A method of promoting improvement of antiviral traits in fish

Abstract

The application relates to the technical field of COX17 genes, in particular to a method for promoting improvement of fish antiviral traits. It is found in the examples that fish with cox17 gene mutations can obtain resistance to viral stress, thereby providing solid technical support for antiviral fish improvement and breeding and wide application prospects.

Description

Technical Field

[0001] This application relates to the field of cox17 gene technology, specifically to a method for promoting the improvement of antiviral traits in fish. Background Technology

[0002] COX (cytochrome c oxidase, also known as complex IV or CcO) is a transmembrane protein located on the mitochondrial membrane and found in the mitochondria of bacteria and eukaryotes (Wu et al., 2016). COX's functions include accepting electrons from cytochrome c, transferring them to oxygen molecules, and performing oxygen reduction by producing water molecules. Furthermore, COX transports four protons across the membrane, thus contributing to the formation of a transmembrane proton electrochemical potential difference, providing energy for ATP synthase to synthesize adenosine triphosphate (ATP) (Baker et al., 2017; Ducker and Rabinowitz, 2017).

[0003] COX17 (Cytochrome c oxidase assembly homolog 17) is a type of COX containing 69 amino acids, including six cysteine ​​residues that can bind metal ions. COX17 is a soluble copper-binding protein approximately 7 kDa in length. COX17 participates in the assembly and copper metallization of cytochrome c oxidase (Garcia et al 2016; Soto et al 2012), and is involved in regulating the distribution and content of copper in mitochondria (Heaton et al 2001). COX17 has also recently been found to participate in the assembly of the mitochondrial contact site and cristae organizing system (MICOS). The main function of MICOS is to establish and maintain the proper inner mitochondrial membrane structure and connect the outer mitochondrial membrane. Furthermore, the interaction between COX17 and MICOS is regulated by copper ions (Ge et al 2022).

[0004] Some developmental and physiological characteristics of COX17 mutants have been revealed in Arabidopsis thaliana (Garcia et al 2016), yeast (Beers et al 1997), and mammalian cells (Heaton et al 2001). Furthermore, COX17 is also associated with some blood disorders, such as acute myeloid leukemia (AML) (Singh et al., 2020). Studies have found that the mitochondrial metallocarrier protein COX17 can reduce DNA methylation levels in AML cells, promote AML cell differentiation, and inhibit the proliferation of AML stem cells (Singh et al 2020). Recent studies have shown that the absence of COX17 or its non-acetylated mutations lead to defects in mitochondrial structure, including breaks, reduced cristae density, and impaired integrity of the mitochondrial electron transport chain complex IV; acetylation mimicking COX17 can rescue these defects (Guhathakurta et al 2023). Summary of the Invention

[0005] The inventors of this application have creatively discovered that fish with mutations in the cox17 gene can acquire resistance to viral stress, thus providing solid technical support and broad application prospects for the improvement and breeding of antiviral fish.

[0006] Therefore, the embodiments of this application disclose at least the following technical solutions:

[0007] In one aspect, the embodiments disclose cox17-gRNA, which is used in a CRISPR / Cas9 kit for targeted editing of the cox17 gene. The nucleotide sequence of the cox17-gRNA is as shown in SEQ ID NO:1.

[0008] Secondly, the embodiments disclose primer pairs for synthesizing the cox17-gRNA described in the first aspect. The primer pairs comprise DNA molecules as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0009] Thirdly, the embodiments disclose a CRISPR / Cas9 kit targeting the cox17 gene, including Cas9 mRNA as shown in SEQ ID NO:29 and cox17-gRNA as shown in SEQ ID NO:1.

[0010] Fourthly, the embodiments disclose a method for constructing a cox17 gene mutant fish. The method includes: synthesizing Cas9 mRNA as shown in SEQ ID NO:29 and cox17-gRNA as shown in SEQ ID NO:1; injecting the Cas9 mRNA and the gRNA into the embryo of the fish; culturing the embryos into F0 generation fish; and screening the cox17 gene mutant fish from the F0 generation fish or the offspring of the F0 generation fish.

