A method for constructing a single-cell and spatial full-length transcriptome library based on second-generation sequencing and application thereof

Abstract

The application relates to a single-cell and spatial full-length transcriptome library construction method based on second-generation sequencing and application thereof, and steps of the library construction method comprise the following steps: (S1) intramolecular circularization of cDNA with a single-cell label or a spatial label and a specific molecular label at a 3' end or a 5' end; (S2) fragmentization of a transposase and addition of a linker sequence to the circularized cDNA molecules in step (S2); (S3) screening, amplification and second-generation sequencing of the fragmented cDNA in step (S2). Based on the single-cell / spatial label and the specific molecular label which are common in 3' end and 5' end sequencing data, the application realizes assembly of single-cell and spatial full-length transcriptome and capture of corresponding information.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for assembling libraries from single cells and full-length spatial transcriptomes based on next-generation sequencing and its application. Background Technology

[0002] Next-generation sequencing (NGS), also known as high-throughput sequencing, is a DNA sequencing technology developed based on PCR and gene chips. It can rapidly sequence the base pairs of DNA or RNA samples. NGS supports a wide range of applications, including gene expression profiling, chromosome counting, epigenetic change detection, and molecular analysis, and is driving the development and realization of the future of personalized medicine. It determines gene sequences by performing parallel sequencing on multiple small DNA fragments. Single-cell RNA sequencing and spatial transcriptomics are emerging sequencing methods under next-generation sequencing. Single-cell RNA sequencing refers to a new technology that performs high-throughput sequencing and analysis of RNA at the single-cell level. Unlike the results obtained from conventional tissue or cell population sequencing, single-cell sequencing can deeply mine specific information. Spatial transcriptomics is a technology that analyzes and describes the expression profiles of specific cell types in a spatial dimension to understand the expression differences between organs, tissues, and pathological states. It can resolve the transcriptome status of tissues in different spatial locations.

[0003] However, existing next-generation sequencing-based methods either capture only the 3' end or only the 5' end of the mRNA, failing to capture the full-length mRNA. Currently, there are two main methods for intramolecular circularization ligation: direct blunt-end ligation and circularization of large DNA fragments using recombinase systems. Direct blunt-end ligation relies solely on the collision probability of the large DNA fragment's own twisting, resulting in low circularization efficiency, typically below 10%. Circularization of large DNA fragments using recombinase systems also presents challenges. For example, it generates a large proportion of adapter fragments with recombination sites at both ends in different orientations, preventing recombination. Furthermore, the recombination efficiency of recombinase systems in vitro is low. These factors contribute to the overall circularization efficiency of the system not exceeding 10%. The most similar technology is full-length transcriptome sequencing based on third-generation sequencing. Although it can capture full-length mRNA information, the length of mRNA is relatively short (usually around 1.5kb), which does not quite match the fragment length (10-20kb or more) required by conventional third-generation sequencers. Therefore, it often suffers from problems such as low detection efficiency and low accuracy, and its sequencing price is also relatively expensive.

[0004] Current technologies cannot capture the full-length information of mRNA, thus making it impossible to construct libraries for single-cell and full-length spatial transcriptomes based on next-generation sequencing. Therefore, how to obtain complete single-cell and full-length spatial transcriptomes of mRNA using next-generation sequencing has become an urgent problem to be solved. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a method for library construction based on second-generation sequencing of single-cell and spatial full-length transcriptomes and its application. This method captures the full-length information of the entire mRNA and, based on the single-cell / spatial tags and specific molecular tags common to the 3' and 5' sequencing data, enables the construction of libraries of single-cell and spatial full-length transcriptomes on the basis of second-generation sequencing.

