A molecular marker associated with early fruit maturity in pyrus and use thereof

Abstract

The application discloses a molecular marker related to early maturity of pear fruits and application thereof, and belongs to the field of molecular markers and biological breeding. The SNP site FM_22516479 screened by the application is located at the 22516479th base on the 6th chromosome of a pear genome, the polymorphism of the SNP site FM_22516479 is G or T, the SNP site FM_22516479 is G in the fruits of late-maturing hybrid offspring, and the SNP site FM_22516479 is T in the fruits of early-maturing hybrid offspring. The SNP site FM_22516479 developed by the application is used to design specific primers, and a high-resolution melting curve method is used to well type the maturity of the pear fruits. The application can be used for molecular marker assisted selection breeding of early-maturing pear fruit varieties, is beneficial to accelerating the genetic improvement process of the pear varieties, and improves the breeding selection rate.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and molecular breeding, specifically relating to a molecular marker, amplification primer and its application related to early ripening of pear fruit. Technical Background

[0002] Pears are one of my country's important economic fruit trees, and are widely cultivated in 87 countries worldwide. Their fruit is highly nutritious, with crisp, juicy flesh and a delicious flavor, making them popular with consumers. In recent years, early-maturing pears have gained increasing attention due to their ability to seize market opportunities and meet consumer demand for fresh fruit, indicating a promising market prospect. Therefore, breeding early-maturing pears is a very important goal.

[0003] Pear trees are perennial deciduous fruit trees with a long juvenile stage, requiring a long conventional breeding period. Furthermore, the pear genome has a high degree of heterozygosity (Wu et al., 2013), resulting in complex and variable phenotypic traits and traits, which are significantly influenced by the environment. In recent years, the rapid development of high-throughput sequencing technology has enabled the efficient use of molecular markers in fruit trees to construct high-density genetic maps, allowing for a more comprehensive discovery of QTL loci associated with agronomic traits. Therefore, the development of molecular markers has become a key research direction.

[0004] Currently, there is a lack of germplasm for early-maturing pears, and research on the ripening period of pear fruits is limited. The development and application of SNP molecular markers related to early ripening in pears have not yet been reported. Therefore, conducting research on the ripening period of pear fruits and developing SNP molecular markers related to early ripening in pears will help to understand and regulate the ripening process of pear fruits, improve fruit quality, accelerate the breeding process of early-maturing pears, and meet the diverse needs of consumers. Summary of the Invention

[0005] The purpose of this invention is to provide a SNP locus FM_22516479 associated with early ripening of pear fruit and its application. Based on QTL mapping results, this invention develops the SNP molecular marker FM_22516479 associated with early ripening of pear, identified using high-resolution melting curves, along with its amplification primers and applications. Using this molecular marker, early identification and screening of the ripening period of segregating populations can be performed at the DNA level, enabling early prediction of the timing of pear fruit ripening and providing locus information and marker resources for the breeding of early-maturing pear varieties.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] In a first aspect, the present invention seeks protection for the use of a substance for detecting the polymorphism or genotype of the SNP locus FM_22516479 in any of the following:

[0008] (A1) Application in identifying or assisting in the identification of the early maturity period of pear varieties;

[0009] (A2) Application in the preparation of products for identifying or assisting in the identification of the early maturity period of pear varieties;

[0010] (A3) Application in screening or breeding early-maturing pear varieties;

[0011] (A4) Application in the preparation of products for screening or breeding early-maturing pear varieties;

[0012] (A5) Application in molecular marker-assisted breeding or germplasm resource identification of early-maturing pear varieties;

[0013] The SNP locus FM_22516479 is located at the 22516479th base on chromosome 6 of the pear genome. The physical location of the SNP locus FM_22516479 was determined based on the whole genome sequence of the pear, whose accession number is AJSU00000000. The polymorphism of the SNP locus FM_22516479 is G or T. In late-maturing hybrid offspring, the SNP locus FM_22516479 is G, while in early-maturing hybrid offspring, it is T.

[0014] Furthermore, the substance is (B1) or (B2) or (B3) as follows:

[0015] (B1) PCR primers for amplifying the pear genomic DNA fragment containing the SNP site FM_22516479;

[0016] (B2) PCR reagents containing the PCR primers described in (B1);

[0017] (B2) A kit containing the PCR primers described in (B1) or the PCR reagents described in (B2).

[0018] Furthermore, the PCR primers include an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2.

[0019] Upstream primer: GTTACTGTGAGGATAAGGGGATGAGAGGACT (SEQ ID NO.1);

[0020] Downstream primer: CAGGAAAAGAGATGTAACGATTTGAGGGAA (SEQ ID NO.2).