[0011] Fifthly, the embodiments disclose the application of the cox17-gRNA described in the first aspect, the primer pair described in the second aspect, or the kit described in the third aspect in constructing antiviral fish. Attached Figure Description

[0012] Figure 1 This is a schematic diagram of the target mutation sites of the cox17 gene.

[0013] Figure 2 To detect cox17 in the same infection with Spring Viraemia of Carp Virus (SVCV) - / - Zebrafish have a lower mortality rate and stronger resistance to viruses.

[0014] Figure 3 To ensure that, under the same SVCV infection conditions, cox17 - / - Enhanced dual-luciferase activity driven by the promoters of zebrafish IFN1 and IFN3 genes suggests that cox17 - / - Zebrafish exhibit enhanced antiviral activity.

[0015] Figure 4 To determine the cox17 under the same SVCV infection conditions - / - Upregulation of zebra antiviral IRF (interferon regulator factor) family gene mRNA levels indicates that cox17 - / - Zebrafish have a stronger ability to fight viruses.

[0016] Figure 5 To ensure that, under the same SVCV infection conditions, cox17 - / - Zebrafish have less residual virus in their bodies and a stronger ability to kill viruses.

[0017] Figure 6 To determine the cox17 under the same SVCV infection conditions - / - Zebrafish tissue homogenate-infected carp epithelioma cells (EPCs) produced less cytopathic effect (CPE), indicating that cox17... - / - Zebrafish have a stronger ability to kill viruses. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional testing methods and can be obtained from the prior art.

[0019] The wild-type zebrafish (Danio rerio) and mutants required for the examples were raised in the fish house of the College of Fisheries, Huazhong Agricultural University. The breeding conditions were: water temperature of 28.5±0.5℃, light and dark time of 14h and 10h respectively, and brine shrimp were fed twice a day.

[0020] cox17-gRNA and its synthesis

[0021] Based on the cox17 cDNA sequence (gene ID: 447914), the first two-thirds of the CDS region and the region after the ATG of this gene were selected to design cox17-gRNA, as shown in SEQ ID NO: 1.

[0022] Primer pairs cox17-gRNA-F and cox17-gRNA-R are used for the synthesis of cox17-gRNA.

[0023] cox17-gRNA-F: GTAATACGACTCACTA TAGGCTTCACCTGCAGCGATAGgttttagagctagaaatagc, the underlined part represents the nucleotide sequence of the T7 promoter, and the lowercase parts represent homologous sequences to the intrinsically conserved sequence of gRNA, as shown in SEQ ID NO:2.

[0024] The cox17-gRNA-R sequence is complementary to the 3' end of plasmid pT7-gRNA (Addgene, Catalog #46759) and is used to synthesize cox17-gRNA. cox17-gRNA-R: AAAAGCACCGACTCGGTGCC, SEQ ID NO:3.

[0025] The examples also disclose a method for synthesizing cox17-gRNA. The method includes:

[0026] 1) Synthesize cox17-gRNA PCR product using pT7-gRNA as template. The pT7-gRNA plasmid contains a conserved sequence of the gRNA transcription template (SEQ ID NO:4). The cox17-gRNA PCR product synthesized using pT7-gRNA plasmid as template can form a hairpin structure of gRNA after in vitro transcription, thereby enabling Cas9 protein to perform its cleavage function in cells.

[0027] The cox17-gRNA-F and cox17-gRNA-R were formulated to form a cox17-gRNA synthesis system. The cox17-gRNA synthesis system, in 200 μL increments, contained 4 μL pT7-gRNA (1 ng / μL), 100 μL 2×Mix, 4 μL cox17-gRNA-F, and 4 μL cox17-gRNA-R. The reaction steps for cox17-gRNA synthesis included: pre-denaturation at 94 °C for 3 min, 30 cycles (denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 10 s), and a final extension at 72 °C for 5 min.

[0028] After performing agarose gel electrophoresis on 1 μL of the PCR product obtained in step 1), the product was purified and recovered using a PCR clean kit. In vitro transcription was performed using the Thermo TranscriptAid T7 High Yield Transcription Kit, and the transcription system is shown in Table 1.

