OsAtpd1 gene and application thereof in regulating rice photosynthesis

CN118879760BActive Publication Date: 2026-08-21BAOQING NORTH RICE RES CENT +3
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410973208.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-19
Publication Date
2026-08-21
Estimated Expiration
2044-07-19

AI Technical Summary

Technical Problem

水稻中关于叶绿体F0F1-ATP合酶亚基的报道较少

Benefits of technology

[0012]In this invention, knockout and RNAi mutants of OsAtpD1 were constructed, and their agronomic traits and photosynthetic-related physiological indicators were measured. Knockout of the OsAtpD1 mutant (osatpd1) resulted in seedling lethality in rice, decreased net photosynthetic rate, reduced photosynthetic pigment content, and decreased content of photosynthetic respiratory chain-related proteins. RNAi-OsAtpD1 families exhibited stunted growth, yellowing leaves, reduced tiller number, decreased seed setting rate, and decreased yield. This was accompanied by a significant decrease in photosynthetic pigment content, net photosynthetic rate, and ATPase activity, indicating a decline in photosynthetic capacity and premature aging phenotypes. Expression pattern analysis showed that OsAtpD1 was expressed in various organs, including roots, stems, leaves, young panicles, and mature panicles, but with high expression in green tissues such as leaves, stems, and sheaths, and low expression in roots. OsAtpD1 is located in chloroplasts. Therefore, the OsAtpD1 gene affects ATP synthase activity by influencing the assembly of ATP synthase, and affects the expression of photosynthetic respiratory chain-related proteins, thereby affecting the net photosynthetic rate and photosynthetic pigment content of rice, ultimately influencing the photosynthetic efficiency of rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004953826290000011
    Figure HDA0004953826290000011
  • Figure HDA0004953826290000012
    Figure HDA0004953826290000012
  • Figure HDA0004953826290000021
    Figure HDA0004953826290000021
Patent Text Reader

Abstract

The application belongs to the field of molecular biology, and particularly relates to an OsAtpD1 gene and application thereof in regulating photosynthesis of rice. The OsAtpD1 affects photosynthesis by affecting the activity of chloroplast ATP synthase. In addition, knockout of the OsAtpD1 leads to a seedling lethal phenotype, and interference of the OsAtpD1 transgenic plant with photosynthetic rate is significantly reduced, leading to dwarfing of plant height, reduction of tiller number, reduction of seed setting rate and reduction of yield. The OsAtPD1 gene has important significance for molecular improvement of the photosynthetic rate of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the OsAtpD1 gene and its application in regulating rice photosynthesis. Background Technology

[0002] Photosynthesis is the process by which photosynthetic organisms convert light energy into chemical energy. The absorption and conversion of light energy mainly occur through the synergistic action of specific thylakoid membrane protein complexes such as photosystems PSI and PSII, their light-trapping antenna proteins LHC1 and LHCII, cytochrome C6f, and the ATP synthase complex. Photosynthesis is a crucial biochemical process supporting plant growth and crop yield; therefore, improving photosynthesis is considered a primary goal for enhancing crop performance. To promote plant growth, increase yield, or improve plant responses to natural stresses by altering the photosynthetic process, in-depth research into photosynthesis and its regulatory mechanisms is essential. Chloroplast F0F1-ATP synthase (cpATPase) utilizes the free energy of the membrane potential to synthesize ATP from ADP and inorganic phosphate through rotational catalysis. It is mainly composed of CFO embedded within the membrane and CF1 protruding from the membrane. CFO is a transmembrane proton channel composed of four subunits: I, II, III, and IV, providing binding sites for CF1. CF1 is the hydrophilic portion exposed outside the membrane, composed of five subunits—α, β, γ, δ, and ε—in the form α3β3γδε. Of the nine subunits that make up F0F1-ATP synthase, only the γ, δ, and ε subunits are encoded by the nuclear genes atpC, atpD, and atpG. Previous studies have shown that mutations in the genes encoding these three nuclear genes result in Arabidopsis mutants (dpa1, atpd, and atpg) exhibiting a seedling-stage lethal phenotype. The Arabidopsis mutant dpa1 is produced by the insertion of the atpC1 gene, which encodes the γ subunit of chloroplast ATP synthase, into T-DNA. The mutant dpa1, lacking the γ subunit, cannot perform photosynthetic autotrophy, and the ATP synthase content in dpa1 plants is less than 5% of that in the wild type. Although the α and β subunits of ATP synthase in dpa1 plants can be synthesized and assembled normally on the thylakoid membrane, the absence of the γ subunit still inhibits the assembly of the cpATPase complex. In Arabidopsis, knockout of the atpD gene encoding the δ subunit of ATP synthase leads to seedling lethality, and the loss of the δ subunit also affects the accumulation of CF1 and CF0. Simultaneously, photosynthesis, thylakoid protein composition, and the expression of some nuclear chloroplast genes in Arabidopsis are all affected. Insertion of the atpG gene encoding the chloroplast ATP synthase subunit II into Arabidopsis T-DNA produces the atpg mutant. The atpg mutant exhibits an albino phenotype due to its inability to photosynthesize and autotrophize; furthermore, the thylakoid membrane of the atpg chloroplast is irregular. The loss of ATP synthase subunit II does not affect CF1 accumulation but does affect the accumulation of the cpATPase complex. Furthermore, light-induced ATP formation in atpg is significantly reduced compared to the wild type. Therefore, ATPG is crucial for the accumulation and function of cpATPase. There are few reports on the chloroplast F0F1-ATP synthase subunit in rice. Summary of the Invention