[0006] To achieve this objective, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a method for library construction based on next-generation sequencing for single-cell and spatial full-length transcriptome reconstruction, wherein the library construction method includes the following steps:

[0008] (S1) Intramolecular circularization of cDNA with single-cell tags or spatial tags at the 3' or 5' ends, as well as specific molecular tags;

[0009] (S2) The cDNA molecule circularized in step (S1) is fragmented by transposase and adapter sequences are added;

[0010] (S3) The fragmented cDNA from step (S2) is screened, amplified, and sequenced.

[0011] This invention creatively modifies and intramolecularly circularizes normal 3' (or 5') end single-cell / space transcriptome library cDNA molecules, linking their 5' ends to the original 3' end single-cell / space tags and specific molecular tags. Subsequently, by specifically enriching the cDNA containing the 5' end, single-cell / space tags, and specific molecular tags, and performing next-generation sequencing, not only can the 5' end cDNA information be obtained, but also the full-length cDNA can be assembled using single-cell / space tags and specific molecular tags based on the original 3' end cDNA information, thereby obtaining complete full-length mRNA information.

[0012] Preferably, in step (S1), the fragment size of the cDNA molecule is 50-5000bp, for example, it can be 50bp, 100bp, 1000bp, 2000bp, 3000bp, 4000bp or 5000bp, etc.

[0013] Preferably, in step (S1), the fragment size of the single-cell tag is 5-100bp, for example, it can be 5bp, 10bp, 20bp, 40bp, 60bp, 80bp or 100bp, etc.

[0014] Preferably, in step (S1), the size of the spatial tag fragment is 5-100bp, for example, it can be 5bp, 10bp, 20bp, 40bp, 60bp, 80bp or 100bp, etc.

[0015] Preferably, in step (S1), the fragment size of the specific molecular tag is 5-100bp, for example, it can be 5bp, 10bp, 20bp, 40bp, 60bp, 80bp or 100bp, etc.

[0016] Preferably, in step (S1), the cDNA molecule has adapters with deoxyguanosine added to both ends, and the 3' adapter with deoxyguanosine is biotin-labeled.

[0017] Preferably, in step (S1), the intramolecular cyclization step includes:

[0018] (1) The modified cDNA molecule was amplified, purified and recovered;

[0019] (2) The modified cDNA molecule was digested with an enzyme with deoxyuridine cutting function to obtain a large cDNA fragment with a gap, which was then purified and recovered after incubation.

[0020] (3) Use ligase to intramolecularly circularize the large cDNA fragment with the gap, purify and recover it to obtain circularized cDNA.

[0021] Preferably, in step (1), the primers for amplification include SEQ ID NO:1 and SEQ ID NO:2.

[0022] Preferably, in step (2), the enzyme with deoxyuridine cleavage function includes USER enzyme and UDG enzyme.

[0023] In this invention, an enzyme with deoxyuridine cutting function is used to cut the deoxyguanosine linkers added to both ends of cDNA to form sticky ends. The sticky ends at both ends are joined to form circular DNA. After fragmentation, the 3' end contains biotin, and the DNA information at the 5' end can be obtained by enriching it with streptavidin magnetic beads.

[0024] Preferably, in step (2), the incubation temperature is 35-40℃, and the incubation time is 20-40 min. The 35-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 20-40 min can be, for example, 20 min, 25 min, 30 min, 35 min, or 40 min.

[0025] Preferably, in step (3), the ligase includes T4 ligase, T7 DNA ligase, E. coli DNA ligase and Taq DNA ligase.

[0026] Preferably, in step (3), the cyclization temperature is 20-30℃, and the cyclization time is 10-14h. The 20-30℃ can be, for example, 20℃, 22℃, 24℃, 26℃, 28℃, or 30℃, and the 10-14h can be, for example, 10h, 11h, 12h, 13h, or 14h.

[0027] Preferably, step (3) further includes digesting the uncircularized linear DNA contained in the obtained circularized cDNA.

[0028] In this invention, uncircularized linear DNA is digested in order to reduce the impact of uncircularized linear DNA on subsequent fragmentation. After fragmentation, linear DNA cannot obtain complete information at both ends, so it needs to be digested before fragmentation.

