Nitrate-responsive gene BnaBT1.1 and its application in breeding of high-nitrogen-efficient rapeseed

CN118910083BActive Publication Date: 2026-09-18HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411114682.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-14
Publication Date
2026-09-18
Estimated Expiration
2044-08-14

AI Technical Summary

Technical Problem

因此,氮利用效率将严重限制油菜产业的发展

Benefits of technology

[0014] Overexpression of the gene BnBT1.1 reduces the absorption and transport capacity of nitrate, thereby decreasing the chlorate sensitivity and nitrogen use efficiency of rapeseed. Therefore, the gene BnBT1.1 can be applied to nitrogen-efficient breeding of rapeseed to screen for nitrogen-efficient rapeseed varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910083B_ABST
    Figure CN118910083B_ABST
Patent Text Reader

Abstract

The application provides a nitrate-responsive gene BnaBT1.1 and application thereof in rapeseed nitrogen-efficient breeding. The nucleotide sequence of the gene BnaBT1.1 is shown in SEQ ID NO:1, and the gene BnaBT1.1 can be used for identifying nitrogen utilization efficiency of rapeseed and applied to rapeseed nitrogen-efficient breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a nitrate-responsive gene BnaBT1.1 and its application in high-nitrogen-efficiency breeding of rapeseed. Background Technology

[0002] Nitrogen is an essential mineral nutrient element for plant growth and development, participating in the synthesis of important macromolecules such as nucleic acids, proteins, and hormones. To ensure crop yields, my country uses a massive amount of nitrogen fertilizer. However, the nitrogen use efficiency of Chinese crops is only 40.2%. On the other hand, although "high-yield, high-nitrogen-input" cultivation management is a crucial guarantee of crop yields, excessive nitrogen fertilizer does not leave the field after harvest. This phenomenon not only exacerbates ecological and environmental pollution but also seriously wastes resources.

[0003] As one of the world's most important oilseed crops, rapeseed is my country's largest domestic source of vegetable oil and second-largest source of feed protein. Currently, the rapeseed planting area continues to increase year by year. Although rapeseed yields are somewhat guaranteed by the large input of nitrogen fertilizer, its nitrogen use efficiency is only half that of cereal crops. Under the current trend of fertilizer conservation and efficiency improvement, while rapeseed yields remain stable, fertilizer input is relatively reduced. Therefore, nitrogen use efficiency will severely limit the development of the rapeseed industry.

[0004] Rapeseed is a nitrate-loving crop, exhibiting good growth after exogenous nitrate supplementation. However, the genetic mechanisms underlying nitrate absorption and utilization in rapeseed are still poorly understood. Investigating the physiological regulatory mechanisms of key genes will provide an important theoretical and practical foundation for improving nitrogen efficiency in rapeseed and cultivating nitrogen-efficient varieties. Summary of the Invention

[0005] The inventors discovered the gene BnaBT1.1 for the first time and clarified its regulatory mechanism in nitrate uptake. Overexpression of BnaBT1.1 in rapeseed negatively regulates the plant's chlorate sensitivity, significantly reduces plant growth and total nitrogen concentration under nitrate-deficient conditions, and inhibits root morphology such as total root number and root tip number. Nitrate concentration also shows a significant decrease in both short-term and long-term conditions. 15 N isotope tracing experiments further showed that overexpression of BnaBT1.1 could inhibit the absorption and transport capacity of rapeseed at a 0.1 mM nitrate level.

[0006] To address the problems existing in the background technology, the present invention provides a nitrate-responsive gene BnaBT1.1 and its application in high-nitrogen-efficiency breeding of rapeseed. This nitrate-responsive gene has a negative regulatory effect on the chlorate sensitivity of rapeseed, and high-nitrogen-efficiency rapeseed varieties can be selected by measuring the expression level of the gene BnaBT1.1.

[0007] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0008] In a first aspect, the present invention provides a nitrate-responsive gene BnaBT1.1, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0009] Secondly, this invention provides the application of the above-mentioned gene in identifying the nitrogen use efficiency of rapeseed. The expression level of gene BnaBT1.1 in different rapeseed varieties is negatively correlated with the nitrogen use efficiency of rapeseed. The higher the expression level of gene BnaBT1.1, the lower the nitrogen use efficiency of rapeseed, and the lower the expression level of gene BnaBT1.1, the higher the nitrogen use efficiency of rapeseed.

[0010] Thirdly, this invention provides the application of the above-mentioned gene BnaBT1.1 in the nitrogen-efficient breeding of rapeseed. The expression level of gene BnaBT1.1 in different rapeseed varieties is negatively correlated with the nitrogen use efficiency of rapeseed. The lower the expression level of gene BnaBT1.1, the higher the nitrogen use efficiency of rapeseed.