[0003] Therefore, the purpose of this invention is to provide the application of the OsAtpD1 gene, its encoded protein, and recombinant vector in rice. The OsAtpD1 gene is involved in the assembly of rice F0F1-ATP synthase and the photosynthetic process. Knockout of OsAtpD1 leads to a lethal phenotype in rice seedlings. Transgenic plants with OsAtpD1 interference exhibit stunted growth, reduced yield, decreased net photosynthetic rate, reduced photosynthetic pigment content, and reduced expression of some proteins related to the photosynthetic respiratory chain, resulting in yellowing leaves and premature aging.

[0004] To achieve the above objectives, the present invention provides the application of the OsAtpD1 gene in regulating rice photosynthesis, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0005] This invention also provides the application of proteins transcribed and translated from the OsAtpD1 gene in regulating rice photosynthesis.

[0006] Furthermore, the amino acid sequence of the protein is shown in SEQ ID NO:2.

[0007] The present invention also provides a recombinant vector, which uses the gene OsAtpD1 as the target gene, designs a CRISPR / Cas9-based sgRNA sequence, and ligates a DNA fragment containing the encoding the sgRNA sequence into a vector carrying CRISPR / Cas9 to obtain the recombinant vector.

[0008] Furthermore, the nucleotide sequence of the sgRNA action site is shown in SEQ ID NO:3.

[0009] This invention also provides the application of the above-mentioned recombinant vector in regulating rice photosynthesis.

[0010] The present invention also provides a transgenic rice with OsAtpD1 gene loss of function, obtained by transforming rice using the above-mentioned recombinant vector.

[0011] The present invention has the following beneficial effects:

[0012] In this invention, knockout and RNAi mutants of OsAtpD1 were constructed, and their agronomic traits and photosynthetic-related physiological indicators were measured. Knockout of the OsAtpD1 mutant (osatpd1) resulted in seedling lethality in rice, decreased net photosynthetic rate, reduced photosynthetic pigment content, and decreased content of photosynthetic respiratory chain-related proteins. RNAi-OsAtpD1 families exhibited stunted growth, yellowing leaves, reduced tiller number, decreased seed setting rate, and decreased yield. This was accompanied by a significant decrease in photosynthetic pigment content, net photosynthetic rate, and ATPase activity, indicating a decline in photosynthetic capacity and premature aging phenotypes. Expression pattern analysis showed that OsAtpD1 was expressed in various organs, including roots, stems, leaves, young panicles, and mature panicles, but with high expression in green tissues such as leaves, stems, and sheaths, and low expression in roots. OsAtpD1 is located in chloroplasts. Therefore, the OsAtpD1 gene affects ATP synthase activity by influencing the assembly of ATP synthase, and affects the expression of photosynthetic respiratory chain-related proteins, thereby affecting the net photosynthetic rate and photosynthetic pigment content of rice, ultimately influencing the photosynthetic efficiency of rice. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 The sequence analysis is shown in a more detailed embodiment of the present invention. (A) LOC_Os02g51470 genomic sequence, white box: 5'-UTR, 3'-UTR; blue box: exons; (B) LOC_Os02g51470 protein sequence.

