Use of an RNA helicase 20 in modulating the ability of a plant to resist viruses

Abstract

The present application relates to the field of genetic engineering, and in particular, the present application provides an application of RNA helicase 20 (RH20) in plant antiviral. Through T-DNA insertion mediated gene mutation, the mutant of RH20 knockout is generated in the background of Arabidopsis Columbia wild type. It is found by comparing with the Columbia wild type itself that the expression down-regulation of RH20 in Arabidopsis due to mutation significantly increases the disease rate of plants and the accumulation of viruses. The experiment shows that RNA helicase 20 can effectively regulate the accumulation of viral proteins, and provides a new solution path for plant antiviral.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering. Specifically, this invention relates to the application of RNA helicase 20 derived from Arabidopsis thaliana and its encoded protein in regulating plant antiviral capabilities. Background Technology

[0002] Plant viruses are a significant class of diseases affecting the normal growth and development of plants. They not only severely impact plant growth and development but also cause irreversible damage to the ecological environment upon which they depend. Among them, Turnip Mosaic Virus (TuMV), belonging to the genus *Potatovirus Y*, is one of the most serious plant viruses affecting vegetable crops. Cucumber Mosaic Virus (CMV), a representative member of the genus *Cucumber Mosaic Virus* in the family *Brassicae Mosaicviraceae*, can infect more than 1,000 plant species, including monocots and dicots, and is one of the most economically harmful plant viruses. To date, there are no effective chemical agents for controlling plant viral diseases; once a plant viral disease occurs, there is no cure. Therefore, plant viral diseases have always been a major factor limiting agricultural development.

[0003] RNA helicases are highly conserved enzymes widely distributed in eukaryotes and prokaryotes. These enzymes affect almost all aspects of RNA-related processes, including transcription, splicing, mRNA synthesis, translation, and degradation. They reshape RNA structure and RNA-protein interactions, interacting with viral replication-related proteins or acting as cofactors for various viruses, influencing viral replication or translation. Therefore, research on RNA helicases offers possibilities for the control of plant viral diseases. Further exploration of genes affecting plant resistance to viruses is of great significance for understanding the prevention and control of plant viral diseases and for the rapid development of healthy agriculture. Summary of the Invention

[0004] Based on this, the present invention provides an application of the Arabidopsis RNA helicase 20 gene in plant antiviral activity. Specifically, the present invention provides the following technical solution:

[0005] In a first aspect, the present invention provides a protein encoded by the Arabidopsis RNA helicase 20 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] In a second aspect, the present invention provides a gene encoding the above-mentioned protein, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0007] A third aspect of the present invention provides the application of the Arabidopsis thaliana RNA helicase 20 gene and its encoded protein in plant antiviral activity.

[0008] In a preferred embodiment, the virus is TuMV and / or CMV.

[0009] A fourth aspect of the present invention provides a method for regulating plant antiviral ability by an RNA helicase 20 gene, the method comprising regulating plant antiviral ability by controlling the expression level of the RNA helicase 20 gene in plants.

[0010] In one embodiment, the virus is TuMV and CMV; the transcript sequence of the RNA helicase 20 gene is shown in SEQ ID NO:1.

[0011] A fourth aspect of the present invention provides the use of the RNA helicase 20 gene in screening plant antiviral drugs, wherein the virus is TuMV and / or CMV.

[0012] Compared with the prior art, the present invention achieves the following beneficial technical effects:

[0013] The experiments of this invention demonstrate that the Arabidopsis RNA helicase 20 gene plays a crucial regulatory role in plant antiviral activity, and that mutating this gene to downregulate its expression weakens the antiviral ability of Arabidopsis. Therefore, this gene can be used to regulate or study plant antiviral applications, and it has significant implications for screening plant antiviral drugs. This invention provides a method for cultivating antiviral plants and has important application prospects. Attached Figure Description

[0014] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0015] Figure 1 The structure of RNA helicase 20 gene and the insertion site of the T-DNA-mediated mutant rh20-1 (Salk_124308c) were determined, the genotype of the mutant plant rh20-1 was identified, and the expression level of the RH20 gene in the mutant rh20-1 was determined.

[0016] Figure 2 The plant phenotypes are those of the Col-0 wild type and the rh20-1 mutant.