[0011] Fourthly, this invention provides a method for screening nitrogen-efficient rapeseed varieties using the gene BnaBT1.1. The method involves measuring the expression level of the gene BnaBT1.1 in a test sample, a known nitrogen-efficient rapeseed sample, and a nitrogen-inefficient rapeseed sample, respectively. An expression line for the gene BnaBT1.1 in nitrogen-efficient rapeseed varieties is set based on the expression levels in the nitrogen-efficient and nitrogen-inefficient rapeseed samples. If the expression level of the gene BnaBT1.1 in the test sample is lower than this expression line, the test sample is a nitrogen-efficient rapeseed variety; if it is higher than this expression line, the test sample is not a nitrogen-efficient rapeseed variety. The nucleotide sequence of the gene BnaBT1.1 is shown in SEQ ID NO:1.

[0012] Furthermore, the expression level of the gene BnaBT1.1 in the roots or aboveground parts of the test sample, known nitrogen-efficient rapeseed samples, and nitrogen-inefficient rapeseed samples was determined.

[0013] The beneficial effects of this invention are:

[0014] Overexpression of the gene BnBT1.1 reduces the absorption and transport capacity of nitrate, thereby decreasing the chlorate sensitivity and nitrogen use efficiency of rapeseed. Therefore, the gene BnBT1.1 can be applied to nitrogen-efficient breeding of rapeseed to screen for nitrogen-efficient rapeseed varieties. Attached Figure Description

[0015] Figure 1This invention analyzes the expression pattern of the gene BnaBT1.1; where A represents the expression level of BnaBT1.1 in different tissues during the seedling stage; B represents the expression level of BnaBT1.1 in different tissues during the maturity stage; C represents the expression pattern of BnaBT1.1 under different nitrate concentrations; and D represents the identification of the expression level in the overexpression lines of BnaBT1.1.

[0016] Figure 2 Subcellular localization analysis of gene BnaBT1.1 provided for the examples; wherein, A is the localization analysis of BnaBT1.1 in the cytoplasm; B is the localization analysis of BnaBT1.1 in the cell nucleus.

[0017] Figure 3 Phenotypic analysis of the gene BnaBT1.1 provided in the examples after overexpression in rapeseed followed by chlorate treatment; wherein, A represents the growth phenotype of BnaBT1.1 overexpressing lines and wild-type rapeseed after normal culture followed by chlorate treatment; B represents the relative fresh weight of BnaBT1.1 overexpressing lines and wild-type rapeseed after normal culture followed by chlorate treatment; C represents the chlorate sensitivity index of BnaBT1.1 overexpressing lines and wild-type rapeseed after normal culture followed by chlorate treatment; D represents the growth phenotype of BnaBT1.1 overexpressing lines and wild-type rapeseed after low nitrate concentration culture followed by chlorate treatment; E represents the relative fresh weight of BnaBT1.1 overexpressing lines and wild-type rapeseed after low nitrate concentration culture followed by chlorate treatment; F represents the chlorate sensitivity index of BnaBT1.1 overexpressing lines and wild-type rapeseed after low nitrate concentration culture followed by chlorate treatment.

[0018] Figure 4 The following is an example of phenotype identification of the response to nitrate after overexpression of the gene BnaBT1.1 in Brassica napus. In this example, A represents the growth phenotype of the BnaBT1.1 overexpressing line and the wild-type (W10) in Brassica napus at 6 mM and 0.1 mM nitrate concentrations; B and C represent the fresh weight of the aboveground parts and roots; and D and E represent the dry weight of the aboveground parts and roots.

[0019] Figure 5This document presents an analysis of the root structure of wild-type rapeseed (Brassica napus) in response to nitrate after overexpression of the gene BnaBT1.1 in nitrate-tolerant plants, as provided in the examples. Specifically, A represents the total number of roots in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions; B represents the total number of root tips in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions; C represents the total root length in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions; D represents the average root diameter in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions; E represents the root surface area in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions; and F represents the total root volume in wild-type rapeseed and the BnaBT1.1 overexpression material under normal and low nitrate conditions.

[0020] Figure 6 This study analyzed the nitrogen content of the gene BnaBT1.1 provided in the examples after overexpression in Brassica napus at different nitrate concentrations. Specifically, A and B represent the total nitrogen concentration of the aboveground parts and roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; C represents the total nitrogen concentration of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; D and E represent the total nitrogen content of the aboveground parts and roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; and F represents the nitrogen uptake efficiency of the roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations.

[0021] Figure 7 Analysis of uptake and transport of the gene BnaBT1.1 provided in the examples under different nitrate concentrations after overexpression in Brassica napus. A and B represent the nitrate concentrations in the aboveground parts and roots of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations; C represents the nitrate uptake rate of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations; D represents the total nitrate concentration of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations; E represents the nitrate concentration in the xylem sap of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations; F represents the nitrate transport analysis of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations.