[0029] Preferably, the digestion step includes: adding a linear DNA digesting enzyme to the circularized cDNA obtained in step (3), incubating, and then purifying and recovering it.

[0030] Preferably, the incubation temperature is 35-40℃, and the incubation time is 30-90 minutes. The 35-40℃ can be, for example, 35℃, 36℃, 37℃, 38℃, 39℃, or 40℃. The 30-90 minutes can be, for example, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 70 minutes, 80 minutes, or 90 minutes.

[0031] Preferably, in step (S2), the transposase fragmentation step includes: using transposase to fragment the circularized cDNA and add adapters to obtain fragmented cDNA containing adapters.

[0032] Preferably, the transposase includes the Tn5 enzyme.

[0033] Preferably, the fragmentation temperature is 30-60℃, and the incubation time is 10-60 min; the 30-60℃ can be, for example, 30℃, 40℃, 50℃, or 60℃. The 10-60 min can be, for example, 10 min, 20 min, 30 min, 40 min, 50 min, or 60 min.

[0034] Preferably, in step (S3), the screening, amplification, and next-generation sequencing steps include:

[0035] (A) Fragmented cDNA containing adapters and biotin modifications was enriched with magnetic beads and then incubated to obtain cDNA fragments;

[0036] (B) The obtained cDNA fragments were amplified and screened before being subjected to next-generation high-throughput sequencing.

[0037] Preferably, in step (A), the magnetic beads comprise streptavidin magnetic beads.

[0038] Preferably, in step (A), the incubation temperature is 20-30℃, and the incubation time is 20-40 min. The 20-30℃ can be, for example, 20℃, 22℃, 24℃, 26℃, 28℃, or 30℃. The 20-40 min can be, for example, 20 min, 25 min, 30 min, 35 min, or 40 min.

[0039] Preferably, in step (A), the incubation is a rotational incubation, and the rotational speed is 1-500 rpm, for example, it can be 1 rpm, 100 rpm, 200 rpm, 300 rpm, 400 rpm or 500 rpm, etc.

[0040] Preferably, in step (B), the primers required for library construction for amplification include SEQ ID NO:3 and SEQ ID NO:4.

[0041] Preferably, in step (B), the fragment screening involves selecting fragments containing single-cell tags or spatial tags, as well as fragments with specific molecular tags and 5' cDNA. This allows for the assembly of the full-length transcriptome based on the corresponding sequence information obtained from subsequent sequencing.

[0042] Secondly, the present invention provides the application of the method for constructing single-cell and spatial full-length transcriptome libraries based on next-generation sequencing as described in the first aspect in the construction of single-cell and spatial transcriptome sequencing libraries.

[0043] Compared with the prior art, the present invention has at least the following beneficial effects:

[0044] 1. This invention uses intramolecular ligation to cleverly link the 5' cDNA and 3' molecular tag, which cannot be detected simultaneously in conventional next-generation high-throughput sequencing, thereby making it possible to detect the 5' cDNA and 3' molecular tag based on conventional next-generation high-throughput sequencing.

[0045] 2. This invention uses streptavidin magnetic beads to specifically enrich fragmented 5' cDNA and 3' molecular tag fragments containing biotin tags. This method can accurately and effectively enrich target fragments, and is simple to operate and does not easily destroy fragment information.

[0046] 3. This invention creatively incorporates single-cell / spatial tags and specific molecular tags common to 3' and 5' sequencing data, enabling the splicing of full-length transcriptomes at the single-molecule level. Attached Figure Description

[0047] Figure 1 This is a schematic diagram illustrating the principle of the single-cell and spatial full-length transcriptome library assembly method relied upon by next-generation sequencing.

[0048] Figure 2 This is a distribution map of cDNA fragment sizes.

[0049] Figure 3 This is a distribution diagram of the size of cDNA fragments after self-circularization.

