Flavone glycosyltransferase, mutants and uses thereof

Abstract

The application belongs to the field of pharmaceutical biotechnology, and particularly relates to a flavone glycosyltransferase, a mutant and application thereof. The amino acid sequence of the flavone glycosyltransferase is shown as SEQ ID NO. 3, and the amino acid sequence of the mutant HtUGT73EW3-Q85A is shown as SEQ ID NO. 4. The mutant significantly improves the catalytic ability of the wild-type flavone glycosyltransferase, has high flavone 3,7- and 7,4'-O-diglucoside synthesis ability, and obtains the ability to catalyze alkaloids, terpenes and steroids. A double-enzyme catalytic system of HtUGT73EW3-Q85A combined with sucrose synthase is established, and the synthesis of flavone 3,7- and 7,4'-O-diglucoside is realized in a high-efficiency and low-cost manner without using UDP-glucose donor in an in-situ UDP-glucose regeneration mode.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical biotechnology, and specifically relates to a flavonoid glycosyltransferase, its mutant, and its applications. Background Technology

[0002] Flavonoids are the largest class of polyphenols found in nature, with over 9,000 plant-derived flavonoid compounds discovered to date, including flavones, flavonols, flavanones, flavanone alcohols, flavanols, anthocyanins, chalcones, and isoflavones. Flavonoids possess beneficial biological activities and effects such as antioxidant, anti-inflammatory, antibacterial, and anti-obesity properties, and are therefore widely used in the food, health product, pharmaceutical, medical, and cosmetic industries, as well as the textile industry. However, most flavonoids have poor water solubility, are metabolized rapidly, and have low systemic absorption rates, resulting in low bioavailability and biological activity. Studies have shown that glycosylation modification can not only improve the water solubility and stability of flavonoids but also improve their biological and pharmacological activities by reducing toxicity and increasing bioavailability. For example, genistein 7,4'- O -α-diglucoside is 2459 times more water-soluble than genistein; xanthohumol-4'- O -β-D-glucopyranoside has stronger antioxidant capacity and anticancer activity compared to its aglycone.

[0003] Flavonoid aglycones are generally readily available and inexpensive, while flavonoid glycosides are expensive, with monosaccharides and disaccharides typically costing tens or hundreds of times more than their aglycones. Utilizing inexpensive flavonoid aglycones to prepare high-value-added flavonoid glycosides holds great promise for industrial applications. Currently, the main methods for obtaining flavonoid glycosides are chemical synthesis and enzymatic catalysis. Chemical synthesis uses flavonoid aglycones as substrates and employs methods such as the Koenigs-Knorr and Kahne-Crich methods for glycosylation modification, but this requires protection / deprotection of the groups, involves numerous reaction steps, and is subject to harsh conditions. In contrast, enzymatic synthesis offers advantages such as high catalytic efficiency, strong regio / stereoselectivity, mild reaction conditions, and environmental friendliness, making it a feasible route for the "green and efficient" synthesis of flavonoid glycosides. In plants, the glycosylation of flavonoids is mainly catalyzed by uridine diphosphate glycosyltransferases belonging to the GT1 family, which transfer the UDP-activated glycosyl moiety in a regio-specific manner and attach it to a specific receptor site. In glycosylation reactions directly catalyzed by glycosyltransferases, UDP-glucose donors are expensive and non-recyclable consumable substrates. To address this challenge, a common approach is to use glycosyltransferases in combination with sucrase synthases. Sucrase synthases hydrolyze sucrose to generate UDP-glucose, providing a sugar donor for the glycosylation reaction and enabling the recycling of UDP-glucose and in-situ regeneration of UDP-glucose.

[0004] Little Peach Seven ( Helleborus thibetanusFranch., belonging to the genus *Heliotropium* in the family Ranunculaceae, is a plant endemic to China, mainly produced in Shaanxi, Sichuan, and Gansu provinces. It possesses high medicinal and ornamental value. *Heliotropium* plants are rich in flavonoid glycosides, which typically exhibit the following characteristics: a quercetin or kaempferol-based structural core; and hydroxyl groups at the C3 or C7 position linked to different types of glycosyl groups to form monosaccharides or disaccharides, such as isoquercitrin, hyperoside, and kaempferol-3- O -glucopyranosyl-7- O -Glucopyranoside, Quercetin-3- O -(2-E-caffeoyl)-α-L-arabinopyranosyl-(1→2)- O -β-D-glucopyranosyl-7- O -β-D-glucopyranoside, etc. Flavonoid glycosyltransferases are key enzymes in flavonoid glycosylation modification. The presence of various flavonoid glycosides in *Syzygium septum* suggests the existence of novel flavonoid glycosyltransferases with catalytic functions in this plant. Therefore, the discovery and modification of flavonoid glycosyltransferases in *Syzygium septum* will provide effective biocatalysts for the enzymatic synthesis of flavonoid glycosides, enabling low-cost production of flavonoid glycosides. Summary of the Invention

[0005] To overcome the shortcomings of flavonoids, such as poor water solubility and low bioavailability, and to address the issues of numerous steps and demanding conditions in the chemical synthesis of flavonoid glycosides, this invention provides a flavonoid glycosyltransferase that can simultaneously catalyze the generation of a variety of flavonoid monosaccharide products. In practical applications, this reduces the workload of expressing different flavonoid glycosyltransferases and lowers production costs.

[0006] To achieve the above-mentioned objectives, the specific technical solution provided by this invention is as follows: In a first aspect, the present invention provides a flavonoid glycosyltransferase HtUGT73EW3, the amino acid sequence of which is shown in SEQ ID NO.3.

[0007] In a second aspect, the present invention provides a flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A, which is obtained by mutating glutamine at position 85 of the amino acid sequence of the flavonoid glycosyltransferase HtUGT73EW3 to alanine. The amino acid sequence of the flavonoid glycosyltransferase mutant is shown in SEQ ID NO.4.

[0008] In a third aspect, the present invention provides a recombinant expression vector comprising a nucleotide sequence encoding a flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A.

[0009] In a preferred embodiment of the present invention, the recombinant expression vector is constructed according to the following steps: The nucleotide sequences of flavonoid glycosyltransferase HtUGT73EW3 and sucrose synthase AtSuSy were ligated into pETDuet to construct the recombinant dual expression vector pETDuet-AtSuSy-HtUGT73EW3; The glutamine (Q) at position 85 of the HtUGT73EW3 amino acid sequence in the recombinant dual expression vector was mutated to alanine (A) to obtain the recombinant dual expression vector pETDuet-AtSuSy-HtUGT73EW3-Q85A containing the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A. The recombinant dual expression vector pETDuet-AtSuSy-HtUGT73EW3-Q85A was transformed into the Transetta(DE3) expression system to obtain a recombinant strain containing the nucleotide sequence encoding the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A.