[0022] Figure 8 The results show the differential expression of the gene BnaBT1.1 in chlorate-sensitive (CSG) and chlorate-insensitive (CIG) varieties. Detailed Implementation

[0023] The principles and features of the present invention are described below with reference to the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0024] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0025] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. Reagents not specifically described in detail herein are conventional reagents and are commercially available; methods not specifically described in detail are conventional experimental methods and are known from the prior art.

[0026] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0027] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0028] In this application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may contain a regulatory sequence (5' non-coding region) preceding the coding sequence and a regulatory sequence (3' non-coding region) following it.

[0029] In this application, the term "expression vector" refers to a vector that adds expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton (empty skeleton) of a cloning vector to enable the expression of the target gene.

[0030] In this application, the term "infusion seamless cloning" refers to an enzyme-free ligation technique in expression vector construction, primarily derived from the discovery of infusion enzymes. Infusion enzymes can recognize any 16 bases from the 5'-3' ends of linearized DNA fragments, forming sticky ends. Target plasmids, after linearization via enzyme digestion or PCR, can also be recognized by infusion enzymes. Only the sticky ends formed by the vector and gene need to be complementary; the vector construction can be completed through an annealing process.

[0031] In this application, the term "nucleic acid molecule" refers to a polymer of RNA or DNA that is single-stranded or double-stranded and optionally contains synthetic, non-natural, or modified nucleotide bases. Nucleic acid molecules in the form of DNA polymers may consist of one or more segments of cDNA, genomic DNA, or synthetic DNA.

[0032] The present invention provides a nitrate-responsive gene BnaBT1.1, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0033] SEQ ID NO:1

[0034] ATGCCAGAGATGCATCCCTTCAAGACATCCCACACAAAACTTACCCAAATCCTTTGTCTGAAACCAAGAGCTGTCCTAGTTACGATGGCCATAACTGCTACTCAAAACGACGCTGTTTCGTTATCAGCCGATAAGATTTCATATGATCTTGTGGAAACTGATGTTGACATCATCACTTCCGGTCGCCGTCGTATTCCGGCACACTCCGGCGTACTGGCTTCTGCGTCGCCGGTACTTACCAACATCATCGAGAAGCCGAGGAAAAGCCACGGCGGACGCGGATCATCGAAGAGAGTGGTTAAGATTCTCGGCGTTCCATGTGACGCCGTTTCAGTCTTCGTTAGATTCCTCTACTCTCCCAGTTTGACGGAGAAGGAAATGGAGAATTATGGAATCCATCTACTTGCTCTATCACACGTGTACATGGTGCCTCAGCTTAAGCAAAGGTGCACGAAAGGCGTCGGCGAGAGAGTGACGGCAGAGAACGTGGTCGATGTTCTCCAACTAGCTCGGCTTTGCGACGCACCTGGCCTCTGTCTCAAGTGTATGCGTTTGATCCACTCAAAGTTCAAGACCGTTGAGCAAACCGAAGGATGGAAGTTTCTTCAAGAACACGATCCTTTGCTTGAACTCGACATTCTCCAGTTCATCGATGAGGCTGAATCGAGGAAGAAAAGAAGACGGAGACACAGACGAGAACAGAATCTTTATATGCAATTGAGTGAAGCCATGGAATGTATCGAGCACATATGCACTGAAGGTTGCACGTTGGTAGGACCATCGTCCAACTTAGACAA CAAGAAGTCAACATCTCAAGTAAAAACCAGTCCATGCAGTGCTTTCTCGACTTGTTACGGACTCCAACTTTTGATACGTCACTTTGCAATCTGCAAGAAACGAGTCGATGGCAAAGGTTGTCTTCGTTGTAA GAGAATGATTCAACTCCTTAGACTCCATTCTTCAATCTGCGACCAATCTGAGTCTTGTCGTGTCCCACTTTGCAGTAGGAAATTTAAGAATAGAGGAGAAATGGACAATAAAATGGCCGAGGACACAAAGTG GACGGTTCTAGTGAGAAGAGTTGCGTCTGCGAAAGCCATGTCTTCATTGTCTCAATCAAAGAAGCAGAAAAGTGAAGTGTTATTCAAAGAAGAAGCTGAAGATTTCATCAGAATCAGGAAGGAGTTATTTTGA

[0035] To determine the effects of the nitrate-responsive gene BnaBT1.1 and its encoded protein on nitrogen use efficiency in rapeseed and its role in genetic breeding, the inventors overexpressed BnaBT1.1. Compared to the wild type, this resulted in decreased sensitivity to chlorate in the plant. Simultaneously, under nitrate-deficient conditions, it significantly reduced plant growth and total nitrogen concentration, and inhibited root morphology such as total root number and root tip number. Nitrate concentration also showed a significant decrease. Therefore, the inventors provided an application of this gene in identifying nitrogen use efficiency in rapeseed. The expression level of the BnaBT1.1 gene in different rapeseed varieties was negatively correlated with nitrogen use efficiency; higher expression levels of BnaBT1.1 corresponded to lower nitrogen use efficiency, and vice versa.