[0050] Figure 4 This is a distribution chart of document fragment sizes.

[0051] Figure 5 It is a statistical diagram of the distribution of single-cell and spatial transcriptome sequencing fragments on the genome.

[0052] Figure 6 This is a diagram showing the clustering results of sequencing analysis at the 3' end, 5' end, and 3'+5' end. Detailed Implementation

[0053] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0054] The various instruments, consumables, and reagents not specifically described in the embodiments of this invention are all conventional commercially available products in the art and can be obtained through commercial means. The specific experimental materials and their sources listed in the following embodiments are merely exemplary and are not intended to limit the invention. Materials that are the same as or similar in type, model, quality, properties, or functions to the following tissues, cells, reagents, and instruments can be used to implement this invention.

[0055] The reagents used in the following examples were sourced from the following sources:

[0056] Biotin: Sangon Biotech (Shanghai) Co., Ltd.

[0057] USER enzyme: NEB (New England Biolabs).

[0058] T4 DNA ligase: NEB (New England Biolabs).

[0059] Transposase: Nanjing Novizan Biotechnology Co., Ltd.

[0060] Single-cell label: Sangon Biotech (Shanghai) Co., Ltd.

[0061] Space tag: Sangon Biotech (Shanghai) Co., Ltd.

[0062] Example 1

[0063] This embodiment focuses on primer design.

[0064] The database construction principle of this invention is as follows: Figure 1 As shown, firstly, cDNA from mouse brain tissue obtained using conventional single-cell and spatial transcriptomics techniques is amplified using circular primers modified with U bases and biotin. This results in all amplified fragments having U bases and biotin at their 3' ends. U bases can be specifically cleaved by certain enzymes (such as USER enzyme), and the resulting sticky ends can be ligated intramolecularly (e.g., by T4 DNA ligase). The ligated product is then fragmented by transposase (Tn5), which adds specific adapter sequences to both ends. Because the tagged portion of the fragmented product is biotin-modified, it can be easily enriched using streptavidin magnetic beads. The enriched product is then amplified using specific library construction primers to extract the 5' cDNA sequence and molecular tag portion, and then subjected to next-generation high-throughput sequencing to obtain the sequence information of the 5' end of the cDNA and the molecular tag portion. Since both the 3' and 5' sequencing data contain unique molecular tags (UMIs), they can be further combined with 3' sequencing data obtained from conventional single-cell and spatial transcriptome sequencing to perform sequencing fragment splicing based on shared UMIs, thereby ultimately obtaining single-molecule-level full-length transcriptome information with single-cell or spatial precision.

[0065] Based on the above principles, amplification sequences 1 and 2, as well as library construction primers 1 and 2, were designed. SEQ ID NO. 1-SEQ ID NO. 2 represent amplification sequences 1 and 2, respectively; SEQ ID NO. 3-SEQ ID NO. 4 represent the upstream and downstream primers of library construction primer 1, respectively; and SEQ ID NO. 5-SEQ ID NO. 6 represent the upstream and downstream primers of library construction primer 1, respectively. The specific sequences are shown in Table 1.

[0066] Table 1

[0067] Primer name sequence name Sequence information (5'→3') Primer set 3 SEQ ID NO.3: AATGATACGGCGACCACCGAGATCTACACTA Primer set 4 SEQ ID NO.4: GATCGCTCGTCGGCAGCGTCAGATGTGTAT Primer set 5 SEQ ID NO.5: CAAGCAGAAGACGGCATACGAGATTCG Primer set 6 SEQ ID NO.6: CCTTAGTCTCGTGGGCTCGGAGATGT

[0068] Primer set 1 is AU-SEQ ID NO.1, where U is deoxyuridine, SEQ ID NO.1: CGACGCTCTTCCGATCT, and the 7th base T from 5'→3' is a biotinylated base.