[0015] Figure 2 Figures A through C represent the knockout transgenic phenotype and expression level detection in this embodiment of the invention. (A) shows the phenotype of the knockout transgenic plant. (B) shows the genotype of the knockout family. (C) shows the expression level detection of the knockout transgenic plant. Data are expressed as mean ± standard deviation. Student's t-test was used to calculate significance, **: phenotype is highly significant at the P < 0.01 level.

[0016] Figure 3Tables A through E represent the quantitative analysis of ATPase activity, photosynthetic pigment content, and photosynthetic respiratory chain-related proteins in the leaves of knockout transgenic plants in this embodiment of the invention. Specifically, (A) ATPase activity in wild-type and knockout transgenic leaves; (B) chlorophyll a content in wild-type and knockout transgenic leaves; (C) chlorophyll b content in wild-type and knockout transgenic leaves; (D) carotenoid content in wild-type and knockout transgenic leaves; and (E) analysis of photosynthetic respiratory chain-related proteins in wild-type and knockout transgenic leaves. Data are expressed as mean ± standard deviation. Student's t-test was used to calculate significance, **: phenotype is highly significant at the P < 0.01 level.

[0017] Figure 4 Figures A to B show the phenotype and expression level detection of the RNAi-OsAtpD1 transgenic plant in this embodiment of the invention. (A) Phenotype of the RNAi-OsAtpD1 plant. (B) Expression level detection of the RNAi-OsAtpD1 plant. Data are expressed as mean ± standard deviation. Student's t-test was used to calculate significance, **: phenotype is highly significant at the P < 0.01 level.

[0018] Figure 5 A through H represent the investigation of ATPase activity, photosynthetic pigment content, and agronomic traits in the leaves of RNAi-OsAtpD1 plants in this embodiment of the invention. Specifically, (A) ATPase activity in the leaves of wild-type and RNAi-OsAtpD1 plants; (B) net photosynthetic rate in the leaves of wild-type and RNAi-OsAtpD1 plants; (C) chlorophyll a content in the leaves of wild-type and RNAi-OsAtpD1 plants; (D) chlorophyll b content in the leaves of wild-type and RNAi-OsAtpD1 plants; (E) carotenoid content in the leaves of wild-type and RNAi-OsAtpD1 plants; (F) plant height in wild-type and RNAi-OsAtpD1 plants; (G) effective tiller number in wild-type and RNAi-OsAtpD1 plants; and (H) seed setting rate in wild-type and RNAi-OsAtpD1 plants. (I) Thousand-grain weight of wild-type and RNAi-OsAtpD1 plants. Data are expressed as mean ± standard deviation. Student's t-test was used to calculate significance. **: Phenotypic significance is extremely significant at the P < 0.01 level.

[0019] Figure 6This invention provides an analysis of the expression pattern of OsAtpD1 in various tissues. qRT-PCR was used to detect the expression of OsAtpD1 in different tissues; data are expressed as mean ± standard deviation. Wherein, Root: root; Stem: stem; Thefirst topleaf: the first leaf from the top; The second topleaf: the second leaf from the top; The third topleaf: the third leaf from the top; Sheath: sheath; P3: young spikelets 1-3 cm long; P>21: spikelets longer than 21 cm.

[0020] Figure 7 This diagram illustrates the subcellular localization of OsAtpD1 in protoplasts and tobacco in embodiments of the present invention. Specifically, (A) eGFP expression in protoplasts (control); scale bar: 5 μm; (B) OsAtpD1-eGFP expression in protoplasts; scale bar: 5 μm; (C) eGFP expression in tobacco; scale bar: 20 μm; (D) OsAtpD1-eGFP expression in tobacco; scale bar: 20 μm.

[0021] Figure 8 The haplotype analysis results for the 2000bp promoter region of OsAtpD1 were obtained using the 3K database.

[0022] Figure 9 The differences in plant height, number of spikes, and thousand-grain weight among different haplotypes corresponding to the 2000bp promoter region of OsAtpD1. Detailed Implementation

[0023] Various exemplary embodiments of the present invention are now described in detail. Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared using conventional methods. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and embodiments of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0028] This invention provides the application of the OsAtpD1 gene in regulating rice photosynthesis. The accession number of the OsAtpD1 gene is LOC_Os02g51470. The OsAtpD1 gene of this invention consists of 732 bases and encodes 244 amino acids. Figure 1 The photosynthetic process described in this invention includes net photosynthetic rate, photosynthetic pigment content, and ATP synthase activity. The OsAtpD1 gene described in this invention affects ATP synthase activity by influencing ATP synthase assembly, and influences the expression of photosynthetic respiratory chain-related proteins, thereby affecting the net photosynthetic rate and photosynthetic pigment content of rice, ultimately impacting the photosynthetic efficiency of rice.