[0036] This invention provides the application of the above-mentioned gene BnaBT1.1 in nitrogen-efficient breeding of rapeseed. The expression level of gene BnaBT1.1 in different rapeseed varieties is negatively correlated with the nitrogen use efficiency of rapeseed. The lower the expression level of gene BnaBT1.1, the higher the nitrogen use efficiency of rapeseed.

[0037] This invention further provides a method for screening nitrogen-efficient rapeseed varieties using the gene BnaBT1.1. The expression levels of the gene BnaBT1.1 are measured in the sample to be tested, known nitrogen-efficient rapeseed samples, and nitrogen-inefficient rapeseed samples. An expression line for the gene BnaBT1.1 in nitrogen-efficient rapeseed varieties is set based on the expression levels in the nitrogen-efficient and nitrogen-inefficient rapeseed samples. If the expression level of the gene BnaBT1.1 in the sample to be tested is lower than the expression line, the sample is considered a nitrogen-efficient rapeseed variety; if it is higher than the expression line, the sample is not a nitrogen-efficient rapeseed variety. The nucleotide sequence of the gene BnaBT1.1 is shown in SEQ ID NO:1.

[0038] Furthermore, the expression level of the gene BnaBT1.1 in the roots or aboveground parts of the test sample, known nitrogen-efficient rapeseed samples, and nitrogen-inefficient rapeseed samples was determined.

[0039] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0040] The molecular biology experiments in the following examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation. These were primarily conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook et al., published by Science Press. Specific experimental conditions could be determined through simple experiments if necessary. PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments could be made through simple experiments if necessary.

[0041] The formula for Avdolin nutrient solution is shown in Table 1 below.

[0042] Table 1

[0043] <![CDATA[NaH2PO4·2H2O]]> 0.156g / L <![CDATA[MgSO4·7H2O]]> 0.986g / L KCl 0.149g / L <![CDATA[CaCl2·2H2O]]> 0.476g / L <![CDATA[H3BO3]]> 2.00 mg / L <![CDATA[MnCl2·4H2O]]> 1.81 mg / L <![CDATA[Na2MoO4·2H2O]]> 0.12 mg / L <![CDATA[ZnSO4·7H2O]]> 0.22 mg / L <![CDATA[CuSO4·5H2O]]> 0.08 mg / L <![CDATA[Na2EDTA]]> 7.445 mg / L <![CDATA[FeSO4·7H2O]]> 55.6 mg / L

[0044] Example 1: Analysis of gene expression pattern BnaBT1.1

[0045] (1) Rapeseed seedling cultivation conditions:

[0046] Select plump and uniform wild-type rapeseed seeds "Westar10", soak them in tap water for 2 hours, drain, purify at 4℃ for 4 hours, and then place them in a 30℃ incubator to break the shells. After uniform germination, grow the seeds in 0.5M CaCl2 pure water for 5 days, then select seedlings with uniform growth and grow them in a solution containing 6mM NO3. - After culturing in Avdolin nutrient solution for 12 days, samples were taken from six sites: roots, hypocotyls, cotyledons, fully expanded leaves, new leaves, and petioles, for RNA extraction to analyze the expression of BnaBT1.1 in these tissues during the seedling stage. Results are as follows: Figure 1 As shown in A and 1B, Figure 1 A indicates that the expression of the rapeseed gene BnaBT1.1 is relatively high in the cotyledons, fully expanded leaves, new leaves, and petioles during the seedling stage. Figure 1 B indicates that during the mature stage, the expression levels of BnaBT1.1 in different parts of the plant, in descending order, are old leaves, middle leaves, branches, new leaves, and roots, while they are relatively lower in stems, leaf nodes, flowers, and siliques.

[0047] (2) Cultivation conditions of rapeseed with different nitrate concentrations

[0048] Select plump and uniform wild-type rapeseed seeds "Westar10", soak them in tap water for 2 hours, drain, then purify at 4℃ for 4 hours and place them in a 30℃ incubator to break the shells. After uniform germination, grow the seeds in 0.5M CaCl2 pure water for 5 days, then select seedlings with uniform growth and grow them in a solution containing 6mM NO3. - Seedlings were acclimatized in Avdolin nutrient solution for 6 days, then treated with 0 μM, 100 μM, and 6000 μM nitrate concentrations for 7 days. Roots, fully expanded leaves, and new leaves were collected to analyze the expression changes of BnaBT1.1 in different tissues during the seedling stage in response to nitrate. The nutrient solution was changed every three days. Results are as follows: Figure 1 As shown in Figure C, under a nitrate concentration of 6000 μM, the expression level of BnaBT1.1 in fully expanded leaves and roots was significantly increased compared to the nitrate environments of 0 μM and 100 μM.