[0069] Primer set 2 is AU-SEQ ID NO.2, where U is deoxyuridine, SEQ ID NO.2: GTGGTATCAACGCAGAGT.

[0070] Example 2

[0071] This embodiment involves intramolecular cyclization.

[0072] (1) Add U base and biotin

[0073] CDNA from mouse brain tissue, obtained using conventional single-cell and spatial transcriptomics techniques, was amplified using biosynthesized sequences 1 and 2. This cDNA contained single-cell tags, spatial tags, and specific molecular tags, which could be used for subsequent single-cell and spatial transcriptomics sequencing. Both sequences 1 and 2 included U bases, which could be used to generate sticky ends for DNA circularization via USER cleavage, while biotin was used to screen for 3' fragments and molecular tags. Amplification was performed using the following system, with U bases and biotin added to the cDNA.

[0074] Table 2

[0075] Reagent Name Added amount 5× High-Fidelity Polymerase Buffer 10μL dNTP Mix (10mM) 1μL Amplified sequence 1 (10 μM) 2μL Amplified sequence 2 (10 μM) 2μL cDNA 100ng U-base-tolerant high-fidelity amplification enzyme 1μL <![CDATA[ddH2O]]> Add to 50μL

[0076] The specific length distribution of the injected cDNA is as follows: Figure 2As shown. The 5× high-fidelity polymerase buffer used was 5×Uc Buffer for Library Amplification, and the U-base-tolerant high-fidelity amplification enzyme used was PhantaUc Super-Fidelity DNA Polymerase. The above system was amplified using the following amplification program: 95℃~3min; 5 cycles (98℃~10s, 65℃~45s, 72℃~3min); held at 4℃.

[0077] The amplified product was purified. 50 μL of magnetic beads were added to the amplified product, mixed thoroughly, and incubated at room temperature for 10 min. The mixture was then placed on a magnetic rack, and after the liquid became clear, it was removed. The magnetic beads were washed twice with 200 μL of 80% ethanol, dried at room temperature for 5 min, and then eluted with 50 μL of ddH2O for 5 min. The mixture was then placed on a magnetic rack, and after the liquid became clear, it was carefully aspirated into a new tube.

[0078] (2) Add U-base digestive enzyme to form sticky ends

[0079] After adding the U base and biotin to the cDNA, add it to a centrifuge tube according to the system shown in Table 3 below, and incubate it in a PCR instrument at 37°C for 30 min. Take out the incubated cDNA and perform bead purification, as described in step (1).

[0080] Table 3

[0081]

[0082]

[0083] (3) Circular connection of viscous ends

[0084] The obtained cDNA containing sticky ends was circularized and added to centrifuge tubes according to the system shown in Table 4 below. The tubes were then incubated in a PCR instrument at 25°C for 12 hours. The incubated cDNA was then removed, purified, and analyzed in a fully automated nucleic acid and protein analysis system. Specific results are shown below. Figure 3 As shown in the figure, the fragment distribution clearly shows two distinct peaks: one peak representing a fragment of approximately 800 bp that was not successfully circularized, and the other peak representing a successfully circularized cDNA product of approximately 1500 bp.

[0085] Table 4

[0086] Components content cDNA obtained in step (2) 50μL 10×T4 DNA ligase buffer 30μL T4 DNA ligase (2000 U / μL) 7μL <![CDATA[ddH2O]]> Add to 300μL

[0087] (4) Digestion of linear cDNA

[0088] The obtained circularized cDNA was added to centrifuge tubes according to the system shown in Table 5 below, and incubated in a PCR instrument at 37°C for 1 hour. The incubated cDNA was then removed and purified.

[0089] Example 3

[0090] This embodiment involves DNA fragmentation, enrichment, and library amplification.