[0029] This invention also provides the application of the OsAtpD1 gene in regulating rice plant architecture and yield. RNAi-OsAtpD1 families exhibit stunted growth, reduced tiller number, decreased seed setting rate, and decreased yield.

[0030] This invention also provides the application of the OsAtpD1 protein in regulating rice photosynthesis, wherein the OsAtpD1 protein is obtained by transcription and translation of the OsAtpD1 gene. The molecular mechanism by which the OsAtpD1 protein regulates rice photosynthesis is the same as that of the OsAtpD1 gene, and will not be described again here.

[0031] This invention also provides the application of the OsAtpD1 protein in regulating rice plant architecture and yield. The regulatory mechanism described in this invention is the same as that of the OsAtpD1 gene, and will not be repeated here.

[0032] This invention also provides the application of a recombinant vector containing the OsAtpD1 gene in regulating rice photosynthesis. The preferred method for preparing the recombinant vector of this invention includes: designing a CRISPR / Cas9-based sgRNA sequence using the OsAtpD1 gene as the target gene; ligating a DNA fragment encoding the sgRNA sequence into a CRISPR / Cas9-carrying vector; transforming rice to obtain transgenic rice with the gene lacking function; preferably, the nucleotide sequence of the sgRNA action site is 5'-GTTGTCGAAGAACTCGGCG-3.

[0033] This invention also provides the application of recombinant vectors containing the OsAtpD1 gene in regulating rice plant architecture and yield. The regulatory mechanism described in this invention is the same as that of the OsAtpD1 gene, and will not be repeated here.

[0034] The following examples illustrate the application of the OsAtpD1 gene, its encoded protein, and recombinant vector provided by this invention in rice. These examples are for illustrative purposes only and are not intended to limit the scope of this invention.

[0035] Example 1

[0036] Gene selection and material creation

[0037] Photosynthesis, generally speaking, refers to the process by which photosynthetic organisms absorb light energy, synthesize energy-rich organic matter from carbon dioxide and water, and release oxygen simultaneously. It is crucial for energy conversion in nature and maintaining the carbon-oxygen balance of the atmosphere. It mainly includes two stages: the light reaction and the dark reaction, involving reaction steps such as light absorption, electron transport, photophosphorylation, and carbon assimilation. Photophosphorylation is the process by which chloroplast ATP synthase, also known as F0F1-ATP, utilizes the transmembrane proton (H+) gradient generated by the energy released during photosynthesis to catalyze the synthesis of ATP from ADP and phosphate groups. The activity of ATP synthase is closely related to plant energy metabolism, and the δ subunit, as an important component of ATP synthase, plays a vital role in the mechanisms of plant energy metabolism.

[0038] We named it OsAtpD. To clone and investigate the function of the rice gene OsAtpD, we constructed knockout and RNAi transgenic plants in the ZH8015 background to reveal the function of this gene. Figure 2 ).

[0039] The primer sequences used to construct the knockout transgenic vector are (5′-3′):

[0040] OsAtpD1-Cas9-F: AGATGATCCGTGGCAGTTGTCGAAGAACTCGGCGAGTTTTAGAGCTATGCOsAtpD1-Cas9-R: GCATAGCTCTAAAACTCGCCGAGTTCTTCGACAACTGCCACGGATCATCT The primer sequences used to construct RNAi transgenic vectors are (5′-3′):

[0041] I miR-s:agGCGAAGAACGTCCGGGTCAAGcaggagattcagtttga

[0042] II miR-a:tgCTTGACCCGGACGTTCTTCGCctgctgctgctacagcc

[0043] III miR*s:ctCTTGAGCCGCACGTTCTTCGCttcctgctgctaggctg

[0044] IV miR*a:aaGCGAAGAACGTGCGGCTCAAGagagaggcaaaagtgaa2300-F:ggtacccggggatcctctagaACTAGTGGATCCCCCTCGGAT