[0017] Figure 3 The infection status of rh20-1 mutant plants and Col-0 plants under the influence of TuMV virus.

[0018] Figure 4 The infection status of rh20-1 mutant plants and Col-0 plants under CMV virus infection. Detailed Implementation

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0020] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0021] Unless otherwise specified, m / v in the following examples refers to g / ml.

[0022] The mutants and their wild-type origins appearing in the following examples are explained below:

[0023] Seed of RH20 gene mutant rh20-1 (Salk_124308c), purchased from

[0024] TAIR (https: / / www.arabidopsis.org / index.jsp).

[0025] The wild-type Arabidopsis thaliana selected was the Columbia type.

[0026] The RH20 gene mutant rh20-1 and wild-type Arabidopsis thaliana Col-0 genomes show only a T-DNA insertion mutation in the RH20 gene; the other genes are identical.

[0027] The CDS sequence of the Arabidopsis RNA helicase 20 gene is shown in SEQ ID NO.1, and the protein sequence of Arabidopsis RNA helicase 20 encoded by it is shown in SEQ ID NO.2.

[0028] Example 1: Construction and identification of Arabidopsis thaliana RNA helicase 20 gene mutant plants

[0029] Identification of Rh20-1 mutants

[0030] ① Genomic DNA was extracted from wild-type Arabidopsis thaliana seedlings of Col-0 (Col-0 WT) and rh20-1 mutant. PCR amplification was performed using primers RH20-LP and RH20-RP on the RH20 gene across the T-DNA insertion site and primer RH20-BP on the T-DNA insertion fragment.

[0031] The main reagents used were: KOD One™ PCR Master Mix purchased from Toyobo, DNA marker and gelred nucleic acid dye purchased from Polymer Biotech, DNA gel extraction kit purchased from TransGen Biotech, and primers synthesized by BGI Genomics Co., Ltd.

[0032] Primer sequences used:

[0033] RH20-LP 5'-TGAAGGGACGTGATCTTATCG-3'

[0034] RH20-RP 5'-TTTCGATTCACCACAAATTCC-3'

[0035] RH20-BP 5'-ATTTTGCCGATTTCGGAAC-3'

[0036] After PCR amplification, 8 μL of the amplification product was added to 1 μL of loading buffer and electrophoresed on a 1% agarose gel containing gelred nucleic acid dye. 1×TAE was used as the electrophoresis buffer, and electrophoresis was performed at 150V for 20 minutes. The gel was then imaged using a gel imaging system, and the results were identified as follows: Figure 1 As shown in b.

[0037] The principle of the cross-insertion site assay is to design LP and RP primers on both sides of the insertion site. In WT, a full-length sequence can definitely be amplified. However, in mutants, due to the insertion of T-DNA, the fragment cannot be amplified. The BP primer is located at the insertion site. Therefore, if there is T-DNA insertion in the mutant, the BP and LP primers can amplify the fragment, indicating that the plant is a T-DNA insertion mutant. In this example, if the RH20-LP and RH20-RP primers across the insertion site fail to amplify the fragment in the rh20-1 mutant, but PCR using the primers RH20-BP and RH20-LP located on the T-DNA insertion fragment can amplify the fragment in the rh20-1 mutant, then it can be concluded that the rh20-1 plant is a RH20 mutant plant.

[0038] ② RNA was extracted from Col-0 WT and rh20-1 using the Trizol method and reverse transcribed into cDNA. qRT-PCR was then performed using primers RH20-qF, RH20-qR, Actin2-qF, and Actin2-qR.

[0039] The reagents used were purchased from Novizan Biotechnology Co., Ltd. Primers were synthesized by BGI Genomics Co., Ltd.

[0040] Primer sequences used:

[0041] RH20-qF 5'-GGATGAGGCTGATCGAATGC-3'

[0042] RH20-qR 5'-TCCGGATCTGAGGGTCAAAC-3'

[0043] Actin2-qF 5'-AGTGGTCGTACAACCGGTATT-3'

[0044] Actin2-qR 5'-GATGGCATGAGGAAGAGAGAA-3'

[0045] The results, analyzed using Graphpad Prism 9, show that... Figure 1 As shown in c, the expression level of RH20 mRNA in rh20-1 is almost zero, indicating that the rh20-1 plant is a knockout line of the RH20 gene (i.e., a mutant).

