Method for soybean seed fatty acid content regulation by soybean kernel shape gene st1 and application

Abstract

The application provides a method and application of soybean grain shape gene ST1 in regulating soybean seed fatty acid content, and belongs to the technical field of vegetable oil.The application provides application of soybean grain shape gene ST1 in regulating soybean seed fatty acid content, after knockout of the ST1 gene, the knockout mutant is significantly different from a control group in soybean seed fatty acid content, the content of palmitic acid and oleic acid is significantly increased, and the content of linoleic acid is significantly decreased; after the ST1 gene is introduced, the genomic vector complementary transgenic material is significantly different from the control group in soybean seed fatty acid content, the content of linolenic acid is significantly decreased, and the content of linoleic acid is significantly increased.

Description

Technical Field

[0001] This invention belongs to the field of vegetable oil technology, specifically relating to the method and application of regulating the fatty acid content of soybean seeds using the soybean grain shape gene ST1. Background Technology

[0002] Soybean [Glycine max (L.) Merr.] is an important oilseed crop worldwide and a significant source of protein and oil for human daily needs. Soybean seeds contain approximately 40% protein and 20% oil in their dry volume. Soybean production accounts for 60% of the world's oilseed crop production and provides about one-third of global vegetable oil consumption.

[0003] Soybeans are a major source of vegetable oil. Fatty acids are the main component of soybean oil, accounting for about 90% of the total fat content. Fatty acids can be classified into saturated and unsaturated fatty acids. Saturated fatty acids include palmitic acid and stearic acid, while unsaturated fatty acids include oleic acid, linoleic acid, and linolenic acid. The unsaturated fatty acids in soybean oil can lower cholesterol levels in the human body, thereby reducing the risk of cardiovascular disease. Furthermore, linolenic acid, an unsaturated fatty acid, cannot be synthesized, metabolized, or converted by the human body and must be obtained from food. A deficiency in linolenic acid can lead to lipid metabolism disorders, resulting in symptoms such as weakened immunity, forgetfulness, fatigue, vision loss, and atherosclerosis. The content and ratio of saturated and unsaturated fatty acids in soybean oil directly affect its quality and uses. Soybean oil, rich in unsaturated fatty acids, is mainly used as an edible vegetable oil. In addition to meeting the body's nutritional needs, its unsaturated fatty acids can also lower cholesterol and have an auxiliary therapeutic effect on hypertension and cardiovascular and cerebrovascular diseases. Therefore, increasing the oleic acid content in soybean oil can both increase the nutritional value of soybeans and ensure the shelf life of soybean oil, which is an important way to improve the quality of soybean oil.

[0004] Identifying key genes regulating seed fatty acid content is helpful for molecular breeding of high-quality soybean varieties with improved fatty acid profiles. Currently, an increasing number of genes regulating oil content are being cloned; for example, soybean DoF-type transcription factors GmDof4 and GmDof11 can significantly increase the total fatty acid content in Arabidopsis seeds. [1] Transcription factor GmbZIP123 can participate in the regulation of lipid accumulation in soybean seeds by controlling the transport of sugars from photoautotissue to the seeds. [2] GmFATA1B has the ability to increase unsaturated fatty acids and seed size, and is an important gene in the biosynthesis pathway of soybean oil and fatty acids. [3] GmOLEO1 actively enhances oil accumulation in soybean seeds by influencing triacylglycerol metabolism. [4]GmSWEET10a and GmSWEET10b can affect the transport of sucrose and hexose, thereby influencing the sugar distribution from the seed coat to the embryo, and thus determining the oil and protein content and seed size in soybeans. [5] The sucrose efflux transporter gene GmSWEET39 is highly expressed in soybean seeds and encodes a plasma membrane localization protein; its expression level is positively correlated with soybean seed oil content. [6] Screening for key genes that regulate the oil content and fatty acid content of soybean seeds is a current research hotspot. It has important theoretical significance for improving soybean varieties and enhancing the quality of soybean oil, and has broad application prospects.