[0049] (3) Subcellular localization of gene BnaBT1.1

[0050] The CDS sequence of the gene BnaBT1.1 was searched in the rapeseed database (https: / / yanglab.hzau.edu.cn / ), and primers were designed to amplify the 1107 bp target fragment. Primers F1 and R1 were used. The target fragment was fused with the PM999-GFP vector using the Infusion seamless cloning technique to form 35S::GFP-BnaBT1.1 (PM999-GFP was linearized by PCR amplification using primers F2 and R2). In the Arabidopsis protoplast system, healthy Arabidopsis leaf protoplasts were extracted and transformed into the high-quality, high-concentration 35S::GFP-BnaBT1.1 plasmid obtained by plasmid large-scale extraction using the PEG transformation method. After static culture for 10 h, the subcellular localization of BnaBT1.1 was observed under a confocal microscope.

[0051] The CDS sequence is shown in SEQ ID NO:1.

[0052] F1:ATGGCCATAACTGCTACTC(SEQ ID NO:2)

[0053] R1:TCAAAATAACTTCTTCCTGATTCTG(SEQ ID NO:3)

[0054] F2:GATGAACTATACAAA(SEQ ID NO:4)

[0055] R2:TCGGGAATTGGATCC(SEQ ID NO:5)

[0056] Figure 2 The analysis showed that the GFP-BnaBT1.1 fusion protein could co-localize with the cytoplasmic Maker, indicating that it could be expressed in the cytoplasm. Figure 2 B indicates that, in addition to the cytoplasm, the GFP-BnaBT1.1 fusion protein can also co-localize with AtNSR-mCherry in the cell nucleus.

[0057] Example 2: Construction of Brassica rapa BnaBT1.1 overexpression lines

[0058] (1) Construction of the overexpression vector for gene BnaBT1.1

[0059] The CDS sequence of the gene BnaBT1.1 was searched in the rapeseed database (https: / / yanglab.hzau.edu.cn / ), and primers were designed to amplify the 1107 bp target fragment. The primers were F1 and R1, respectively. The target fragment was fused with the PMDC83-GFP vector using the Infusion seamless cloning technique to form 35S::BnaA02.GLN1;2-GFP (KpnⅠ restriction site). After the vector was constructed, it was transformed into Agrobacterium for rapeseed hypocotyl infection.

[0060] (2) Infection and transformation of the BnaBT1.1 gene overexpression vector in rapeseed

[0061] Agrobacterium carrying 35S::BnaBT1.1-GFP was used to infect the hypocotyl of rapeseed. The specific steps were as follows:

[0062] 1) Sterilization. Select plump Weatar10 seeds and soak them in 75% alcohol for 1 minute; rinse the soaked seeds with sterile water and sterilize them with an appropriate amount of 84 disinfectant (diluted 3-4 times) for 15-20 minutes; after sterilization, rinse them with sterile water 8-10 times on a sterile workbench.

[0063] 2) Sowing. Sow the sterilized seeds in the prepared MO medium, about 30-50 seeds per dish; then incubate in the dark for 5-6 days until the hypocotyl reaches a certain height, but not too long.

[0064] 3) Shaking incubation. One day in advance, culture the cultured strain in sterile Erlenmeyer flasks or centrifuge tubes at 28°C and 200 rpm in a shaker, depending on the hypocotyl growth. For infection, centrifuge the cultured strain (OD generally around 0.4-0.6) at 6000 rpm for 10 minutes, discard the supernatant, resuspend the culture in an equal volume of DM, centrifuge again under the same conditions, discard the supernatant, resuspend in DM, and dilute for later use (bacterial culture:DM = 1:10).

[0065] 4) Preparation and infection of explants. First, in a sterile workbench, use sterile forceps and a scalpel to cut the hypocotyls of rapeseed to 0.8-1 cm each, and perform the entire operation in M1 liquid medium. Introduce the prepared bacterial solution into M1 liquid medium for infection for 20 min, shaking once every 5 min. After infection, transfer to M1 solid medium for incubation in the dark at 24℃. After 2 days, transfer to M2 medium for light incubation (24℃, 16 h day / 8 h night). After two weeks, transfer to M3 medium until green shoots appear, changing the medium once every 2 weeks. Finally, transfer to M4 medium for rooting.

[0066] 5) Subculture. Rooted seedlings are cultured in a greenhouse to obtain T0 generation seeds, and hygromycin tags and expression levels are identified through breeding. Positive seedlings are screened and subcultured repeatedly until homozygous lines are obtained.