[0046] II. Phenotypic Identification of Col-0 Wild-type and rh20-1 Mutants

[0047] like Figure 2 As shown, compared with Col-0 WT, the rh20-1 mutant did not show obvious developmental abnormalities, which means that the RH20 gene does not affect plant growth and development.

[0048] Example 2: Application of Arabidopsis RNA helicase 20 gene in regulating plant antiviral resistance

[0049] I. Differences in the ability of rh20-1 mutant and Col-0 to combat TuMV virus

[0050] Wild-type Arabidopsis thaliana Col-0 and RNA helicase mutant Arabidopsis thaliana (rh20-1, in which a mutant with T-DNA insertion introduced into the sixth exon region of the RH20 gene) were planted, and when the seedlings were 4 weeks old, they were infected with TuMV virus with GFP fluorescent tag (TuMV-GFP). The specific method is as follows: The plasmid of TuMV-GFP wild-type virus (from the literature: Garcia-Ruiz H, et al. (2010) Arabidopsis RNA-dependent RNA polymerases and dicerlike proteins in antiviral defense and small interfering RNA biogenesis during TurnipMosaic Virus infection. Plant Cell 22(2):481–496.) was transformed into GV3101 competent cells. Positive colonies were shaken until the bacterial cell OD600≈3, at which point the bacterial cells were collected and resuspended in injection solution (500μL 1M MgCl2, 500μL 1M MES, 50μL 0.15MAS, diluted to 50ml). The absorbance of the bacterial cells was measured until OD600=0.5. The bacterial solution was injected into Arabidopsis leaves, usually the third round of leaves. After injection, the excess bacterial solution on the leaves was aspirated, and the plants were placed on a light-supported growth rack for culture. After about 10 days, the newly grown leaves can be observed to have a mottled and wrinkled phenotype and GFP fluorescence carried by the virus.

[0051] The viral accumulation levels in wild-type plants Col-0 and the mutant rh20-1 were statistically analyzed. Specifically, the experimental steps are as follows:

[0052] 1) Infect Col-0 and rh20-1 plants with TuMV GFP virus, and observe and record the disease status of the plants 8-11 days later;

[0053] 2) Take leaves from the infected plant parts 11 days after infection, weigh them, and grind them in liquid nitrogen. Use 1 / 3 of the powder to extract protein and 2 / 3 to extract mRNA (thermal phenol method).

[0054] 3) TuMV gRNA detection

[0055] 15 μg of mRNA was extracted from the pathogenesis material and run on a formaldehyde denaturing gel. After gel running, the mRNA was transferred to a Hybond N+ membrane. UV cross-linking was performed. The membrane was stained with methylene blue as an internal control for rRNA. Thermal cross-linking was then performed at 85℃.

[0056] The steps for detecting TuMV gRNA using Northern blot are as follows:

[0057] ① PCR amplification of the CP fragment in TuMV UK1; using the random a Gene labeling system (Promega, U1100) with the PCR fragment as a template, to obtain isotope-labeled fragments. 32 PC-labeled probes;

[0058] The PCR amplification uses the following primers:

[0059] TuMV CP forward primer: ACTCTCAATGATATAGAGGATG

[0060] TuMV CP reverse primer: TTGATGGTGAACTGCCTCAAG

[0061] ② Pre-mix at 60℃ for 30 min, add the probe added in the previous step, hybridize overnight at 60℃, wash the membrane, press the phosphorus screen, and detect the signal.

[0062] 25S rRNA is used as an internal reference for gRNA detection.

[0063] 4) Detection of TuMV CP and GFP proteins

[0064] Western blot was used to detect the accumulation of TuMV coat proteins CP and GFP. The primary antibody was anti-TuMV CP or anti-GFP, and the secondary antibody was anti-Rabbit.

[0065] α-Tubulin was used as an internal control in Western blot. Monoclonal antibodies against Tubulin and GFP were purchased from EasyBio, catalog numbers BE4006-100 and BE2002-100 respectively. α-TuMV CP was a self-made monoclonal antibody against TuMV CP.