[0005] References:

[0006] [1]WANG HW, ZHANG B, HAO YJ, et al. The soybean Dof-type transcription factor genes, GmDof4 and GmDof11, enhance lipid content in the seeds of transgenic Arabidopsis plants [J]. PlantJournal, 2007, 52(4): 716-729.

[0007] [2]SONG QX, LIQ T, LIU YF, et al. Soybean GmbZIP123 gene enhances lipidcontent in the seeds of transgenic Arabidopsis plants [J]. Journal of Experimental Botany, 2013, 64(14): 4329-4341.

[0008] [3] CAI Z,

[0009] [4]ZHANG D,ZHANG H,HU Z,et al.Artificial selection onGmOLEO1contributes to the increase in seed oil during soybean domestication[J].PLoS Genetics,2019,15(7):e1008267.

[0010] [5]WANG S, LIU S, WANG J, et al. Simultaneous changes in seed size, oilcontent and protein content driven by selection of SWEET homologues during soybean domestication[J]. National Science Review, 2020, 7(11): 1776-1786.

[0011] [6]MIAO L, YANG S, ZHANG K, et al. Natural variation and selection inGmSWEET39 affect soybean seed oil content[J]. New Phytologist, 2020, 225(4):1651-1666. Summary of the Invention

[0012] This invention provides a method and application for regulating the fatty acid content of soybean seeds using the soybean grain shape gene ST1.

[0013] This invention provides the application of the soybean grain shape gene ST1 (Glyma.08g109100) in regulating the fatty acid content of soybean seeds.

[0014] Preferably, the regulation of fatty acid content in soybean seeds includes regulating the content of palmitic acid, oleic acid, linoleic acid, and linolenic acid in soybean seeds.

[0015] Preferably, after inhibiting the soybean grain shape gene ST1, the content of palmitic acid and oleic acid in soybean seeds is significantly increased, while the content of linoleic acid is significantly decreased.

[0016] Preferably, the method of inhibition includes gene editing.

[0017] Preferably, the gene editing tool includes CRISPR / Cas9.

[0018] Preferably, after the soybean grain shape gene ST1 is introduced, the content of linolenic acid in soybean seeds is significantly reduced and the content of linoleic acid is significantly increased.

[0019] Preferably, the method of genetic modification includes Agrobacterium-mediated transformation.

[0020] The present invention also provides a gRNA that inhibits the expression of the soybean grain shape gene ST1, the nucleotide sequence of which is shown in SEQ ID No.1: GGAGGATGAAGGATGTCTTA.

[0021] The present invention also provides a genome complementation vector for transferring the soybean grain shape gene ST1, comprising inserting the soybean grain shape gene ST1 into a plant expression vector to obtain the genome complementation vector;

[0022] The soybean grain shape gene ST1 is Glyma.08g109100.

[0023] The present invention also provides a method for transferring the soybean grain shape gene ST1, which includes transferring the above-mentioned genome complementation vector into Agrobacterium tumefaciens to carry out soybean genetic transformation.

[0024] This invention also provides the application of the soybean grain shape gene ST1 in creating soybean germplasm with different fatty acid contents.

[0025] Beneficial Effects: This invention provides the application of the soybean seed shape gene ST1 in regulating the fatty acid content of soybean seeds. After ST1 gene knockout, the fatty acid content of soybean seeds in the knockout mutant showed significant changes compared to the control group, with significantly increased palmitic acid and oleic acid content and significantly decreased linoleic acid content. This indicates that the loss of function of the ST1 gene significantly reduces the relative content of linoleic acid and increases the relative content of palmitic acid and oleic acid. After ST1 gene transfer, the fatty acid content of soybean seeds in the genome vector complementary transgenic material showed significant changes compared to the control group, with significantly decreased linolenic acid content and significantly increased linoleic acid content. This indicates that the ST1 gene can significantly reduce the relative content of linolenic acid and increase the relative content of linoleic acid. Attached Figure Description