[0021] Secondly, the present invention seeks protection for the use of the aforementioned substance or the aforementioned PCR primers in the preparation of products for detecting the polymorphism or genotype of the SNP locus FM_22516479.

[0022] Thirdly, this invention claims protection for a product containing the aforementioned substances or the aforementioned PCR primers. This product may be a PCR reagent or kit containing PCR primers.

[0023] Fourthly, this invention claims protection for a method for identifying or assisting in the identification of early-maturing pear varieties, which involves detecting the genotype of the SNP locus FM_22516479 in the pear germplasm material to be tested, and making the following judgment: pears with the SNP locus FM_22516479 genotype TT have a shorter ripening period than GT or GG, and are therefore early-maturing genotypes.

[0024] Fifthly, this invention claims protection for a method for molecular marker-assisted breeding of early-maturing pear varieties, which involves detecting the genotype of the SNP locus FM_22516479 in the pear germplasm material to be tested, selecting pear germplasm materials with the TT genotype as germplasm materials for early-maturing pear varieties, and then breeding them to obtain early-maturing pear varieties.

[0025] Furthermore, in the above method, the method for detecting the genotype of SNP site FM_22516479 in the pear germplasm material to be tested is as follows: using the aforementioned PCR primers or the aforementioned products, the genomic DNA extracted from the pear germplasm material to be tested is subjected to an HRM reaction. By analyzing the different linear shapes of the high-resolution melting curves, the genotype of SNP site FM_22516479 in the genomic DNA of the pear germplasm material to be tested is determined. GT and GG are late-maturing genotypes; TT is an early-maturing genotype.

[0026] In a specific embodiment of the present invention, the HRM reaction system consists of 20 μL of: 50 ng genomic DNA, 0.3 μM PCR primers, and 10 μL 2×CWStar HRM Master Mix; the amplification program is a falling-rate PCR: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 10 s, 60℃ annealing for 10 s, Sec Target at 53℃, decreasing by 0.5℃ per cycle, and extension at 72℃ for 10 s for 40 cycles; the melting program is: 95℃ for 1 min, 40℃ for 1 min, 60℃ for 1 s, then continuously increasing the temperature from 60℃ to 95℃, collecting fluorescence once for every 0.02℃ increase, and cooling to 37℃.

[0027] In a sixth aspect, the present invention seeks protection for a molecular marker containing the aforementioned SNP site FM_22516479, the nucleotide sequence of which is shown in SEQ ID NO.3, wherein the SNP site FM_22516479 is located at 277 bp of SEQ ID NO.3.

[0028] This invention develops a SNP molecular marker FM_22516497 associated with early ripening of pear fruit. A corresponding primer pair was designed for this marker, and this primer pair was used to detect the marker at nucleotide 22516479 of the Chr6 genome in hybrid offspring. This marker is located at 52.731 cM on linkage group 6, with a K* value of 8.29. This invention also develops a method for identifying the genotype of SNP markers associated with early ripening of pear fruit based on high-resolution melting curves.

[0029] In a specific embodiment of the present invention, HRM analysis was performed on a LightCycler 480 II real-time PCR instrument. The high-resolution melting curve reaction system was prepared according to the CWStar HRM Master Mix instructions, with a total system volume of 20 μL.

[0030] The melting curves of this invention were analyzed using the Gene Scanning program in LightCycler480 II Analysis, with known hybrid offspring, the maternal parent 'Cuiguan' and the paternal parent 'Huagai', serving as controls. 'Cuiguan' is an early-maturing variety, and 'Huagai' is a late-maturing variety. The differences in fruit maturity due to polymorphic expression at the QTL locus FM_22516479 in the hybrid offspring were detected. If the color and linear pattern of the melting curves of the amplified products from some offspring matched those of the maternal parent 'Cuiguan', it indicated that the fruits of these offspring exhibited early maturity; conversely, if the color and linear pattern of the melting curves of the amplified products from some offspring matched those of the paternal parent 'Huagai', it indicated that the fruits of these offspring exhibited late maturity.

[0031] This invention uses genome sequencing to determine the genotype of the maternal parent 'Cuiguan' (TT) and the genotype of the paternal parent 'Huagai' (GG). The 'FM_22516479 marker results in a genotype of G in late-maturing hybrid offspring and a genotype of T in early-maturing hybrid offspring. When the FM_2251647 marker site shows a mutation from G to T, the pear fruit exhibits early maturity.

[0032] The primer pairs and methods developed in this invention are used to detect the polymorphism of the FM_22516479 marker associated with early fruit ripening, express and present the differences in the ripening period of pear fruits, and carry out identification, screening and breeding of early-ripening pear varieties as well as molecular-assisted breeding work.