[0067] (3) Expression of BnaBT1.1 in BnaBT1.1 overexpression strains in rapeseed

[0068] Wild-type rapeseed 'Westar10' and BnaBT1.1 overexpression materials were cultured in normal nutrient solution for 12 days, followed by root and shoot sampling. RNA was extracted to analyze the BnaBT1.1 expression level between the overexpression materials and the wild-type. The results are as follows: Figure 1 As shown in D, the expression level in the constructed overexpression material was increased by 2 to 6 times compared to the wild type.

[0069] (4) Chlorate sensitivity analysis of BnaBT1.1 overexpression lines in rapeseed

[0070] Two treatment methods were used to analyze the chlorate sensitivity of rapeseed: one method involved culturing in 6mM KNO3 for 3 days followed by culturing in 6mM KClO3 for 2 days to determine relevant indicators, including the relative fresh weight of the aboveground parts before and after chlorate treatment (fresh weight of aboveground parts before chlorate treatment - fresh weight of aboveground parts after chlorate treatment) and the chlorate sensitivity index (relative fresh weight / fresh weight of aboveground parts before chlorate treatment * 100%); the other method involved culturing in 0.1mM KNO3 for 3 days followed by culturing in 6mM KClO3 for 2 days.

[0071] The results are as follows Figure 3As shown, A represents the growth phenotype of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following normal culture; B represents the relative fresh weight of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following normal culture; C represents the chlorate sensitivity index of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following normal culture; D represents the growth phenotype of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following low nitrate concentration culture; E represents the relative fresh weight of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following low nitrate concentration culture; and F represents the chlorate sensitivity index of BnaBT1.1 overexpressing lines and wild-type Brassica napus after chlorate treatment following low nitrate concentration culture.

[0072] Figure 3 The results showed that under the initial treatment with 6 mM nitrate, the phenotypic differences between the BnaBT1.1 overexpression material and W10 were relatively small. Compared with W10, the relative fresh weight of OEBnaBT1.1-1 / 2 decreased by 30.32% and 32.33%, respectively, while the chlorate sensitivity index also decreased significantly by 27.90% and 34.41%, respectively. However, under the treatment with 0.1 mM nitrate, the phenotypic differences between the BnaBT1.1 overexpression material and W10 increased significantly. Compared with W10, the relative fresh weight of OEBnaBT1.1-1 / 2 decreased by 44.56% and 50.45%, respectively, while the chlorate sensitivity index also decreased significantly by 21.41% and 24.91%, respectively.

[0073] (5) Phenotypic analysis of nitrate response in BnaBT1.1 overexpression lines in rapeseed

[0074] 1) Determination of growth phenotype-related indicators in rapeseed lines overexpressing BnaBT1.1.

[0075] Select plump and uniform wild-type "Westar10" seeds and BnaBT1.1 overexpression lines. Soak in tap water for 2 hours, drain, and then purify at 4℃ for 4 hours before incubating at 30℃ to break the shell. After uniform germination, grow the seeds in 0.5M CaCl2 pure water for 5 days. Select seedlings with uniform growth and then incubate them in a solution containing 6mM NO3. - Seedlings were acclimated in a nutrient solution containing avtocin for 6 days, followed by treatment with 6 mM and 0.1 mM NO3. - Treatment lasted 9-12 days. Sampling was performed on both the aboveground parts and roots for relevant parameter measurements. Biomass, total nitrogen concentration, and content required dry samples, while nitrate concentration measurements required fresh samples. Results are as follows: Figure 4 , Figure 5 and Figure 6 As shown.

[0076] Figure 4 This study aimed to identify the phenotype of nitrate response after overexpression of the gene BnaBT1.1 in Brassica napus. Figure A shows the growth phenotypes of the BnaBT1.1 overexpressing lines and the wild-type (W10) in Brassica napus at nitrate concentrations of 6 mM and 0.1 mM; B and C represent the fresh weight of the aboveground parts and roots; and D and E represent the dry weight of the aboveground parts and roots. Figure 4A indicates that under low nitrate concentration (0.1 mM), the growth level of the BnaBT1.1 overexpressing lines was significantly lower than that of the wild type. Figure 4 B and C indicate that the aboveground fresh weight of OEBnaBT1.1-1 / 2 was significantly reduced by 46.26% and 42.72% respectively compared to W10, while the fresh weight of the roots was significantly reduced by 28.02% and 29.59% respectively. Figure 4 Figures D and E show that the aboveground dry weight of OEBnaBT1.1-1 / 2 was significantly reduced by 14.30% and 27.23%, and the root dry weight decreased by 10.15% and 25.44%. These results indicate that overexpression of BnaBT1.1 had a significant negative regulatory effect on the growth of Brassica napus under low nitrate concentration conditions.