[0010] The 5′ end of the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A contains a nucleic acid sequence with a 6-histidine tag. The recombinant dual expression vector can simultaneously express the flavonoid glycosyltransferase mutant and sucrose synthase to obtain a crude enzyme solution, or it can further purify the flavonoid glycosyltransferase mutant separately to obtain a pure enzyme.

[0011] In a preferred embodiment of the present invention, the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A is specifically constructed according to the following steps: The above recombinant strains were activated, incubated and induced to express recombinant proteins, and the bacterial cells were collected by centrifugation. The bacterial cells were resuspended, ultrasonically disrupted, and then centrifuged. The supernatant was the crude enzyme solution. The crude enzyme solution was purified to obtain a crude enzyme solution of AtSuSy and HtUGT73EW3-Q85A dual enzymes. The crude enzyme solution of the two enzymes was purified by column chromatography and concentrated to obtain the pure enzyme HtUGT73EW3-Q85A.

[0012] In a fourth aspect, the present invention provides a host cell comprising a nucleotide sequence encoding a flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A.

[0013] In a preferred embodiment of the present invention, the host cell is Escherichia coli Transetta (DE3).

[0014] The host cell can simultaneously express sucrose synthase AtSuSy and the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A.

[0015] In a fifth aspect, the present invention provides a flavonoid glycosyltransferase HtUGT73EW3 or the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A or the recombinant expression vector or the host cell having any of the following uses: (1) Catalyzing flavonoids to synthesize flavonoid glycosides; (2) Catalyze alkaloids, terpenoids or steroids.

[0016] In a preferred embodiment of the present invention, the flavonoid glycosyltransferase is used to catalyze the synthesis of flavonoid monosaccharides.

[0017] In a preferred embodiment of the present invention, the flavonoid glycosyltransferase mutant is used to catalyze the synthesis of flavonoid disaccharides or flavonoid monosaccharides.

[0018] In a preferred embodiment of the present invention, the synthesis of flavonoid glycosides from flavonoids using the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A involves the flavonoid glycosyltransferase mutant catalyzing the formation of flavonoids with 3,7 and 7,4'- O - Glycosylation products mainly composed of disaccharides. The catalytic process primarily involves glycosylation modification of the C-3, C-7, and C-4' hydroxyl groups in flavonoids. The main glycosylation product is flavonoid 7- O - Monosaccharide glycoside, flavonoid 4'- O - Monosaccharides, flavonoids 3- O - Monosaccharides and flavonoids 3,7- O - Disaccharide glycoside, flavonoid 7,4'- O - Disaccharide glycoside products.

[0019] As a preferred embodiment of the present invention, the method for synthesizing flavonoid glycosides from flavonoids using the flavonoid glycosyltransferase mutant includes the following steps: The recombinant strain containing the nucleotide sequence encoding the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A was activated, inoculated and cultured to the logarithmic growth phase, induced to express at low temperature, and the supernatant obtained after cell lysis and centrifugation was the crude enzyme solution containing AtSuSy and HtUGT73EW3-Q85A. The glycosyltransferase mutant HtUGT73EW3-Q85A is coupled with sucrase synthase (AtSuSy) for an enzymatic reaction. Sucrase synthase AtSuSy utilizes UDP to catalyze the cleavage of sucrose to generate UDP-glucose, while the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A utilizes UDP-glucose to catalyze the conversion of flavonoids into corresponding flavonoid glycosides. The UDP generated by the glycosylation reaction catalyzed by HtUGT73EW3-Q85A is then reused by sucrase synthase AtSuSy, thus achieving UDP recycling and regeneration, thereby enabling the low-cost and high-efficiency preparation or production of flavonoid glycosides.

[0020] As a preferred embodiment of the present invention, the reaction system of the enzyme-catalyzed reaction is as follows: 50 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 50 mM~800 mM sucrose, 0.1 mM~1 mM substrate, 0.1 mM~1 mM UDP, 100 μL crude enzyme solution, and the total volume is 200 μL.

[0021] In a preferred embodiment of the present invention, the flavonoids are selected from quercetin, luteolin, sennaol, dihydromyricetin, daidzein, phlorizin, apigenin, myricetin or other structurally similar flavonoids, and the steroids, terpenoids and alkaloids are selected from bufotalin, glycyrrhetinic acid, 10-hydroxycamptothecin and β-estradiol.

[0022] The present invention has the following advantages and effects compared with the prior art: Existing flavonoid glycosyltransferases typically exhibit strict regioselectivity, recognizing hydroxyl groups at specific sites on flavonoids for glycosylation modification, thus providing specific flavonoid 3- O - Glycosyltransferase or flavonoid 7- O - Glycosyltransferase, therefore can only produce 3- O - Monosaccharide or 7- O - Monosaccharides. The flavonoid glycosyltransferases HtUGT73EW3 and HtUGT73EW3-Q85A provided by this invention can simultaneously catalyze the generation of a variety of flavonoid monosaccharide products. In practical applications, this can reduce the workload of expressing different flavonoid glycosyltransferases and lower production costs. Furthermore, the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A can also transform alkaloids, terpenes, and steroidal compounds that the wild type cannot recognize, such as 10-hydroxycamptothecin, glycyrrhetinic acid, bufotalin, and β-estradiol.

[0023] Currently known glycosyltransferases primarily catalyze the formation of monosaccharide products from flavonoids, with the catalytic site mostly at the C3 hydroxyl position, and disaccharide products are less common. This invention provides a flavonoid glycosyltransferase mutant, HtUGT73EW3-Q85A, with highly efficient catalytic activity. HtUGT73EW3-Q85A has a broad substrate spectrum and can efficiently catalyze the formation of flavonoid compounds with 3,7 and 7,4'- O - Glycosylation products mainly composed of disaccharides.

[0024] This invention couples HtUGT73EW3-Q85A with AtSuSy, and through the UDP-glycemic regeneration pathway of AtSuSy, replaces expensive UDP-glucose with inexpensive sucrose and a very small amount of UDP, efficiently catalyzing the glycosylation of flavonoid substrates to form a variety of flavonoid glycosides with high added value.

[0025] This invention presents a method for synthesizing flavonoid glycosides using the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A, which shows promising industrial potential and lays the foundation for the large-scale synthesis of flavonoid glucosides. Upon implementation, this invention will provide an important enzyme tool for the glycosylation synthesis of flavonoids, bringing significant economic benefits to the flavonoid glycoside synthesis industry. Attached Figure Description

[0026] Figure 1 This is a flowchart of the construction process of the recombinant dual expression vector pETDuet-AtSuSy-HtUGT73EW3-Q85A.