[0033] The present invention has the following advantages and effects:

[0034] (1) This invention performs QTL mapping on the quantitative trait of pear fruit ripening time, and the contribution rate of the mapped QTL sites is high, which provides an important basis for the genetic improvement of traits controlled by multiple genes.

[0035] (2) The present invention discovers a locus closely related to fruit maturity period at the 22,516,479th base on Chr6 of the pear genome: FM_22516479. By detecting and identifying the genotype of this locus, the early or late fruit maturity can be predicted, and early identification and screening of early-maturing pear varieties can be carried out. Based on the above discovery, the applicant has developed a specific SNP marker primer pair for the above locus. Using the developed primer pair to detect the genotype of the hybrid offspring population can accurately analyze and identify early-maturing offspring. Population tests show that the developed SNP markers can well genotype early-maturing offspring. Therefore, FM_22516479 related to early maturity of pear fruits and the amplification primers can be applied to the identification, screening, breeding, and molecular-assisted breeding of early-maturing pear varieties, and have good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the position of the major QTL interval related to the fruit maturity period of the present invention and the SNP marker locus FM_22516479 on the 6th linkage group. LG6 represents the 6th linkage group of the integrated map of the female parent 'Cuiguan' and the male parent 'Huagai'. The red and green solid rectangles respectively represent the major QTL intervals in 2016 and 2017. The numbers on the left side of the linkage group represent the genetic distance, with the unit of cM, and the markers on the right side of the linkage group are the markers of the overlapping intervals in two years.

[0037] Figure 2 This is the melting curve detected by the primer pair developed according to the SNP molecular marker FM_22516479 of the present invention in the female parent 'Cuiguan', the male parent 'Huagai', and 35 randomly selected offspring, which can be divided into two types. Line type 1 - blue melting curve, and the female parent 'Cuiguan' belongs to this line type. Line type 2 - red melting curve, and the male parent 'Huagai' belongs to this line type.

[0038] Figure 3 This is the analysis of the maturity traits of FM_22516479 markers in F₁ offspring in (a) 2016 and (b) 2017 of the present invention. The abscissa is the genotype, the ordinate is the fruit maturity period, the straight line represents the median, and the dash-dotted line represents the average value. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0039] The following makes a detailed description of the present invention in combination with specific embodiments. According to the following description and implementation, those skilled in the art can determine the basic features of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to make it applicable to various uses and conditions.

[0040] Example 1 Investigation of the Fruit Maturity Traits of Pears

[0041] 57 F1 populations were obtained by crossing the early-maturing cultivar 'Cuiguan' (P. bretschneideri) with the late-maturing cultivar 'Huagai' (P. ussuriensis), and the maturity periods were investigated for two years. The investigation results are as follows:

[0042] Table 1 Investigation and analysis of the fruit maturity period of the 'Cuiguan' × 'Huagai' F1 population

[0043]

[0044] Example 2 Major effect QTL loci and linked markers for the pear fruit maturity period

[0045] (1) DNA extraction and genome sequencing were performed on 'Cuiguan', 'Huagai', and the offspring populations. Young leaves of the F1 population and the parents were collected, numbered, and stored in an -80 °C refrigerator. The genomic DNA of the parents and the F1 population was extracted using a plant genomic DNA extraction kit (DC104-01, Novizan). The concentration and quality of the DNA were detected by agarose gel electrophoresis and Nanodrop, and stored in a -20 °C refrigerator. A DNA library was constructed using the Truseq Nano DNA HT sample preparation kit (Illumina, USA), and sequencing was performed on the Illumina HiSeq2500 platform to obtain 150 bp paired-end sequences. Picard-tools was used to remove PCR-duplication-generated sequencing reads, and the sequencing depth and coverage were calculated. The GATK software package was used to detect information such as SNPs and small indels, and the breakdancer software was used to identify SV loci.

[0046] (2) Construction of SNP markers and genetic maps. The JoinMap 4.1 software was used to construct a genetic map. The SNP loci conforming to genetic segregation in step (2) were imported into JoinMap 4.1, loci with deletions and significant segregation distortion were excluded, and the MapChart software was used to draw linkage groups.

[0047] (3) QTL mapping was performed on the phenotypic data of the F1 hybrid population of 'Cuiguan' × 'Huagai' investigated in 2016 and 2017. QTL mapping was performed by the "interval mapping method" (Interval Mapping), and the Kruskal-Wallis (K-W) test was used to perform QTL tests on the maturity traits. Markers with a significance of "Signifi." < 0.005 (****) were considered candidate QTL loci. The results showed that the same QTL interval was detected on the 6th linkage group for two consecutive years. Among them, the FM_22516479 marker was located at 52.731 cM on the 6th linkage group, the K* value was 8.29, and the significance was Signifi. < 0.005 ( Figure 1 ).