[0029] Table 1

[0030] ATP / CTP / GTP / UTP mix 8 μL (2 μL / each) TranscriptAid Enzyme Mix 2 μL PCR product 1 μg DEPC-treated water up to 20 μL

[0031] 2) Harvesting cox17-gRNA from in vitro transcripts

[0032] After mixing the in vitro transcription reaction system, centrifuge, seal, and incubate in a 37°C water bath for 2 hours; add 1 μL LDNase, incubate at 37°C for 15 minutes to remove the DNA template; add 1 μL LEDTA, incubate at 60°C for 10 minutes to terminate the reaction; add 30 μL LEPC water and 30 μL LiCl, mix, and precipitate at -80°C for 4 hours; centrifuge at 4°C and 14000g for 10 minutes; discard the supernatant, wash with 1 mL of 70% ethanol, and centrifuge at 4°C and 14000g for 10 minutes; repeat the previous step; discard the supernatant, air dry at room temperature, dissolve in 20 μL of RNase-free water, take 1 μL and use a NanoDrop 2000 nucleic acid quantification instrument to measure the RNA concentration and mass, dilute to 80 ng / μL, aliquot, and store at -80°C for later use, which is the solution containing 80 ng / μL cox17-g RNA.

[0033] Cas9 mRNA and its synthesis

[0034] The examples also disclose Cas9 mRNA, the nucleotide sequence of which is shown in SEQ ID NO:29.

[0035] The examples also disclose a method for synthesizing Cas9 mRNA. The method includes: digesting the pT3TS-nCas9n plasmid (Addgene, Catalog #46757) with XbaI; recovering the linearized fragment of the pT3TS-nCas9n plasmid from the digestion product; performing in vitro transcription on the linearized fragment of the pT3TS-nCas9n plasmid; and obtaining Cas9 mRNA from the in vitro transcript.

[0036] Table 2 shows the reaction system for in vitro transcription of the linearized fragment of the pT3TS-nCas9n plasmid. In this system, Cas9 mRNA was transcribed in vitro using the Ambion MAXIscript T3 Kit. After mixing the reaction system, centrifuging was performed, and the mixture was sealed and incubated in a 37°C water bath for 2 hours. 1 μL of DNase was added, and the reaction was incubated at 37°C for 15 minutes to remove the DNA template. 1 μL of LEDTA was added, and the reaction was terminated at 60°C for 10 minutes.

[0037] Table 2

[0038] 2x NTP / CAP 10 μL Template DNA 1 μg T3 Enzyme Mix 1 μL DEPC-treated water up to 20 μL

[0039] In some embodiments, the steps for obtaining Cas9 mRNA from in vitro transcripts include: adding 30 μL of LEPC water and 30 μL of LiCl to the in vitro transcripts (20 μL reaction system), mixing well, and precipitating at -80°C for 4 h; centrifuging at 14000g for 10 min at 4°C; discarding the supernatant, washing with 1 mL of 70% ethanol, and centrifuging at 14000g for 10 min at 4°C. Repeating the previous step, discarding the supernatant, air-drying at room temperature, dissolving in 20 μL of RNase-free water, measuring the RNA concentration and mass using a 1 μL NanoDrop 2000 nucleic acid quantification instrument, diluting to 500 ng / μL, aliquoting, and storing at -80°C for later use; this is the solution containing 500 ng / μL Cas9 mRNA.

[0040] CRISPR / Cas9 gene editing kit targeting cox17 gene and method for constructing cox17 gene mutant fish

[0041] The examples disclose a CRISPR / Cas9 gene editing kit targeting the cox17 gene, comprising Cas9 mRNA as shown in SEQ ID NO:29 and cox17-gRNA as shown in SEQ ID NO:1.

[0042] In some embodiments, the gene editing kit includes a solution of 500 ng / μL Cas9 mRNA and a solution of 80 ng / μL cox17-gRNA.

[0043] This embodiment discloses a method for constructing a cox17 gene mutant fish. The method includes: synthesizing Cas9 mRNA as shown in SEQ ID NO:29 and cox17-gRNA as shown in SEQ ID NO:1; mixing the Cas9 mRNA and the cox17-gRNA and injecting the mixture into the embryo of the fish; culturing the embryos into F0 generation fish; and screening the cox17 gene mutant fish from the F0 generation fish or the offspring of the F0 generation fish.