[0027] Figure 2 This is a schematic diagram of the quercetin glycosylation reaction catalyzed by HtUGT73EW3-Q85A in conjunction with AtSuSy.

[0028] Figure 3 This is an SDS-PAGE analysis of the purified HtUGT73EW3-Q85A enzyme obtained after expression and purification of the recombinant dual expression vector in Escherichia coli Transetta(DE3).

[0029] Figure 4 This is a liquid chromatogram of the product of the reaction of quercetin catalyzed by the pure enzyme HtUGT73EW3-Q85A.

[0030] Figure 5 The image shows a bar graph illustrating the catalytic activity of HtUGT73EW3-Q85A compared to that of HtUGT73EW3.

[0031] Figure 6 The effect of sucrose concentration on the quercetin reaction system catalyzed by the combined use of HtUGT73EW3-Q85A and AtSuSy.

[0032] Figure 7The effect of quercetin concentration on the quercetin reaction system catalyzed by the combined use of HtUGT73EW3-Q85A and AtSuSy.

[0033] Figure 8 Effect of UDP concentration on the quercetin reaction system catalyzed by HtUGT73EW3-Q85A and AtSuSy.

[0034] Figure 9 The effect of temperature on the quercetin reaction system catalyzed by HtUGT73EW3-Q85A and AtSuSy.

[0035] Figure 10 Effect of pH on the quercetin reaction system catalyzed by HtUGT73EW3-Q85A and AtSuSy. Detailed Implementation

[0036] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. It should be noted that any processes not specifically described in detail below are those that can be implemented or understood by those skilled in the art with reference to existing technology. Reagents or instruments whose manufacturers are not specified are considered to be conventional products that can be purchased commercially.

[0037] Example 1 Cloning of HtUGT73EW3 and Construction of Dual Expression Vectors RNA was extracted from young leaves of *Arabidopsis thaliana* and *Eriocaulon buergerianum* using a plant RNA extraction kit, and then cDNA was obtained by reverse transcription using an RNA reverse transcription kit. A dual expression vector was constructed using the in-fusion cloning method.

[0038] First, using Arabidopsis cDNA as a template, a pair of specific primers were designed targeting the coding gene sequence of sucrose synthase AtSuSy (Genbank number: NM_001036838, its nucleotide sequence is shown in SEQ ID NO.5). Simultaneously, a base sequence homologous to the pETDuet-1 vector was introduced at the 5' end of each primer for in-fusion cloning to construct the pETDuet-AtSuSy vector. PCR amplification was performed using Arabidopsis cDNA as a template to obtain the target gene AtSuSy. The reaction conditions were: 98 ℃ pre-denaturation for 3 min; 98 ℃ denaturation for 30 sec, 55 ℃ annealing for 10 sec, and 72 ℃ extension for 30 sec, for 30 cycles. Specific amplification primers are as follows:

[0039] P1-F: 5'- TGCCGCGCGGCAGCCATATGATGGCAAACGCTGAACGTATG-3', as shown in SEQ ID NO.6; P1-R: 5'-TCGAGTCGGCCGCAAGCTTTCAATCATCTTGTGCAAGAGGAA-3', as shown in SEQ ID NO.7.

[0040] Simultaneously, PCR amplification was performed using the pETDuet-1 circular empty vector as a template to obtain the linearized pETDuet-1 vector. The reaction conditions were: 98 ℃ pre-denaturation for 3 min; 98 ℃ denaturation for 30 sec, 55 ℃ annealing for 10 sec, and 72 ℃ extension for 6 min, for 30 cycles. Specific amplification primers are as follows:

[0041] P2-F: 5'-GCTGACGTCGGTACCCTCG-3', as shown in SEQ ID NO.8; P2-R: 5'-GGCCGATATCCAATTGAGATCTG-3', as shown in SEQ ID NO.9.

[0042] After the target gene AtSuSy and the linearized pETDuet-1 vector were recovered, digested, and then recovered again, the target gene AtSuSy and the linearized pETDuet vector were ligated using the OneStep Cloning Kit. 10 μL of the ligation product was transformed into competent E. coli DH5α cells and plated on ampicillin-resistant plates. Single clones were selected for sequencing verification and plasmid extraction to obtain the recombinant vector pETDuet-AtSuSy.

[0043] Subsequently, using a similar method, a pair of specific primers targeting the coding gene sequence of the glycosyltransferase HtUGT73EW3 were designed. Each primer also incorporated a base sequence homologous to the pETDuet-AtSuSy vector at its 5' end for in-fusion cloning to construct a dual-expression vector. PCR amplification was performed using *Xiaotaoerqi* cDNA as a template to obtain the target gene. HtUGT73EW3 The reaction conditions were: 98 ℃ pre-denaturation for 3 min; 98 ℃ denaturation for 30 sec, 55 ℃ annealing for 10 sec, and 72 ℃ extension for 44 sec, for 30 cycles. The specific amplification primers are as follows:

[0044] P3-F: 5'-ATCACCATCATCACCACAGCATGGGGTCTGAAGATCAAAAACTC-3', as shown in SEQ ID NO. 10; P3-R: 5'-GTTCGACTTAAGCATTATGCTCAATTCTTGCTGTTATTTGATTTCTG-3', as shown in SEQ ID NO. 11.

[0045] Using the successfully constructed circular pETDuet-AtSuSy vector as a template, PCR amplification was performed to obtain the linearized pETDuet-AtSuSy vector. The reaction conditions were: 98 ℃ pre-denaturation for 3 min; 98 ℃ denaturation for 30 sec, 55 ℃ annealing for 10 sec, and 72 ℃ extension for 6 min, for 30 cycles. The specific amplification primers are as follows:

[0046] P4-F: 5'-GCATAATGCTTAAGTCGAACAGAAAGTAA-3', as shown in SEQ ID NO. 12; P4-R: 5'-GCTGTGGTGATGATGGTGATGGCT-3', as shown in SEQ ID NO.13.

[0047] target gene HtUGT73EW3 After being recovered, digested, and then recovered from the linearized pETDuet-AtSuSy vector, the target gene was extracted using the One Step Cloning Kit. HtUGT73EW3 Ligation was performed with the linearized pETDuet-AtSuSy vector. 10 μL of the ligation product was transformed into competent E. coli DH5α cells and plated on ampicillin-resistant plates. Single clones were selected for sequencing verification, and plasmids were extracted to obtain the recombinant vector pETDuet-AtSuSy-HtUGT73EW3, containing the target gene. HtUGT73EW3 The nucleic acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the flavonoid glycosyltransferase HtUGT73EW3 encoded by it is shown in SEQ ID NO.3.