[0066] The results are as follows Figure 3 As shown in the figure: (a) In the RNA helicase 20 mutant line, the GFP fluorescence characteristic of the viral phenotype was significantly increased compared to the wild type (Col-0 WT); (b) The accumulation of viral RNA genome in mutant rh20-1 was significantly increased compared to Col-0WT; (c) The viral capsid protein CP and the viral-carried GFP protein were significantly increased in mutant rh20-1. In summary, the significant increase in the accumulation of viral RNA genome, CP protein, and GFP protein in the rh20-1 mutant indicates that RH helicase 20 has anti-TuMV virus properties.

[0067] II. Differences in the ability of rh20-1 mutant and Col-0 to combat CMV virus

[0068] Wild-type Arabidopsis thaliana Col-0 and the RNA helicase mutant line Arabidopsis thaliana (rh20-1) were planted and infected with CMV at 4-week seedling age. CMV RNA was resuspended to a concentration of 20 ng / μl using buffer C (5 mM sodium borate [pH 9.0], 0.5 mM EDTA). The CMV resuspension was added to the leaf surface, and the leaf surface was gently rubbed with carborundum to inoculate the virus. The plants were then cultured on a light-supported growth rack. After 12 days post-infection (dpi), a mottled and wrinkled phenotype was observed in the newly emerging leaves. Infected leaves were collected for further experiments.

[0069] The viral accumulation levels in the wild-type plant (Col-0) and the mutant line (rh20-1) were statistically analyzed. Specifically, the experimental procedures are as follows:

[0070] 1) CMV virus was used to infect Col-0 and rh20-1 plants, and diseased plants were obtained 12 days later;

[0071] 2) Only systemic leaves from diseased plants are collected, weighed, and then ground in liquid nitrogen. One-third of the ground powder is used for protein extraction, and two-thirds is used for mRNA extraction (thermal phenol method).

[0072] 3) CMV gRNA detection

[0073] 15 μg of mRNA was extracted from the pathogenesis material and run on a formaldehyde denaturing gel. After gel running, the mRNA was transferred to a Hybond N+ membrane. UV cross-linking was performed. The membrane was stained with methylene blue as an internal control for rRNA. Thermal cross-linking was then performed at 85℃.

[0074] The steps for detecting CMV gRNA using Northern blot are as follows:

[0075] ① PCR amplification of the CMV UK1 sequence; using the random a Gene labeling system (Promega, U1100) with the PCR fragment as a template, to obtain isotope-labeled sequences. 32 PC-labeled probes;

[0076] The PCR amplification uses the following primers:

[0077] CMV CP forward primer: TCTGTGGCGGGAGCTGAGTTGGC

[0078] CMV CP reverse primer: TGGTCTCCTTTTGGAGGCCCCAC

[0079] ② Pre-mix at 60℃ for 30 min, add the probe added in the previous step, hybridize overnight at 60℃, wash the membrane, press the phosphorus screen, and detect the signal.

[0080] 25S rRNA is used as an internal reference for gRNA detection.

[0081] 4) CMV CP protein detection

[0082] Western blot was used to detect the accumulation of CMV coat protein CP and GFP protein. The primary antibody was anti-CMV CP, and the secondary antibody was anti-Rabbit (purchased from EASYBIO, catalog number: BE0106-100).

[0083] α-Tubulin was used as an internal control in Western blot. The monoclonal antibody for Tubulin was purchased from EasyBio, catalog number BE4006-100. α-CMV CP was a self-made monoclonal antibody for CMV CP.

[0084] Results and phenotypes are shown in Figure 4 The rh20-1 mutant exhibited a more severe leaf curling phenotype (a), and compared with the wild type (Col-0 WT), the virally infected experimental group (rh20-1) showed a significant increase in the accumulation of viral RNA (b) and CMV-CP protein (b), indicating that RH helicase 20 has anti-CMV properties.

[0085] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of knocking out the Arabidopsis RNA helicase 20 gene in reducing Arabidopsis resistance to TuMV and / or CMV viruses, characterized by: The transcript sequence of the RNA helicase 20 gene is shown in SEQ ID NO.

1.

2. A method for reducing the ability of Arabidopsis thaliana to resist TuMV and / or CMV viruses, characterized in that: The method reduces the ability of Arabidopsis thaliana to resist TuMV and / or CMV viruses by knocking out the RNA helicase 20 gene, the transcript sequence of which is shown in SEQ ID NO.1.

Images