trp-Gln-Glu-Met-Gly-Tyr-Ile-Phe-Tyr-Pro-Arg-Lys-Leu-Arg; The amino acid sequence of the thymopentin is shown in SEQ ID NO: 2: Arg-Lys-Asp-Val-Tyr.

2. The use of the active peptide composition according to claim 1 in the preparation of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells, characterized in that, Umbilical cord hematopoietic stem cells were seeded into a culture medium supplemented with MOTS-c peptide and thymopentin for expansion culture.

3. The use of the active peptide composition according to claim 2 for the preparation of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells, characterized in that, The concentration of the MOTS-c polypeptide in the culture medium is 60-105 μg / mL, and the concentration of the thymopentin in the culture medium is 4-8 μg / mL.

4. The use of the active peptide composition according to claim 2 for the preparation of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells, characterized in that, The culture medium is AIM-V medium, which also contains 5-20 ng / mL IL-3, 1-5% FBS, 1-3% penicillin, and 1-3% streptomycin.

5. The use of the active peptide composition according to claim 2 for the preparation of a medicament for promoting proliferation of umbilical cord hematopoietic stem cells, characterized in that, The umbilical cord hematopoietic stem cells have a seeding density of 1-3 x 10 4 / mL.

6. The use of the active peptide composition according to claim 2 in the preparation of a drug for promoting the proliferation of umbilical cord hematopoietic stem cells, characterized in that, The culture conditions were 37°C and 5% CO2.

Citation Information

Patent Citations

  • Application of active peptide in preparation of medicine or culture medium for promoting proliferation of umbilical cord hematopoietic stem cells

    CN115991737A

  • Cyclic analog of thymus pentapeptide, its preparing method and use

    WO2008148247A1