[0048] The selected SNP locus FM_22516479 is located at the 22516479th base on chromosome 6 of the pear genome. The physical location of the SNP locus FM_22516479 was determined based on the whole genome sequence of the pear, whose accession number is AJSU00000000. The polymorphism of the SNP locus FM_22516479 is G or T.

[0049] Example 3: Design of HRM-specific primer pairs using the SNP marker FM_22516479

[0050] The FM_22516479 marker site was retrieved from the pear genome sequence (http: / / peargenome.njau.edu.cn / ). Using this site as the core, nucleotide sequences totaling 300 bp on both sides were selected. Primers were designed using Primer 5.0 software according to primer design principles, resulting in the SNP marker primer pair SEQ ID NO.1 and SEQ ID NO.2. SEQ ID NO.1: GTTACTGTGAGGATAAGGGGATGAGAGGACT; SEQ ID NO.2: CAGGAAAAGAGATGTAACGATTTGAGGGAA. The amplified sequence size was 349 bp, as shown in SEQ ID NO.3. Using the genomic DNA of Dangshan pear as a template, PCR amplification was performed using this designed marker primer pair. Primer amplification was normal, and the PCR product size met expectations, indicating that this specific primer pair can be used to detect the FM_22516479 marker.

[0051] Amplified fragment sequence:

[0052] GTTACTGTGAGGATAAGGGGATGAGAGGACTGGAGGTAGGCTTAGTTTCAAATATTAC

[0053] TGATAAAATAAGCTCAATGTTCTTTTTGTTTTACAGGGTTGGCAAGTTCTCAAATGGCT

[0054] AGCACTGCTTTTACTTTCGGAACAACCTCAGTTCTCCATTCTATGCCCTCATGGTTCT

[0055] GGCACCTAAAGCTGAACTAGTATGTTTCTGTATTTATTTCAGTCCCTGATTTCCATTC

[0056] AATGTATCAGTTTTCGTTCAACGTGTAGATTAATTATCATA G TTGTCGTATATATTTGAAAGCTGTCAGTCGTGTGTGTGTTTTTTCCCTCAAATCGTTACATCTCTTTTCCTG (SEQ ID NO. 3).

[0057] Example 4 uses high-resolution melting curve (High-Resolution Melting) technology to verify the genotyping of pear fruit maturity.

[0058] HRM was performed on a LightCycler 480 II real-time PCR instrument. The high-resolution melting curve reaction system was prepared according to the CWStar HRM Master Mix instructions. The total system volume was 20 μL: 50 ng genomic DNA, 0.3 μM SNP-labeled primers, and 10 μL 2×CWStar HRM Master Mix. The amplification program used was drop-down PCR: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 10 s, 60℃ annealing for 10 s, Sec Target at 53℃, decreasing by 0.5℃ per cycle, and extension at 72℃ for 10 s, for 40 cycles. The melting program was: 95℃ for 1 min, 40℃ for 1 min, 60℃ for 1 s, then continuously increasing the temperature from 60℃ to 95℃, collecting fluorescence once for every 0.02℃ increase, and then cooling to 37℃.

[0059] Melting curves were analyzed using the Gene Scanning program in LightCycler480 II Analysis, employing the FM_22516479 marker primer pair obtained in Implementation Case 3 to perform melting curve analysis on 'Cuiguan', 'Huagai', and some progeny. Figure 2 The parents served as controls, with 'Cuiguan' being an early-maturing variety and 'Huagai' a late-maturing variety. The genotyping results using the FM_22516479 marker primers were as follows: The melting curves of some offspring showed the same color and linearity as the maternal parent 'Cuiguan,' indicating that these offspring exhibited early maturity; the melting curves of some offspring showed the same color and linearity as the paternal parent 'Huagai,' indicating that these offspring exhibited late maturity. Figure 2 ).

[0060] Example 5: Genotypic analysis of pear fruit ripening traits

[0061] The results of genome sequencing were analyzed, and the genotypes of the FM_22516479 marker in the offspring of 'Emerald Crown' × 'Flower Canopy' were statistically analyzed (Table 2).

[0062] Table 2. Statistics and analysis of the FM_22516479 marker in different genotypes in paternal, maternal, and offspring populations.