[0045] 2300-R:agagccctggcatgcctgcagCCCTCGGTACCGCTGCTGATG

[0046] 1. Knocking out the rice gene OsAtpD using CRISPR / Cas9 technology

[0047] The knockout vector used was pCas9-AarI, which has prokaryotic resistance to spectinomycin and eukaryotic resistance to hygromycin (WU et al., 2017). The target sequence for the OsAtpD gene was designed using an online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). A sequence located in the CDS region and with a high score close to the ATG start site was selected as the sgRNA. Corresponding adapters were added to form F primers, and the F primer sequences were reverse-complemented to form R primers. Primers F and R were mixed and reacted at 94℃ for 10 min, then annealed at 0.1℃ / s to 15℃, and held at 15℃ for 10 min to complete annealing and form double strands. The pCas9 vector was digested overnight with AarI, and the target band was recovered by gel extraction. 1 μL of the double-stranded product was recombined with the recovered pCas9-AarI linear vector, transformed into DH5α, plated on spectinomycin-resistant plates, and incubated overnight at 37℃. The next day, single clones were selected and sequenced at Shangya Biotechnology Co., Ltd. Finally, the successfully sequenced plasmids were sent to Wuhan Boyuan Biotechnology Co., Ltd. for genetic transformation in the background of indica rice ZH8015. Transgenic plants of generation T0 were sequenced, and homozygous mutants of different types were selected and named Cr-OsAtpD1-1 and Cr-OsAtpD1-2 for subsequent studies. Figure 2 (AC).

[0048] 2. RNAi of the OsAtpD1 gene in rice

[0049] Because the knockout plants exhibited a seedling-stage lethal phenotype, RNAi transgenic plants were constructed to further verify the function of OsAtpD1. RNAi verification was performed using an artificial small RNA interference method designed by Norman Warthmann of MPI developmental organisms. The specific process is as follows: First, the interference sites were selected and designed on the website http: / / wmd3.weigelworld.org / ; an artificial small RNA structure was constructed, and the pNW55 vector plasmid was used as a template to perform a combined PCR reaction with the designed primers (G-4368+miR-a / miR-s+miR*-a / miR*-s+G-4369). Then, the three PCR mixtures were used as templates to perform PCR with the G-4368 / G-4369 primers to obtain a 554bp product; the 554bp PCR product was ligated with the pCAMBIA2300 linear vector digested with XbaI and PstI and plated. The next day, single clones were selected for sequencing; positive clones were transformed into ZH8015 callus to obtain transgenic plants of the OsAtpD1 gene in rice RNAi. Figure 4 (AB).

[0050] Example 2: Determination of chloroplast ATP synthase activity, net photosynthetic rate, and photosynthetic pigment content

[0051] Chloroplast ATP synthase activity was measured using a chloroplast complex V / ATP synthase / ATP synthase / ATP synthase assay kit. Net photosynthetic rate was measured using a LI-6400XT portable photosynthesis meter. On sunny mornings between 9:30 and 11:00 AM during the heading stage, the third leaf from the bottom of wild-type ZH8015 and RNAi-OsAtpD1 transgenic families was selected for total photosynthetic rate measurement. Parameter settings: photon density 1200 μmol·m⁻¹ -2 ·s -1 Flow rate 500 μmol·s -1 Three measurements of every three leaves were considered as one replicate, and statistical analysis was performed on the three replicates. Photosynthetic pigment and chlorophyll content were determined according to the methods of ARNON and PORRA et al. Chloroplast ATP synthase activity, net photosynthetic rate, and photosynthetic pigment content were measured in wild-type, sapotpd1 knockout transgenic families, and RNAi-OsAtpD1 transgenic families. Compared with the wild-type, the knockout transgenic plants sapotpd1-1 and sapotpd1-2 were lethal at the seedling stage, and their chloroplast ATP synthase activity, net photosynthetic rate, and photosynthetic pigment content were all significantly reduced. Figure 5 (AD). Compared with the wild type, RNAi-OsAtpD1 transgenic plants showed yellowing leaves, and the chloroplast ATP synthase activity, net photosynthetic rate, and photosynthetic pigment content in the leaves were all significantly reduced. Figure 5 (AE).

[0052] Example 3: Detection of expression levels of photosynthetic respiratory chain-related proteins in leaves of wild-type and sapotpd1 knockout transgenic families

[0053] Immunoblotting analysis was used to compare the expression levels of photosynthetic respiratory chain-related proteins in leaves of wild-type ZH8015 and sasAtpD1 knockout transgenic families. The proteins detected mainly included the core subunit of the PSII and PSI complex (plastomer-encoded: PsbO), the nuclear subunit of PSI encoding chlorophyll a / b binding proteins Lhca2-4, the nuclear subunit encoding LHCII type chlorophyll a / b connexins Lhcb1-6 (except Lhcb3), and the nuclear subunit encoding the β subunit (AtpB), c subunit (AtpC), and δ subunit (AtpD) of ATP synthase. Immunoblotting results showed that the expression levels of photosynthetic respiratory chain-related proteins in leaves of sasAtpD1 knockout transgenic families were significantly decreased, indicating that the loss of OsAtpD1 function not only leads to a reduction in chloroplast ATP synthase activity but also affects the expression of thylakoid membrane protein complex-related proteins in the photosynthetic respiratory chain. Figure 3 (E).