[0026] Figure 1The graph shows the differences in fatty acid content between soybean seeds from the ST1 knockout mutant and the control. Figure A shows the difference in palmitic acid content between the ST1 knockout mutant and the control; B shows the difference in stearic acid content between the ST1 knockout mutant and the control; C shows the difference in oleic acid content between the ST1 knockout mutant and the control; D shows the difference in linoleic acid content between the ST1 knockout mutant and the control; and E shows the difference in linolenic acid content between the ST1 knockout mutant and the control. The labels above each subgraph indicate whether the differences between treatments are significant (ns: P≥0.05; *: P<0.05; **: P<0.01; t-test method; N=3).

[0027] Figure 2 This figure shows the differences in fatty acid content between soybean seeds from ST1 genome vector-complemented transgenic materials and controls. Figure A: Palmitic acid content difference between ST1 genome vector-complemented transgenic materials and controls; B: Stearic acid content difference between ST1 genome vector-complemented transgenic materials and controls; C: Oleic acid content difference between ST1 genome vector-complemented transgenic materials and controls; D: Linoleic acid content difference between ST1 genome vector-complemented transgenic materials and controls; E: Linolenic acid content difference between ST1 genome vector-complemented transgenic materials and controls. The labels above each subfigure indicate whether the differences between treatments are significant (ns: P ≥ 0.05; *: P < 0.05; **: P < 0.01; t-test method; N = 2). Detailed Implementation

[0028] This invention provides the application of the soybean grain shape gene ST1 (Glyma.08g109100) in regulating the fatty acid content of soybean seeds.

[0029] The ST1 (Seed Thickness1) gene described in this invention is a gene that controls the formation of soybean seed shape, with a gene ID of Glyma.08g109100.

[0030] The soybean grain shape gene ST1 described in this invention can regulate the fatty acid content of soybean seeds, preferably including regulating the content of palmitic acid, oleic acid, and linoleic acid in soybean seeds. In embodiments of this invention, it has been demonstrated that inhibiting the soybean grain shape gene ST1 significantly increases the content of palmitic acid and oleic acid in soybean seeds, while significantly decreasing the content of linoleic acid; after transferring the soybean grain shape gene ST1, the content of linolenic acid in soybean seeds significantly decreases, while the content of linoleic acid significantly increases.

[0031] The present invention does not specifically limit the method of inhibition, but preferably includes gene editing, and the gene editing tool in the embodiments preferably includes CRISPR / Cas9. The present invention also does not specifically limit the method of overexpression or transient expression, but preferably includes Agrobacterium-mediated transformation.

[0032] The present invention also provides a gRNA that inhibits the expression of the soybean grain shape gene ST1, the nucleotide sequence of which is shown in SEQ ID No.1: GGAGGATGAAGGATGTCTTA.

[0033] This invention preferably involves editing ST1 using a CRISPR / Cas9 vector. A specific target site is designed within the coding region of the gene to achieve nucleotide mutations that affect gene function. In this embodiment, a 20 bp target sequence is preferably designed in the conserved region of ST1, with the nucleotide sequence shown in SEQ ID No. 1: GGAGGATGAAGGATGTCTTA. Based on this target sequence, the invention designs a gRNA, GGAGGATGAAGGATGTCTTA.

[0034] This invention synthesizes the target sequence and clones it into the Bbs I site of pBlu / gRNA (containing the U6 promoter). The resulting construct is then digested with EcoRI, and the fragment containing the gRNA is transferred into a CRISPR / Cas9 vector to construct a vector that inhibits the expression of the gene. The preferred CRISPR / Cas9 vector in this invention is pYLCRISPR / Cas9Pubi-B, a gift from Professor Liu Yaoguang of South China Agricultural University.