[0048] SEQ ID NO.1: atggggtctg aagatcaaaa actccatata ttcttcttcc cattcatggc ccacggccatagaatcccaa tgatagacat cgtccgacta tttgcagctc gcggtactaa gtgtaccata atctccactccccttaacgc cctccacttt gctgaaagta tagacagaga taaacaatca ggactagata ttgggatcctaacaatccca tttccggcag tacaagctgg gttacctgaa ggatgtgaag accaaggttc tattcctgcgcctgaaatga ttgtgaattt cctggaagct gttggcatgc ttctggaacc cttcaacaaa ctgctgcaagagcatcaccc tgattgtgtc gtggctgatg cgttcttacc ttggacaaca gaagtggctg acaggtatggaattccaagg cttgtgtttc atggaaaatg ttattttcct ctatgtgttg ctgaaaatat caaacgcttcgctcctcatg agaagctaac atctgattca gaaactttta ttgtgcctgg tctgccggac caaatagagatgacgaaatc agaattgcat aaaggtgaca ccaacgctaa gtttgcagat aggcatgcta tagcacaagaggcagaggag agaagctatg gtgtcttggc gaatagcttt tatgagatgg aaccagctta tgttgagtacttcaagaagg aaatgggaag aagagcatgg agcataggtc cagtttcgct ttacaataag actataactagtaaggctca gagaggagag aaatctgtta atgatgaaca actatatctc aactggcttg actccagggaaccaggctca gtcctttatg tttgtttcgg aagcatttct cacttaggaa ctgctcaagt gcgtgagattgcaatgggac tcgaagcctccaaaattcca tttgtttggg ttgtaagaat gacaaacatt gagaaggaagatttcctgcc cgaagggttt gaagacagaa tggaagggaa gggattgata attaaaggtt gggcaccacaagtgctaatt cttgaccatc cagctgttgg agggttcatg actcactgtg ggtggaaccctcgcatc aatgatcaca tggccaatgt ttgccgatca atttacaat gagaagcttgtcactcaggt tcttaagatt ggaattgcag ctggtaataa aacatggaaa tggtggatgg aagctgatactgtatttgtg acaaaggaaa gagtaaacca agtggtggct caactcatgg gcagtggaac agaagcagatgatatgagaa ggcgagctcg agagcttgga aatatggcaa agaaagctgt ggaagaaggt ggatcgtcttacaatgactt gactaatttg attcaagaac tgagactaca taaacaagaaaa tcaagaaataaca g SEQ ID NO.3: Met Gly Ser Glu Asp Gln Lys Leu His Ile Phe Phe Phe Pro Phe Met AlaHis Gly His Arg Ile Pro Met Ile Asp Ile Val Arg Leu Phe Ala Ala Arg Gly ThrLys Cys Thr Ile Ile Ser Thr Pro Leu Asn Ala Leu His Phe Ala Glu Ser Ile AspArg Asp Lys Gln Ser Gly Leu Asp Ile Gly Ile Leu Thr Ile Pro Phe Pro Ala ValGln Ala Gly Leu Pro Glu Gly Cys Glu Asp Gln Gly Ser Ile Pro Ala Pro Glu MetIle Val Asn Phe Leu Glu Ala Val Gly Met Leu Leu Glu Pro Phe Asn Lys Leu LeuGln Glu His His Pro Asp Cys Val Val Ala Asp Ala Phe Leu Pro Trp Thr Thr GluVal Ala Asp Arg Tyr Gly Ile Pro Arg Leu Val Phe His Gly Lys Cys Tyr Phe ProLeu Cys Val Ala Glu Asn Ile Lys Arg Phe Ala Pro His Glu Lys Leu Thr Ser AspSer Glu Thr Phe Ile Val Pro Gly Leu Pro Asp Gln Ile Glu Met Thr Lys Ser GluLeu His Lys Gly Asp Thr Asn Ala Lys Phe Ala Asp Arg His Ala Ile Ala Gln GluAla Glu Glu Arg Ser Tyr Gly Val Leu Ala Asn Ser Phe Tyr Glu Met Glu Pro AlaTyr Val Glu Tyr Phe Lys Lys Glu Met Gly Arg Arg Ala Trp Ser Ile Gly Pro ValSer Leu Tyr Asn Lys Thr Ile ThrSer Lys Ala Gln Arg Gly Glu Lys Ser Val AsnAsp Glu Gln Leu Tyr Leu Asn Trp Leu Asp Ser Arg Glu Pro Gly Ser Val Leu TyrVal Cys Phe Gly Ser Ile Ser His Leu Gly Thr Ala Gln Val Arg Glu Ile Ala MetGly Leu Glu Ala Ser Lys Ile Pro Phe Val Trp Val Val Arg Met Thr Asn Ile GluLys Glu Asp Phe Leu Pro Glu Gly Phe Glu Asp Arg Met Glu Gly Lys Gly Leu IleIle Lys Gly Trp Ala Pro Gln Val Leu Ile Leu Asp His Pro Ala Val Gly Gly PheMet Thr His Cys Gly Trp Asn Ser Thr Cys Glu Gly Ile Ser Ala Gly Leu Pro MetIle Thr Trp Pro Met Phe Ala Asp Gln Phe Tyr Asn Glu Lys Leu Val Thr Gln ValLeu Lys Ile Gly Ile Ala Ala Gly Asn Lys Thr Trp Lys Trp Trp Met Glu Ala AspThr Val Phe Val Thr Lys Glu Arg Val Asn Gln Val Val Ala Gln Leu Met Gly SerGly Thr Glu Ala Asp Asp Met Arg Arg Arg Ala Arg Glu Leu Gly Asn Met Ala