[0054] Example 4: Investigation of agronomic traits in wild-type and RNAi-OsAtpD1 transgenic families

[0055] At maturity, plant height and tiller number were investigated in the field for wild-type and RNAi-OsAtpD1 transgenic families. After harvesting and drying the ears, seed setting rate was investigated. Thousand-grain weight was analyzed using the automated seed testing system SG-G from Wanshen Company. All investigations were performed with at least three biological replicates. Agronomic trait studies of wild-type and RNAi-OsAtpD1 transgenic families showed that, compared to the wild-type, the RNAi-OsAtpD1 transgenic families had reduced plant height, reduced effective tiller number, and significantly reduced seed setting rate and thousand-grain weight. Figure 5 (FI). Therefore, OsAtpD1 also affects plant height, effective tiller number, seed setting rate, and thousand-grain weight.

[0056] Example 5: Spatiotemporal expression of gene OsAtpD1

[0057] The expression levels of most genes change in different tissues and at different growth stages. To detect the expression of OsAtpD1 in various tissues, total RNA was extracted using Tiangen's Plant RNA Extraction Kit, and then transformed into cDNA using Toyobo's ReverTra-Ace qPCR-RT-Master Mix. qRT-PCR was then performed using Takala's ExTaqII qPCR kit on a Light Cycler 480II instrument, following the manufacturer's instructions. UBQ10 was used as an internal control. We detected the expression levels of OsAtpD1 at different stages of root, stem, leaf, leaf sheath, and young spike development in ZH8015. Figure 6 As shown, OsAtpD1 can be detected in all tissues, indicating constitutive expression. OsAtpD1 is mainly expressed in green tissues such as leaves, stems, sheaths, and spikelets, with extremely low expression levels in roots. Green tissues, especially leaves, are the main sites of photosynthesis, which is consistent with the function of OsAtpD1.

[0058] Example 6: Subcellular localization of OsAtpD1 protein

[0059] The localization of proteins in organelles is crucial for understanding their function. The CDS of OsAtpD1 without the terminator was ligated into a vector containing an eGFP tag to construct the pYBA-1132-OsAtpD1-eGFP vector. Expression analysis was then performed after transient transformation in rice protoplasts and tobacco leaves. Experimental results showed that the GFP signal of the OsAtpD1-eGFP fusion protein could fuse with the autofluorescence of chloroplasts, indicating that OsAtpD1 is mainly localized in chloroplasts (…). Figure 7 ).

[0060] Example 7: Haplotype analysis of gene OsAtpD1 in rice genome

[0061] We performed haplotype analysis on the 2000bp promoter region of the OsAtpD1 gene in the 3K Rice Genome Database (https: / / www.rmbreeding.cn / Index) and counted haplotypes from more than 29 rice varieties. The results showed that the OsAtpD1 gene and its mutations can be divided into 9 haplotypes (Hap). Figure 8 ZH8015 belongs to the Hap group. Japonica rice varieties mainly have Hap1, Hap3, Hap4, and Hap9, while indica rice varieties mainly have Hap2, Hap5, and Hap7. Aus varieties mainly have Hap6, and Bzs varieties mainly have Hap8. Haplotype analysis of plant height, tiller number, and thousand-grain weight revealed that the tiller number of Hap2, Hap5, and Hap7 corresponding to indica rice varieties was significantly less than that of Hap1, Hap3, Hap4, Hap6, Hap8, and Hap9 corresponding to Japonica, Aus, and Bzs rice varieties. Figure 9 The above results indicate that the OsAtpD1 gene has been subject to artificial selection during breeding.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the OsAtpD1 gene in regulating rice photosynthesis, characterized by: The application is to construct RNAi transgenic rice using the small RNA interference method. The photosynthetic capacity of the transgenic rice is reduced. The nucleotide sequence of the OsAtpD1 gene is shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • Tracing method of cronobacter spp. in infant formula milk powder

    CN105950744A

  • Application of rice low-temperature sensitive gene Psb27

    CN118147202A