[0063]

[0064] The results showed that the genotype of the early-maturing variety 'Cuiguan' in the parental line was 'TT', and the genotype of the late-maturing variety 'Huagai' was 'GG'. The FM_22516479 marker resulted in two genotypes in the offspring: 'GT' and 'TT', with a genotype ratio of 26:19 (Table 2). Based on this result, and combined with the phenotypic survey of fruit maturity in the offspring population in Case Study 1, the Bin_22516479 marker results showed that the offspring carrying 'GT' had a longer fruit maturity period than the offspring carrying 'TT', indicating that the mutation from G to T at this locus resulted in early maturity. Figure 3 For example, sequencing results of the progeny plants numbered 07-22-80, 07-22-62, and 07-22-58 showed that the genotype was TT. Field surveys showed that these three plants matured at 120 days, 123 days, and 123 days after flowering, respectively. HRM verification showed that the melting curves of these three plants were consistent with the early-maturing maternal parent 'Cuiguan', indicating that 07-22-80, 07-22-62, and 07-22-58 were early-maturing. Sequencing results for the mature offspring (plants numbered 07-22-66, 07-22-40, and 07-22-96) showed genotype GT. Field surveys showed that these three plants matured at 155 days, 161 days, and 158 days after flowering, respectively. HRM verification showed that the melting curves of these three plants were consistent with the late-maturing paternal parent 'flower cover', indicating that 07-22-66, 07-22-40, and 07-22-96 are late-maturing offspring. Therefore, it is concluded that the FM_22516479 marker, when the locus is T in the fruits of the hybrid offspring, exhibits early maturity; when the locus is G in the fruits of the late-maturing hybrid offspring, it exhibits late maturity. When the FM_22516479 marker mutates from G to T, the pear fruits exhibit early maturity.

Claims

1. The application of substances that detect SNP molecular markers in any of the following: (A1) Application in identifying or assisting in the identification of the early maturity period of pear varieties; (A2) Application in the preparation of products for identifying or assisting in the identification of the early maturity period of pear varieties; (A3) Application in screening or breeding early-maturing pear varieties; (A4) Application in the preparation of products for screening or breeding early-maturing pear varieties; (A5) Application in molecular marker-assisted breeding or germplasm resource identification of early-maturing pear varieties; The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3, with the base at 277bp being G or T. The pear is a hybrid offspring of 'Cuiguan' and 'Huagai'. The SNP site in the late-maturing hybrid offspring fruit is G, and the SNP site in the early-maturing hybrid offspring fruit is T. The substance used to detect SNP molecular markers is (B1) or (B2) or (B3) as follows: (B1) PCR primers for amplifying the SNP molecular marker; the PCR primers include an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2; (B2) PCR reagents containing the PCR primers described in (B1); (B3) A kit containing the PCR primers described in (B1) or the PCR reagents described in (B2).

2. A method for identifying or assisting in the identification of early-maturing pear varieties, characterized in that, Using the PCR primers described in claim 1 to detect the genotype of the SNP molecular marker in the pear germplasm material to be tested, the following judgments were made: pears with the SNP molecular marker genotype TT have a shorter maturity period than those with GT or GG, and are early-maturing genotypes; the pear germplasm material to be tested is a hybrid offspring of 'Cuiguan' and 'Huagai'.

3. A method for molecular marker-assisted breeding of early-maturing pear varieties, characterized in that, Using the PCR primers described in claim 1 to detect the genotype of the SNP molecular marker in the pear germplasm material to be tested, the following judgments were made: pears with the SNP molecular marker genotype TT have a shorter maturity period than those with GT or GG, and are early-maturing genotypes; the pear germplasm material to be tested is a hybrid offspring of 'Cuiguan' and 'Huagai'.

4. The method according to claim 2 or 3, characterized in that, The method for detecting the genotype of SNP molecular markers in the pear germplasm material to be tested is as follows: using the PCR primers described in claim 1, the genomic DNA extracted from the pear germplasm material to be tested is subjected to an HRM reaction, and the different genotypes of the offspring are identified by analyzing the different high-resolution melting curves.

5. The method according to claim 4, characterized in that, The HRM reaction system consisted of 20 μL of: 50 ng genomic DNA, 0.3 μM of the PCR primers described in claim 1, and 10 μL of 2×CWStar HRM Master Mix. The amplification program used was drop-down PCR: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 10 s, 60℃ annealing for 10 s, Sec Target at 53℃, decreasing by 0.5℃ per cycle, and extension at 72℃ for 10 s for 40 cycles. The melting program was: 95℃ for 1 min, 40℃ for 1 min, 60℃ for 1 s, then continuously increasing the temperature from 60℃ to 95℃, collecting fluorescence once for every 0.02℃ increase, and cooling to 37℃.

Images