[0035] The present invention also provides a genome complementation vector for transferring the soybean grain shape gene ST1, comprising inserting the soybean grain shape gene ST1 into a plant expression vector to obtain the genome complementation vector;

[0036] The soybean grain shape gene ST1 is Glyma.08g109100.

[0037] In this embodiment of the invention, primers are preferably designed based on the full length of the ST1 gene of GR8836 and the sequence of the first 2.5kb of ATG and the last 1.5kb of TGA. The former has a forward primer (SEQ ID No. 4: ATGCCTGCAGGTCGACTCTAGAGG) and a reverse primer (SEQ ID No. 5: GCTATGACATGATTACGAATTCTGGT), and the latter has a forward primer (SEQ ID No. 6: GTTCCAATCACGCTATTAGT) and a reverse primer (SEQ ID No. 7: GAGTGTTGAAGAGATTCG). Restriction endonuclease EcoRI and BamHI recognition sites and protective bases are introduced at both ends of the primers, respectively. The DNA of GR8836 is extracted using the CTAB method. Using this DNA as a template, an amplification product of 5.8kb in length is obtained. The PCR product containing the corresponding restriction enzyme sites was cut using restriction endonucleases EcoRI and BamHI. The recovered PCR product fragment was ligated to the target vector to clone the above 5.8kb DNA fragment into the plant expression vector pTF101, resulting in a genomic expression vector containing the soybean GR8836ST1 allele, named pTF101-ST1.

[0038] The present invention also provides a method for transferring the soybean grain shape gene ST1, wherein the above-mentioned genome complementation vector is transferred into Agrobacterium to carry out soybean genetic transformation.

[0039] The present invention preferably uses an Agrobacterium-mediated method for genetic transformation. Specifically, it includes transferring the above-mentioned pTF101-ST1 vector plasmid into Agrobacterium strain EHA105 and sending it to the company for soybean genetic transformation. The recipient material is Kefeng No. 1.

[0040] This invention also provides the application of the soybean grain shape gene ST1 in creating soybean germplasm with different fatty acid contents.

[0041] The ST1 gene described in this invention can regulate the fatty acid content of soybeans. Therefore, by inhibiting, knocking down, eliminating, or overexpressing the ST1 gene in the genomes of soybean seeds with different fatty acid contents, the fatty acid content of the soybean seeds can be changed, thereby creating soybean germplasm with different fatty acid contents.

[0042] To further illustrate the present invention, the method and application of the soybean seed fatty acid content regulated by the soybean grain shape gene ST1 provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Example 1

[0044] 1. Constructing CRISPR / Cas9 vectors

[0045] A 20 bp target sequence was designed in the conserved region of ST1 using the online tool CRISPRP v2 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR). The target sequence was synthesized and cloned into the Bbs I site of pBlu / gRNA (containing the U6 promoter). The resulting construct was then digested with EcoRI, and the fragment containing the gRNA was transferred into the CRISPR / Cas9 vector.

[0046] 2. Genetic transformation

[0047] Using the soybean variety Williams82 as the recipient material, genetic transformation was performed. The Glyma.08g109100 gene was edited using a CRISPR / Cas9 vector for verification. A specific target site was designed within the coding region of this gene to achieve nucleotide mutations affecting its function. The constructed genetic transformation vector was transformed into Agrobacterium tumefaciens GV3101, followed by cotyledonary node transformation into the soybean variety Williams82. DNA was extracted from the obtained transgenic plants, and the ST1 gene fragment was amplified using specific primers: forward primer (SEQ ID No. 2: ATTGGCCATGCATGTGTGTG) and reverse primer (SEQ ID No. 3: GGGGCACGGAAAGGATGAAT). The PCR product was purified for Sanger sequencing to detect potential mutations. Sequencing revealed two homozygous positive plants with a 2bp deletion near the target site, causing premature termination of the coding sequence; this was named CasST1.