[0091] (1) DNA fragmentation

[0092] Add 50 μL of Tn5 enzyme (TTE Mix V5) and 20 μL of 5× fragmentation buffer (5×TTBL) to 50 ng of the circularized DNA obtained in Example 2, then add ddH2O to a final volume of 100 μL and incubate at 55°C for 20 min. Both TTE Mix V5 and 5×TTBL were obtained from Novizan. DNALibrary Prep Kit V2 for Illumina TD502.

[0093] (2) DNA enrichment

[0094] Add 20 μL of C1 beads (streptavidin magnetic beads) to the above fragmented product, rotate at room temperature for 30 min to bind and enrich biotin- and linker fragments, then add 500 μL of elution buffer (EB buffer) to wash for 5 min to initially remove impurities, and then add 100 μL of ddH2O to wash for 5 min to completely remove residual impurities.

[0095] (3) Amplification

[0096] Add the DNA containing the 3' end enriched in step (1) into centrifuge tubes according to the system shown in Table 5 below.

[0097] Table 5

[0098] Reagent Name Added amount 2× High-fidelity polymerase mixture 10μL P5 (10μM) 2μL Ad2.1 (10μM) 2μL C1 beads \ <![CDATA[ddH2O]]> Add to 50μL

[0099] The 2× high-fidelity polymerase mixture used was 2×KAPA HIFI Master mix. The above system was amplified using the following amplification program: 95℃~3min; 10 cycles (98℃~10s, 65℃~45s, 72℃~3min); held at 4℃.

[0100] The amplified product was purified bidirectionally. 30 μL of beads were added to the amplified product, mixed thoroughly, and incubated at room temperature for 10 min. The mixture was then placed on a magnetic rack, and after the liquid clarified, the beads were removed, retaining the supernatant. 10 μL of beads were added to the supernatant, mixed thoroughly, and incubated at room temperature for 10 min. The mixture was then placed on a magnetic rack, and after the liquid clarified, the supernatant was removed. The beads were washed twice with 200 μL of 80% ethanol, dried at room temperature for 5 min, and then eluted with 50 μL of ddH2O for 5 min. The mixture was placed on a magnetic rack, and after the liquid clarified, the liquid was carefully aspirated into a new tube. The obtained library fragment sizes were mainly distributed between 300 bp and 600 bp, specifically as shown below. Figure 4 As shown.

[0101] Example 4

[0102] This embodiment performs second-generation high-throughput sequencing.

[0103] The obtained library was subjected to routine PE150 next-generation high-throughput sequencing. The reads obtained after sequencing were aligned back to the corresponding reference genome. The specific distribution of reads on the genes after alignment is shown in the figure below. Figure 5 As shown, conventional 3' end sequencing reads are mainly distributed at the 3' end of the gene, while the circularized 5' end sequencing reads used in this invention are mainly distributed at the 5' end of the gene. Combining reads from both methods achieves balanced coverage of the gene at both the 5' and 3' ends. Furthermore, as... Figure 6 As shown, this method can construct single-cell and spatial maps using both 3' and 5' end sequencing reads, and combining paired-end sequencing reads can construct even more detailed single-cell and spatial maps.

[0104] In summary, the method of the present invention can perform single-cell and spatial sequencing of complete mRNA, overcoming the shortcomings of existing technologies that cannot use next-generation sequencing to perform single-cell and spatial sequencing of complete mRNA. This method has the characteristics of high detection efficiency and high accuracy.