LysLys Ala Val Glu Glu Gly Gly Ser Ser Tyr Asn Asp Leu Thr Asn Leu Ile Gln GluLeu Arg Leu His Lys Gln LysSer Asn Asn Ser Lys Asn SEQ ID NO.5: atggcaaacg ctgaacgtat gataacgcgc gtccacagcc aacgtgagcg tttgaacgaaacgcttgttt ctgagagaaa cgaagtcctt gccttgcttt ccagggttga agccaaaggt aaaggtattttacaacaaaa ccagatcatt gctgaattcg aagctttgcc tgaacaaacc cggaagaaac ttgaaggtggtcctttcttt gaccttctca aatccactca ggaagcaatt gtgttgccac catgggttgc tctagctgtgaggccaaggc ctggtgtttg ggaatactta cgagtcaatc tccatgctct tgtcgttgaa gaactccaacctgctgagtt tcttcatttc aaggaagaac tcgttgatgg agttaagaat ggtaatttca ctcttgagcttgatttcgag ccattcaatg cgtctatccc tcgtccaaca ctccacaaat acattggaaa tggtgttgacttccttaacc gtcatttatc ggctaagctc ttccatgaca aggagagttt gcttccattg cttaagttccttcgtcttca cagccaccag ggcaagaacc tgatgttgag cgagaagatt cagaacctca acactctgcaacacaccttg aggaaagcag aagagtatct agcagagctt aagtccgaaa cactgtatga agagtttgaggccaagtttg aggagattgg tcttgagagg ggatggggag acaatgcaga gcgtgtcctt gacatgatacgtcttctttt ggaccttctt gaggcgcctg atccttgcac tcttgagact tttcttggaa gagtaccaatggtgttcaac gttgtgatcc tctctccaca tggttacttt gctcaggaca atgttcttgg ttaccctgacactggtggac aggttgtttacattcttgat caagttcgtg ctctggagat agagatgctt caacgtattaagcaacaagg actcaacatt aaaccaagga ttctcattct aactcgactt ctacctgatg cggtaggaactacatgcggt gaacgtctcg agagacagtta tgattctgag tactgtgata ttcttggt g gtattgttcg caaatggatc tcaaggttcg aagtctggcc atatcttag acttacaccgaggatgctgc ggttgagctatcgaaagaat tgaatggcaa gcctgacctt atcattggta actacagtgatggaaatctt gttgcttctt tattgctca caaacttgggt gtcattcattgc tcatgctcttgagaaaacaa agtacccgga ttctgatatc tactggaaga agcttgacga caagtaccat ttctcatgccagttcactgc ggatattttc gcaatgaacc acactgattt catcatcact agtactttcc aagaaattgctggaagcaaa gaaactgttg ggcagcagtatca gccttattc gtatcgagttgttcacggga ttgatgtgtt tgatcccaag ttcaacattg tctctcctgg tgctgatatg agcatctacttcccttacac agaggagaag cgtagattga ctaagttcca ctctgagatc gaggagctcc tctacagcgatgttgagaac aaagagcactgtg caacctgctatgcac aatggctaggcttgatcgtg tcaagaactt gtcaggtctt gttgagtggt acgggaagaa cacccgcttg cgtgagctagctaacttggt tgttgttgga ggagacaggaggaaagagtc aaaggacaat gaagagaaag cagagatgaagaaaatgtat gatctcattg aggaatacaa gctaaacggt cagttcaggt ggatctcctc tcagatggaccgggtaagga acggtgagct gtaccggtac atctgtgaca ccaagggtgc ttttgtccaa cctgcattatatgaagcctt tgggttaact gttgtggagg ctatgacttg tggtttaccg actttcgcca cttgcaaaggtggtccagct gagatcattg tgcacggtaa atcgggtttc cacattgacc cttaccatgg tgatcaggctgctgatactc ttgctgattt cttcaccaag tgtaaggagg atccatctca ctgggatgag atctcaaaaggagggcttca gaggattgag gagaaataca cttggcaaat ctattcacag aggctcttga cattgactggtgtgtatgga ttctggaagc atgtctcgaa ccttgaccgt cttgaggctc gccgttacct tgaaatgttctatgcattga agtatcgccc attggctcaggctgttcctc ttgcacaaga tgattga Example 2 Site-directed mutagenesis to construct the pETDuet-AtSuSy-HtUGT73EW3-Q85A dual expression vector The plasmid pETDuet-AtSuSy-HtUGT73EW3 was extracted from *Escherichia coli* DH5α using a plasmid extraction kit. A pair of mutant primers targeting the gene sequence encoding the glycosyltransferase HtUGT73EW3 was designed to mutate glutamine (Q) at position 85 to alanine (A). PCR amplification was performed using the pETDuet-AtSuSy-HtUGT73EW3 plasmid prepared in Example 1 as a template. The PCR amplification program was as follows: 98 °C pre-denaturation for 3 min; 98 °C denaturation for 10 sec, 55 °C annealing for 20 sec, and 72 °C extension for 6 min, for 30 cycles.