[0077] Figure 5 This study analyzed the root structure of *Brassica napus* in response to nitrate after overexpression of the gene BnaBT1.1 in nitrate-tolerant rapeseed. Specifically, A represents the total number of roots in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions; B represents the total number of root tips in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions; C represents the total root length in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions; D represents the average root diameter in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions; E represents the root surface area in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions; and F represents the total root volume in wild-type rapeseed and BnaBT1.1 overexpression materials under normal and low nitrate conditions. Figure 5 A and 5B show that, compared to the previous conditions, the total number of roots of OEBnaBT1.1-1 / 2 was significantly reduced by 19.79% and 19.17% under the 0.1 mM nitrate concentration, while the total number of root tips decreased by 16.32% and 30.64% respectively. Figure 5 C and D show no difference in total root length and average root diameter between OEBnaBT1.1-1 / 2 and W10; 5E and F show that the total root surface area and total root volume of OEBnaBT1.1-1 / 2 were also significantly inhibited under the condition of 0.1 mM nitrate concentration, at 10.37% and 10.62% and 25.38% and 60.68%, respectively.

[0078] Figure 6This study analyzed the nitrogen content of the gene BnaBT1.1 after overexpression in Brassica napus at different nitrate concentrations. Specifically, A and B represent the total nitrogen concentration of the aboveground parts and roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; C represents the total nitrogen concentration of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; D and E represent the total nitrogen content of the aboveground parts and roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations; and F represents the nitrogen uptake efficiency of the roots of the BnaBT1.1 overexpressing line and the wild-type (W10) Brassica napus at 6 mM and 0.1 mM nitrate concentrations. Figure 6 A and 6B show that under 6 mM nitrate culture conditions, the nitrogen concentration in the roots of OEBnaBT1.1-1 / 2 was significantly increased by 12.47% and 20.32% compared to W10, while the nitrogen concentration in the roots of OEBnaBT1.1-1 / 2 was not different under low nitrate concentration conditions, but was significantly decreased by 17.15% and 23.01% mainly in the aboveground parts. Figure 6 C indicates that there is a significant difference between the two under the condition of 0.1 mM nitrate concentration, with OEBnaBT1.1-1 / 2 decreasing significantly by 12.62% and W10 respectively. Figure 6 D and E indicate that, compared to W10, the BnaBT1.1 overexpression lines showed a significant reduction in nitrogen content in the shoots and roots, on average, by 36.34% and 19.32%, respectively, under 0.1 mM nitrate conditions. Figure 6 F indicates that overexpression of BnaBT1.1 significantly reduced the nitrogen uptake capacity of roots by an average of 16.58% under nitrate-deficient conditions, suggesting that it may play a certain regulatory role in nitrate uptake in Brassica napus.

[0079] 2) Determination of nitrate uptake rate in BnaBT1.1 overexpression lines of rapeseed

[0080] use 15 Nitrogen isotope tracing methods are divided into short-term and long-term treatments. Among them, short-term... 15 The nitrogen isotope tracing method was as follows: After 3 days of nitrogen-deficient treatment (0 mM KNO3), the plants were washed in 0.1 mM CaSO4 for 1 minute, and then the BnaBT1.1 overexpression line and W10 were respectively transformed into... 15 Treatment with N-labeled 6 mM and 0.1 mM KNO3 for 10 minutes ( 15Nitrogen abundance: 10.38%. After treatment, roots from different strains were sampled, washed in 0.1 mM CaSO4, and then dried in an oven. Later, sample preparation was performed, and the results were obtained using an elemental analyzer-isotope mass spectrometer (EA-Delta VMS, Thermo, USA). 15 N and total nitrogen content were used to calculate the root nitrate uptake rate of the BnaBT1.1 overexpression line and W10. Long-term... 15 The nitrogen isotope tracing method extends the culture time to 3 days, and root and aerial part samples are taken after sample preparation. 15 The N and total nitrogen contents were determined to clarify the nitrate transport capacity among different strains. Results are as follows: Figure 7 As shown.

[0081] in Figure 7 A and 7B represent the nitrate concentrations in the aboveground parts and roots of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations, respectively; C represents the nitrate uptake rate of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations, respectively; D represents the total nitrate concentration of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations, respectively; E represents the nitrate concentration in the xylem sap of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus at 6 mM and 0.1 mM nitrate concentrations, respectively; F represents the long-term nitrate concentration of the BnaBT1.1 overexpressing line and wild-type (W10) of Brassica napus. 15 Analysis of nitrate transport at 6 mM and 0.1 mM nitrate concentrations using N isotope tracer processing. Figure 7 A and B indicate that under normal culture conditions, there were no significant differences between OEBnaBT1.1-1 / 2 and W10 in either the aerial parts or roots. However, under 0.1 mM nitrate conditions, the nitrate concentration in the aerial parts of OEBnaBT1.1-1 / 2 was significantly lower than that in W10, decreasing by 46.07% and 31.60% respectively. In the roots, the nitrate concentration in OEBnaBT1.1-2 increased by 110.00%, and OEBnaBT1.1-1 showed a similar trend. Figure 7 D indicates that OEBnaBT1.1-1 / 2 still has a strong negative regulatory effect on the total nitrate concentration of plants under nitrate-deficient conditions, significantly reducing it by 45.36% and 28.59%, respectively. Figure 7 E showed that OEBnaBT1.1-1 / 2 decreased significantly compared to W10 by approximately 41.46% and 16.83% only at 0.1 mM nitrate concentration, while there was no difference at 6 mM nitrate concentration; at the same time Figure 7Long-term 15N isotope tracing experiments of F further demonstrated that, under low nitrate conditions, OEBnaBT1.1-1 / 2 15 NO3 - The translocation of the content from the roots to the aboveground parts was significantly reduced by 32.48% and 10.28%. Figure 7 C indicates that the absorption rate of W10 under 0.1 mM nitrate treatment is approximately 7.84 μmol·g. -1 root DW·min -1 While OEBnaBT1.1-1 / 2 is only 7.54 μmol·g -1 root DW·min -1 and 7.58 μmol·g -1 root DW·min -1 This represents a relative decrease of 3.75% and 3.31%.