[0105] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A method for library assembly based on next-generation sequencing in single cells and spatial full-length transcription, characterized in that, The steps of the database construction method include: (S1) Intramolecular circularization of cDNA with single-cell tags or spatial tags at the 3' or 5' ends, as well as specific molecular tags; After the cDNA was modified and circularized, its 5' end was linked to the single-cell / space tag and specific molecular tag at the 3' end of the original cDNA molecule. (S2) The cDNA molecule circularized in step (S1) is fragmented by transposase and adapter sequences are added; In step (S1), the 5' end is linked to the single-cell / space tag and specific molecular tag at the 3' end of the original cDNA molecule to form a structure that is not broken after being fragmented by transposase. The transposase fragmentation step includes: using transposase to fragment the circularized cDNA and add adapters to obtain fragmented cDNA containing adapters; (S3) The fragmented cDNA from step (S2) is screened, amplified, and subjected to next-generation sequencing; In step (S1), the cDNA molecule is fitted with adapters containing deoxyguanosine at both ends, and the 3' adapter containing deoxyguanosine is biotin-labeled. In step (S1), the intramolecular cyclization step includes: (1) The modified cDNA molecule was amplified, purified and recovered; (2) The modified cDNA molecule was digested with an enzyme with deoxyuridine cutting function to obtain a large cDNA fragment with a gap, which was then purified and recovered after incubation. (3) Use ligase to intramolecularly circularize the large cDNA fragment with the gap, purify and recover it to obtain circularized cDNA; Step (3) also includes digesting the uncircularized linear DNA contained in the obtained circularized cDNA; The digestion steps include: adding a linear DNA digesting enzyme to the circularized cDNA obtained in step (3), incubating, and then purifying and recovering it; In step (S3), the screening, amplification, and next-generation sequencing steps include: (A) The obtained cDNA fragments were enriched with magnetic beads and incubated to obtain fragmented cDNA containing biotin modification; (B) The obtained cDNA fragments were amplified and screened before being subjected to next-generation high-throughput sequencing; In step (B), the fragment screening is to screen for fragments containing single-cell tags or spatial tags, as well as fragments with specific molecular tags and 5' cDNA.

2. The database construction method according to claim 1, characterized in that, In step (S1), the size of the cDNA molecule fragment is 50-5000bp.

3. The database construction method according to claim 1, characterized in that, In step (S1), the fragment size of the single-cell tag is 5-100 bp.

4. The database construction method according to claim 1, characterized in that, In step (S1), the size of the spatial tag fragment is 5-100bp.

5. The database construction method according to claim 1, characterized in that, In step (S1), the fragment size of the specific molecular tag is 5-100 bp.

6. The database construction method according to claim 1, characterized in that, In step (1), the primers used for amplification include SEQ ID NO:1 and SEQ ID NO:

2.

7. The database construction method according to claim 1, characterized in that, In step (2), the enzymes with deoxyuridine cleavage function include USER enzyme and UDG enzyme.

8. The database construction method according to claim 1, characterized in that, In step (2), the incubation temperature is 35-40℃ and the incubation time is 20-40min.

9. The database construction method according to claim 1, characterized in that, In step (3), the ligases include T4 ligase, T7 DNA ligase, E. coli DNA ligase and Taq DNA ligase.

10. The database construction method according to claim 1, characterized in that, In step (3), the cyclization temperature is 20-30℃ and the cyclization time is 10-14h.

11. The database construction method according to claim 1, characterized in that, In step (3), the incubation temperature is 35-40℃ and the incubation time is 30-90min.

12. The database construction method according to claim 1, characterized in that, In step (S2), the transposase includes the Tn5 enzyme.

13. The database construction method according to claim 1, characterized in that, In step (S2), the fragmentation temperature is 30-60℃.

14. The database construction method according to claim 1, characterized in that, The magnetic beads mentioned in step (A) include streptavidin magnetic beads.

15. The database construction method according to claim 1, characterized in that, In step (A), the incubation temperature is 20-30℃ and the incubation time is 20-40min.

16. The database construction method according to claim 1, characterized in that, In step (A), the incubation is a rotary incubation with a rotation speed of 5-100 rpm.

17. The database construction method according to claim 1, characterized in that, In step (B), the primers required for library construction for amplification include SEQ ID NO:3 and SEQ ID NO:

4.

18. The application of the single-cell and spatial full-length transcriptome library construction method based on next-generation sequencing according to any one of claims 1-17 in the construction of single-cell and spatial transcriptome sequencing libraries.

Images