[0049] Add 1 μL of Dpn I to digest the amplification product, and take 10 μL of the digestion product to transform E. coli competent cells DH5α and plate it on ampicillin-resistant plates. Select single clones for sequencing verification and extract plasmids to obtain the recombinant vector pETDuet-AtSuSy-HtUGT73EW3-Q85A. The nucleic acid sequence encoding HtUGT73EW3-Q85A is shown in SEQ ID NO.2, the amino acid sequence of the glycosyltransferase mutant HtUGT73EW3-Q85A is shown in SEQ ID NO.4, and the pETDuet-AtSuSy-HtUGT73EW3-Q85A dual expression vector plasmid map is shown in [image missing]. Figure 1 As shown. The specific mutation primers are as follows:

[0050] P5-F: 5'-GGGTTACCTGAAGGATGTGAAGACGCGGGTTCTATTCCTGCGCCTGAAATG-3', as shown in SEQ ID NO.14; P5-R: 5'-CATTTCAGGCGCAGGAATAGAACCCGCGTCTTCACATCCTTCAGGTAACCC-3', as shown in SEQ ID NO.15.

[0051] SEQ ID NO.2: atggggtctg aagatcaaaa actccatata ttcttcttcc cattcatggc ccacggccatagaatcccaa tgatagacat cgtccgacta tttgcagctc gcggtactaa gtgtaccata atctccactccccttaacgc cctccacttt gctgaaagta tagacagaga taaacaatca ggactagata ttgggatcctaacaatccca tttccggcag tacaagctgg gttacctgaa ggatgtgaag acgcgggttc tattcctgcgcctgaaatga ttgtgaattt cctggaagct gttggcatgc ttctggaacc cttcaacaaa ctgctgcaagagcatcaccc tgattgtgtc gtggctgatg cgttcttacc ttggacaaca gaagtggctg acaggtatggaattccaagg cttgtgtttc atggaaaatg ttattttcct ctatgtgttg ctgaaaatat caaacgcttcgctcctcatg agaagctaac atctgattca gaaactttta ttgtgcctgg tctgccggac caaatagagatgacgaaatc agaattgcat aaaggtgaca ccaacgctaa gtttgcagat aggcatgcta tagcacaagaggcagaggag agaagctatg gtgtcttggc gaatagcttt tatgagatgg aaccagctta tgttgagtacttcaagaagg aaatgggaag aagagcatgg agcataggtc cagtttcgct ttacaataag actataactagtaaggctca gagaggagag aaatctgtta atgatgaaca actatatctc aactggcttg actccagggaaccaggctca gtcctttatg tttgtttcgg aagcatttct cacttaggaa ctgctcaagt gcgtgagattgcaatgggac tcgaagcctccaaaattcca tttgtttggg ttgtaagaat gacaaacatt gagaaggaagatttcctgcc cgaagggttt gaagacagaa tggaagggaa gggattgata attaaaggtt gggcaccacaagtgctaatt cttgaccatc cagctgttgg agggttcatg actcactgtg ggtggaaccctcgcatc aatgatcaca tggccaatgt ttgccgatca attttacaat gagaagcttgtcactcaggt tcttaagatt ggaattgcag ctggtaataa aacatggaaa tggtggatgg aagctgatactgtatttgtg acaaaggaaa gagtaaacca agtggtggct caactcatggg agaacggac agagcttgga aatatggcaa agaaagctgt ggaagaaggt ggatcgtcttacaatgactt gactaatttg attcaagaac tgagactaca taaacagaaa tcaaataaca gcaagaattga SEQ ID NO.4: Met Gly Ser Glu Asp Gln Lys Leu His Ile Phe Phe Pro Phe Met AlaHis Gly His Arg Ile Pro Met Ile Asp Ile Val Arg Leu Phe Ala Ala Arg Gly ThrLys Cys Thr Ile Ile Ser Thr Pro Leu Asn Ala Leu His Phe Ala Glu Ser Ile AspArg Asp Arg Leu Asp Gly His Arg Ile Pro Ile Leu Thr Ile Pro Phe Pro Ala ValGln Ala Gly Leu Pro Glu Gly Cys Glu Asp Ala Gly Ser Ile Pro Ala Pro Glu Met Ile Val Asn PheLeu Glu Ala Val Gly Met Leu Leu Glu Pro Phe Asn Lys Leu Leu Gln Glu His HisPro Asp Cys ValVal Ala Asp Ala Phe Leu Pro Trp Thr Thr Glu Val Ala Asp ArgTyr Gly Ile Pro Arg Leu Val Phe His Gly Lys Cys Tyr Phe Pro Leu Cys Val AlaGlu Asn Ile Lys Arg Phe Ala Pro His Glu Lys Leu Thr Ser Asp Ser Glu Thr Phe Ile Val Pro GlyLeu Pro Asp Gln Ile Glu Met Thr Lys Ser Glu Leu His Lys Gly Asp Thr Asn AlaLys Phe Ala Asp Arg His Ala Ile Ala Gln Glu Ala Glu Glu Arg Ser Tyr Gly ValLeu Ala Asn Ser Phe Tyr Glu Met Glu Pro Ala Tyr Val Glu Tyr Phe Lys Lys GluMet Gly Arg Arg Ala Trp Ser Ile Gly Pro Val Ser Leu Tyr Asn Lys Thr Ile Thr Ser Lys Ala GlnArg Gly Glu Lys Ser Val Asn Asp Glu Gln Leu Tyr Leu Asn Trp Leu Asp Ser ArgGlu Pro Gly Ser Val Leu Tyr Val Cys Phe Gly Ser Ile Ser His Leu Gly Thr AlaGln Val Arg Glu Ile Ala Met Gly Leu Glu Ala Ser Lys Ile Pro Phe Val Trp ValVal Arg Met Thr Asn Ile Glu Lys Glu Asp Phe Leu Pro Glu Gly Phe Glu Asp Arg Met Glu Gly LysGly Leu Ile Ile Lys Gly Trp Ala Pro Gln Val Leu Ile Leu Asp His Pro Ala ValGly Gly Phe Met Thr His Cys Gly Trp Asn Ser Thr Cys Glu Gly Ile Ser Ala GlyLeu Pro Met Ile Thr Trp Pro Met Phe Ala Asp Gln Phe Tyr Asn Glu Lys Leu ValThr Gln Val Leu Lys Ile Gly Ile Ala Ala Gly Asn Lys Thr Trp Lys Trp Trp Met Glu Ala Asp ThrVal Phe Val Thr Lys Glu Arg Val Asn Gln Val Val Ala Gln Leu Met Gly Ser GlyThr Glu Ala Asp Asp Met Arg Arg Arg Ala Arg Glu Leu Gly Asn Met Ala Lys LysAla Val Glu Glu Gly Gly Ser Ser Tyr Asn Asp Leu Thr Asn Leu Ile Gln Glu LeuArg Leu His Lys Gln LysSerAsn Asn Ser Lys Asn Example 3 Prokaryotic expression and purification of HtUGT73EW3-Q85A The recombinant vector pETDuet-AtSuSy-HtUGT73EW3-Q85A, with correct sequencing, was transformed into *E. coli* Transetta(DE3). After colony PCR verification, positive single colonies were picked and inoculated into 5 mL LB (A + Incubate overnight in liquid medium at 37°C and 220 rpm. Inoculate 1% of the solution into 200 mL LB (A + Liquid culture medium, incubated at 37 ℃ and 220 rpm until OD 600The concentration was 0.6, and IPTG was added to a final concentration of 0.5 mM. The cells were cultured at 18 ℃ and 160 rpm for 20 h to induce protein expression. After induction, the cells were collected by centrifugation at 4 ℃ and 4000 rpm for 25 min. The cells were resuspended twice in PBS buffer and sonicated for 30 min. The sonication conditions were: 250 W power, 3 sec interval, 7 sec interval. The cells were centrifuged at 4 ℃ and 12000 rpm for 30 min. The supernatant was the crude mixed enzyme of the flavonoid glycosyltransferase mutant HtUGT73EW3-Q85A and sucrose synthase AtSuSy.

[0052] To obtain pure HtUGT73EW3-Q85A enzyme, the crude enzyme is purified using a Ni-NTA column. The purification process is as follows: First, equilibrate the Ni-NTA column with 10 column volumes of equilibration buffer (20 mM NaH2PO4, 0.5 M NaCl, 10 mM imidazole, pH 7.4). Add crude enzyme solution and mix thoroughly by inverting for 30 min to ensure complete binding of the target protein to the packing material. Then, remove contaminating proteins with 10 column volumes of washing buffer (20 mM NaH2PO4, 0.5 M NaCl, 50 mM imidazole, pH 7.4). Next, wash off the target protein with 10 column volumes of 200 mM buffer (20 mM NaH2PO4, 0.5 M NaCl, 200 mM imidazole, pH 7.4). Aliquot the purified protein solution from the Ni-NTA column into 30 kDa ultrafiltration tubes and centrifuge at 4000 rpm and 4 °C for concentration. Add PBS and centrifuge three times to concentrate the protein. The supernatant is the concentrated protein solution. Protein expression and purification efficiency were detected by 12% SDS-PAGE electrophoresis. The results are shown below. Figure 3 As shown in the figure. Lane M is the marker, and lane 1 shows the protein electrophoresis results of the purified HtUGT73EW3-Q85A enzyme.