[0082] Example 3: Differential expression of gene BnaBT1.1

[0083] Three samples each of chlorate-sensitive genotype (CSG) and chlorate-insensitive genotype (CIG) varieties were taken. Seeds of the extreme chlorate-sensitive varieties, plump and uniform, were soaked in tap water for 2 hours, drained, purified at 4℃ for 4 hours, and then placed in a 30℃ incubator for shell breaking. Seeds with uniform germination were grown in 0.5M CaCl2 pure water for 5 days. Seedlings with uniform growth were then selected and placed in a solution containing 6mM NO3. - Seedlings were acclimated in a nutrient solution containing avtocin for 6 days, followed by treatment with 6 mM and 0.1 mM NO3. - The treatment lasted 7 days, with the nutrient solution changed every three days. Total RNA was extracted from the aboveground parts and roots of six chlorate-sensitive extreme varieties, and the expression level of the gene BnaBT1.1 was determined. Results are as follows: Figure 8 As shown, at a nitrate concentration of 6 mM, BnBT1.1 exhibited relatively high expression levels in both the shoots and roots of the CIG genotype, increasing by 71.28% and 70.62% respectively compared to the CSG genotype. There was no difference in BnBT1.1 expression levels between the two genotypes at a nitrate concentration of 0.1 mM. These data suggest that the chlorate-sensitive genotype (CSG) has lower BnBT1.1 gene expression levels compared to the chlorate-insensitive genotype (CIG), and that the BnBT1.1 gene is a negative regulator of nitrogen use efficiency.

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Genes BnaBT1.1 Its application in assessing the nitrogen use efficiency of rapeseed is characterized by... Genes in different rapeseed varieties BnaBT1.1 The expression level of this gene is negatively correlated with the nitrogen use efficiency of rapeseed. BnaBT1.1 The higher the expression level of [gene name], the lower the nitrogen use efficiency of rapeseed. BnaBT1.1 The lower the expression level of the gene, the higher the nitrogen use efficiency of rapeseed; wherein, the gene BnaBT1.1 This is a nitrate-responsive gene, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. Genes BnaBT1.1 Its application in high-nitrogen-efficiency breeding of rapeseed is characterized by, Genes in different rapeseed varieties BnaBT1.1 The expression level of this gene is negatively correlated with the nitrogen use efficiency of rapeseed. BnaBT1.1 The lower the expression level of the gene, the higher the nitrogen use efficiency of rapeseed; wherein, the gene BnaBT1.1 This is a nitrate-responsive gene, and its nucleotide sequence is shown in SEQ ID NO:

1.

3. A method utilizing genes BnaBT1.1 A method for screening nitrogen-efficient rapeseed varieties, characterized in that, Genes were measured in the test sample, known nitrogen-efficient rapeseed samples, and nitrogen-inefficient rapeseed samples, respectively. BnaBT1.1 The expression levels were determined based on the gene expression levels in nitrogen-efficient and nitrogen-inefficient rapeseed samples. BnaBT1.1 Gene expression levels were set for nitrogen-efficient rapeseed varieties. BnaBT1.1 The expression line, if the gene of the sample to be tested... BnaBT1.1 If the expression level is below the expression line, the sample to be tested is a nitrogen-efficient rapeseed variety; if it is above the expression line, the sample to be tested is not a nitrogen-efficient rapeseed variety. The gene BnaBT1.1 The nucleotide sequence is shown in SEQ ID NO:

1.

4. The use of genes according to claim 3 BnaBT1.1 A method for screening nitrogen-efficient rapeseed varieties, characterized in that, Genes were measured in the roots or aboveground parts of the test samples, known nitrogen-efficient rapeseed samples, and nitrogen-inefficient rapeseed samples. BnaBT1.1 The amount of expression.