[0048] The fatty acid content of transgenic T2 seeds was determined using nuclear magnetic resonance (NMR) analysis, and the results are as follows: Figure 1 As shown, the relative content of palmitic acid in the transgenic positive line was approximately 11.91%, significantly higher than the 11.69% in the transgenic negative line; the relative content of oleic acid was approximately 22.06%, significantly higher than the 20.91% in the transgenic negative line; and the relative content of linoleic acid was approximately 55.58%, significantly lower than the 56.72% in the transgenic negative line. This indicates that the ST1 gene can effectively regulate the fatty acid content of soybean seeds.

[0049] Example 2

[0050] 1. Constructing a genome expression vector

[0051] Primers were designed based on the full length of the ST1 gene of GR8836 and the sequence of the first 2.5kb of ATG and the last 1.5kb of TGA. The former has a forward primer (SEQ ID No. 4: ATGCCTGCAGGTCGACTCTAGAGG) and a reverse primer (SEQ ID No. 5: GCTATGACATGATTACGAATTCTGGT), and the latter has a forward primer (SEQ ID No. 6: GTTCCAATCACGCTATTAGT) and a reverse primer (SEQ ID No. 7: GAGTGTTGAAGAGATTCG). Restriction endonuclease EcoRI and BamHI recognition sites and protective bases were introduced at both ends of the primers, respectively. GR8836 DNA was extracted using the CTAB method. Using this DNA as a template, an amplification product of 5.8kb in length was obtained. The PCR product containing the corresponding restriction enzyme sites was cut using restriction endonucleases EcoRI and BamHI. The recovered PCR product fragment was cloned into the modified plant expression vector pTF101 to obtain a genomic expression vector containing the soybean GR8836ST1 allele, named pTF101-ST1.

[0052] 2. Genetic transformation

[0053] Single colonies of Agrobacterium containing the transformation plasmid were selected and verified by PCR. Successfully transformed bacterial solutions were selected, and plasmid extraction experiments were performed using a plasmid extraction kit manufactured by Tiangen Biotech according to the instructions. The pTF101-ST1 vector plasmid was transformed into Agrobacterium strain EHA105 and sent to the company for soybean genetic transformation. The recipient material was Kefeng No. 1. Five T0 generation transgenic positive plants were obtained from the harvested transgenic plants. The T0 generation transgenic positive plants were self-crossed twice, and the T2 generation positive lines were obtained by PCR identification.

[0054] The fatty acid content of transgenic T2 seeds was determined using the method specified in GB 5009.168-2016. The results are as follows: Figure 2 As shown, the relative content of linolenic acid in the transgenic positive lines was approximately 9.15%, significantly lower than the 9.84% in the transgenic negative lines; the relative content of linoleic acid was approximately 55.47%, significantly higher than the 54.98% in the transgenic negative lines. This indicates that the ST1 gene can effectively regulate the fatty acid content of soybean seeds.

[0055] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Soybean grain shape gene ST1 Its application in regulating the fatty acid content of soybean seeds is characterized by... The soybean grain shape gene ST1 for Glyma.08g109100 ; Suppress the soybean grain shape gene ST1 Subsequently, the content of palmitic acid and oleic acid in soybean seeds increased, while the content of linoleic acid decreased; the soybean grain shape gene was then... ST1 After the transfer, the content of linolenic acid in soybean seeds decreased, while the content of linoleic acid increased.

2. The application according to claim 1, characterized in that, The methods of inhibition include gene editing.

3. The application according to claim 1, characterized in that, The methods for genetic modification include Agrobacterium-mediated transformation.

4. Soybean grain shape gene ST1 Its application in creating soybean germplasm with different fatty acid contents is characterized by... The soybean grain shape gene ST1 for Glyma.08g109100 ; Suppress the soybean grain shape gene ST1 Subsequently, the content of palmitic acid and oleic acid in soybean seeds increased, while the content of linoleic acid decreased; the soybean grain shape gene was then... ST1 After the transfer, the content of linolenic acid in soybean seeds decreased, while the content of linoleic acid increased.

Images