[0053] Example 4 Catalytic activity of HtUGT73EW3-Q85A purified enzyme against flavonoids such as quercetin To determine the catalytic activity of HtUGT73EW3-Q85A, flavonoid substrates such as quercetin were glycosylated using purified HtUGT73EW3-Q85A enzyme. The reaction system consisted of 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 5 mM UDP-glucose, 1 mM substrate, and 50 μg of the purified glycosyltransferase HtUGT73EW3-Q85A from Example 3, with a total volume of 200 μL. The reaction system was incubated overnight at 30 °C. The reaction was terminated the next day by adding 200 μL of methanol, centrifuged at 13000 rpm for 20 min, and the supernatant was used for HPLC analysis.

[0054] The liquid chromatography (LC) detection conditions were as follows: detection wavelength 296 nm; column temperature 30 ℃; mobile phase A was 0.1% formic acid aqueous solution, and mobile phase B was acetonitrile; flow rate 1 mL / min; injection volume 20 μL. The gradient elution conditions were: 0–20 min, 10–75% B; 20–21 min, 75–100% B; 21–26 min, 100% B; 26–29 min, 100–10% B; 29–35 min, 10% B. The LC results are as follows: Figure 4 As shown.

[0055] from Figure 4 As can be seen, the HPLC chromatogram of quercetin converted by HtUGT73EW3-Q85A almost completely lacks the quercetin substrate peak at 9 min, indicating that HtUGT73EW3-Q85A can efficiently catalyze the glycosylation of quercetin, with a conversion efficiency slightly higher than HtUGT73EW3. Analysis of the composition of each product based on reference standards reveals that HtUGT73EW3-Q85A mainly catalyzes the formation of quercetin with peaks at 3,7 and 7,4'- O HtUGT73EW3 primarily catalyzes the formation of glycosylation products mainly composed of disaccharides, with a relatively low proportion of monosaccharides. O - Monosaccharide glycoside, 7- O - Monosaccharide and 4'- O - Glycosylation products mainly composed of monosaccharides. This indicates that HtUGT73EW3-Q85A has higher catalytic efficiency than HtUGT73EW3 and can catalyze the further formation of disaccharides from monosaccharide products.

[0056] In addition, HtUGT73EW3-Q85A also improved the conversion efficiency of many substrates with low conversion efficiency in wild-type plants, such as daidzein and arctigenin, with results as follows: Figure 5 As shown, HtUGT73EW3-Q85A significantly enhanced the enzyme's activity against myricetin and quercetin-7-. O - The catalytic activity of flavonoid monosaccharides such as glucosides converts monosaccharides into disaccharide products. When directly using quercetin-7- O When glucosinolates are used as substrates, the conversion rate is close to 100%.

[0057] HtUGT73EW3-Q85A can also transform alkaloids, terpenes and steroids that are not recognized by the wild type, such as 10-hydroxycamptothecin, glycyrrhetinic acid, bufotalin and β-estradiol, with conversion rates of 35.1%, 11.8%, 11.4% and 86.3%, respectively.

[0058] Example 5 Establishment and optimization of the HtUGT73EW3-Q85A coupled AtSuSy catalytic system To improve the catalytic efficiency and economic benefits of HtUGT73EW3-Q85A in the synthesis of flavonoid glycosides and meet the needs of industrial production of flavonoid glycosides, a mixed crude enzyme solution of HtUGT73EW3-Q85A and sucrose synthase AtSuSy (labeled AtSuSy-HtUGT73EW3-Q85A) from Example 3 was used as a catalyst to establish a catalyst as described in Example 3. Figure 2 The dual-enzyme catalytic system shown.

[0059] By utilizing the UDP-glycemic regeneration pathway of sucrose synthase AtSuSy, inexpensive sucrose and a minimal amount of UDP are used to replace expensive UDP-Glc, efficiently catalyzing the glycosylation of flavonoids to form high-value-added flavonoid glycosides. The dual-enzyme catalytic system was optimized in terms of sucrose concentration, acceptor-substrate concentration, UDP concentration, temperature, and pH.

[0060] (1) Effect of sucrose concentration on UDP recycling system Using quercetin as the acceptor substrate and sucrose and UDP as glycosyl donors, the effect of different sucrose concentrations on enzyme catalytic activity was investigated. Sucrose concentrations used included 50 mM, 100 mM, 200 mM, 400 mM, 600 mM, and 800 mM. A one-pot two-enzyme catalytic reaction system was prepared under different sucrose concentrations, containing the following components: 5 mM MgCl2, 0.5 mM UDP, 0.5 mM quercetin, 100 μL of crude enzyme solution (AtSuSy-HtUGT73EW3-Q85A), and different concentrations of sucrose. The solution was brought to a final volume of 200 μL with Tris-HCl buffer solution at pH 7.5. Each reaction was performed in triplicate, with a parallel reaction without crude enzyme serving as a negative control. The reaction solution was incubated in a 25°C water bath for 12 h, and the reaction was terminated by adding an equal volume of methanol. The mixture was then centrifuged at 13000 rpm for 30 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the catalytic efficiency was determined by HPLC.

[0061] The results are as follows Figure 6 As shown, the catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A gradually increases with increasing sucrose concentration; when the sucrose concentration reaches 200 mM or higher, the catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A tends to stabilize. Therefore, the optimal sucrose concentration for glycosylation modification of AtSuSy-HtUGT73EW3-Q85A is 200 mM.

[0062] (2) Effect of acceptor substrate concentration on UDP recycling system Using quercetin as the acceptor substrate and sucrose and UDP as glycosyl donors, the effects of different acceptor substrate concentrations on enzyme catalytic activity were investigated. The substrate concentrations used included 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1 mM. A one-pot two-enzyme catalytic reaction system was prepared under different acceptor substrate concentrations, containing the following components: 5 mM MgCl2, 200 mM sucrose, 0.5 mM UDP, 100 μL of crude enzyme solution (AtSuSy-HtUGT73EW3-Q85A), and different concentrations of quercetin. The solution was brought to a final volume of 200 μL with Tris-HCl buffer solution at pH 7.5. Each reaction was performed in triplicate, with a parallel reaction without the crude enzyme serving as a negative control. The reaction solution was incubated in a 25 °C water bath for 12 h. The reaction was terminated by adding an equal volume of methanol, and the solution was centrifuged at 13,000 rpm for 30 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the catalytic efficiency was determined by HPLC.

[0063] The results are as follows Figure 7 As shown, when the quercetin concentration is below 0.4 mM, the conversion rate of quercetin by AtSuSy-HtUGT73EW3-Q85A is around 80%. When the quercetin concentration exceeds 0.4 mM, the conversion rate of quercetin by AtSuSy-HtUGT73EW3-Q85A gradually decreases. Therefore, the optimal acceptor substrate concentration for glycosylation modification of AtSuSy-HtUGT73EW3-Q85A is 0.4 mM.

[0064] (3) The effect of UDP concentration on the UDP recycling system Using quercetin as the acceptor substrate and sucrose and UDP as glycosyl donors, the effect of different UDP concentrations on enzyme catalytic activity was investigated. The UDP concentrations used included 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, and 1 mM. A one-pot two-enzyme catalytic reaction system was prepared under different UDP concentrations, containing the following components: 5 mM MgCl2, 200 mM sucrose, 0.4 mM quercetin, 100 μL of crude enzyme solution (AtSuSy-HtUGT73EW3-Q85A), and different concentrations of UDP. The solution was brought to a final volume of 200 μL with Tris-HCl buffer solution at pH 7.5. Each reaction was performed in triplicate, with a parallel reaction without crude enzyme serving as a negative control. The reaction solution was incubated in a 25 ℃ water bath for 12 h, and the reaction was terminated by adding an equal volume of methanol. The mixture was then centrifuged at 13000 rpm for 30 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the catalytic efficiency was determined by HPLC.

[0065] The results are as follows Figure 8 As shown, UDP acts as the acceptor substrate for SuSy, and an increase in UDP promotes the synthesis of UDP-glucose. However, for HtUGT73EW3, UDP is a byproduct of glycosylation modification, and an increase in UDP promotes the reverse reaction of glycosylation synthesis, thus leading to a decrease in conversion. According to... Figure 8 The catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A showed a trend of first increasing and then decreasing with the increase of UDP concentration. The catalytic efficiency reached its highest point at a UDP concentration of 0.4 mM, with a conversion rate of 92.7%. Therefore, the optimal UDP concentration for glycosylation modification of AtSuSy-HtUGT73EW3-Q85A is 0.4 mM.

[0066] (4) Effect of temperature on UDP regeneration system Using quercetin as the acceptor substrate and sucrose and UDP as glycosyl donors, the effect of different reaction temperatures on enzyme catalytic activity was investigated. The temperatures used included 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, and 45 ℃. A one-pot two-enzyme catalytic reaction system was prepared for different reaction temperatures, containing the following components: 5 mM MgCl2, 200 mM sucrose, 0.4 mM UDP, 0.4 mM quercetin, 100 μL of crude enzyme solution (AtSuSy-HtUGT73EW3-Q85A), and brought to a final volume of 200 μL with Tris-HCl buffer solution at pH 7.5. Each reaction was performed in triplicate, with a parallel reaction without crude enzyme serving as a negative control. The reaction solution was incubated in a 25 ℃ water bath for 12 h, and the reaction was terminated by adding an equal volume of methanol. The mixture was then centrifuged at 13000 rpm for 30 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the catalytic efficiency was determined by HPLC.

[0067] The results are as follows Figure 9 As shown, the catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A gradually increases with increasing reaction temperature. The highest catalytic efficiency is achieved at 25 °C, with a quercetin conversion efficiency of 92.7%. Subsequently, the catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A gradually decreases with further increases in reaction temperature. Therefore, the optimal reaction temperature for glycosylation modification with AtSuSy-HtUGT73EW3-Q85A is 25 °C.

[0068] (5) Effect of pH value on UDP recycling system Using quercetin as the acceptor substrate and sucrose and UDP as glycosyl donors, the effect of different pH values ​​on enzyme catalytic activity was investigated. The pH conditions used included: pH 5, pH 6, pH 7, pH 7.5, pH 8, pH 9, and pH 10. A one-pot two-enzyme catalytic reaction system was prepared under different pH conditions, containing the following components: 5 mM MgCl2, 200 mM sucrose, 0.4 mM UDP, 0.4 mM quercetin, and 100 μL of crude enzyme solution (AtSuSy-HtUGT73EW3-Q85A), and made up to 200 μL with buffer solutions of different pH values. The reaction solution was incubated in water baths at different temperatures for 12 h, with three parallel experiments at each temperature. A parallel reaction without crude enzyme was used as a negative control. The reaction was terminated by adding an equal volume of methanol, and the mixture was centrifuged at 13000 rpm for 30 min. The supernatant was filtered through a 0.22 μm organic filter membrane, and the catalytic efficiency was determined by HPLC.

[0069] The results are as follows Figure 10 As shown, the catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A was only 73.2% at an ambient pH of 6. The catalytic efficiency of AtSuSy-HtUGT73EW3-Q85A initially increased and then decreased with increasing UDP concentration, reaching its highest level of 100% at pH 8. Therefore, the optimal pH for the glycosylation modification reaction system of AtSuSy-HtUGT73EW3-Q85A is 8.

[0070] Similar parts between the embodiments provided in this invention can be referred to mutually. The specific embodiments provided above are merely examples under the overall concept of this invention and do not constitute a limitation on the scope of protection of this invention. For those skilled in the art, any other embodiments extended from the solution of this invention without creative effort are within the scope of protection of this invention.

Claims

1. A flavonoid glycosyltransferase mutant, characterized in that, It is obtained by mutating glutamine at position 85 of the amino acid sequence of flavonoid glycosyltransferase to alanine. The amino acid sequence of the mutant flavonoid glycosyltransferase is shown in SEQ ID NO.4, and the amino acid sequence of the flavonoid glycosyltransferase is shown in SEQ ID NO.

3.

2. A recombinant expression vector comprising a nucleotide sequence encoding the flavonoid glycosyltransferase mutant of claim 1.

3. A host cell comprising a nucleotide sequence encoding the flavonoid glycosyltransferase mutant of claim 1.

4. The use of the flavonoid glycosyltransferase mutant of claim 1, the recombinant expression vector of claim 2, or the host cell of claim 3 in the following (1) or (2): (1) Catalyzing flavonoids to synthesize flavonoid glycosides; (2) Catalyzes the glycosylation of alkaloids, terpenoids, or steroids; The flavonoid glycosides are flavonoid disaccharides or flavonoid monosaccharides, and the flavonoid monosaccharides are flavonoid 7- O - Monosaccharides, flavonoids 3- O - Monosaccharide glycoside or flavonoid 4'- O - Monosaccharide glycoside, wherein the flavonoid disaccharide glycoside is flavonoid 3,7- O - Disaccharide glycoside or flavonoid 7,4'- O - Disaccharide glycoside; The flavonoids are selected from quercetin, luteolin, sennaol, dihydromyricetin, daidzein, phlorizin, apigenin, or myricetin; the alkaloid is 10-hydroxycamptothecin; the terpenoid is glycyrrhetinic acid; and the steroidal compound is bufotalin or β-estradiol.

5. The application according to claim 4, characterized in that, The method for synthesizing flavonoid glycosides from flavonoids using the flavonoid glycosyltransferase mutant includes the following steps: The flavonoid glycosyltransferase mutant was coupled with sucrose synthase to carry out an enzymatic reaction, thereby obtaining flavonoid glycosides.

Images