[0044] In some embodiments, equal volumes of 500 ng / μL Cas9 mRNA and 80 ng / μL cox17-gRNA were mixed and injected into zebrafish embryos after one cell cycle using a Picoliter Microinjector (Warner, USA). The zebrafish embryos were cultured in methylene blue medium in a 28°C light-controlled incubator, and the juveniles were transferred to the system to reach the F0 generation. The F0 generation adults were mated with wild-type zebrafish, and the F1 generation embryos were collected. The F1 generation embryos were cultured to adulthood, and cox17-deficient zebrafish were selected from the F1 generation adults.

[0045] In some embodiments, zebrafish embryos injected with Cas9 mRNA and cox17-gRNA were cultured for 24 hours and then F0 generation embryos were screened.

[0046] In some embodiments, the screening steps include: lysing the embryos to be screened with 50mM NaOH at 95℃ for 20 min, equilibrating the pH with 50mM Tris-HCl at pH 8.0, amplifying the equilibrated solution with F1 (SEQ ID NO:5) and R1 (SEQ ID NO:6) PCR, performing agarose gel electrophoresis on the PCR products, collecting the electrophoretic bands to confirm the correctness of the PCR products, and then sequencing the sequences. The sequencing results are then opened in SnapGene software for sequence alignment. If the sequencing results show a double peak near the target site, it proves that the target site is effective, and the F0 embryos injected in the same batch corresponding to the effective target site are cultured to obtain F0 generation adult fish with the Cox17 mutation.

[0047] Screening F1 adult fish carrying cox17 mutation

[0048] The embodiments also provide a method for screening F1 adult fish carrying the cox17 mutation. The method includes: mating F0 generation adult fish with the cox17 mutation with wild-type fish to breed F1 generation individuals, raising F1 generation embryos to 1-2 months of age; taking caudal fin tissue and lysing it at 50mM NaOH at 95℃ for 20 min, balancing the pH with pH 8.050mM Tris-HCl, using F1 and R1 as primer pairs to amplify the balanced solution by PCR, performing agarose gel electrophoresis on the PCR products, collecting the electrophoretic bands for sequencing, and screening out F1 adult fish with the cox17 mutation.

[0049] The remaining PCR products were purified and recovered using a PCR purification kit, ligated into the pMD18-T (Takara, Catalog #6011) vector, transformed, and single colonies were selected for colony PCR amplification. The amplified products were then sent to Qingke Biotechnology Co., Ltd. for sequencing. Based on the sequencing results, the sequence of each individual was analyzed and compared with the wild-type normal gene sequence to analyze the mutation target sequence. Each mutant type was ensured to be present in both males and females. Males and females with the same mutant type were mated to obtain F2 embryos.

[0050] Screening F2 adult fish carrying cox17 mutation

[0051] The embodiments also provide a method for screening F2 adult fish carrying the Cox17 mutation. The method includes: mating and breeding F1 male and female adult fish with the Cox17 mutation to produce F2 embryos; raising the F2 embryos to adult fish; taking caudal fin tissue and lysing it in 50mM NaOH at 95℃ for 20 min, balancing the pH with pH 8.050mM Tris-HCl, using F1 and R1 as primer pairs to PCR amplify the balanced solution, performing agarose gel electrophoresis on the PCR products, collecting the electrophoretic bands for sequencing, and screening out F2 adult fish with the Cox17 mutation.

[0052] like Figure 1 As shown, the target sequence of the wild-type cox17 gene, as shown in SEQ ID NO:7, is mutated to the sequence shown in SEQ ID NO:8, which is a frameshift mutation.

[0053] SVCV infection test

[0054] Some test cases examined the cox17 mutant zebrafish embryos and wild-type (control) zebrafish embryos constructed using the above steps, and tested the antiviral effect of the cox17 mutant zebrafish embryos and juveniles against SVCV through SVCV infection. Specific test steps included:

[0055] 1. Preparation of SVCV virus solution

[0056] Carp epithelioma cells (EPC, ATCC: CRL-2872) were passaged into six-well plates. When the cell coverage was approximately 95%, carp spring viremia virus solution (SVCV, ATCC: VR-1390) was inoculated. The plates were incubated at 28°C with 5% CO2 for 2 hours to allow for sufficient virus contact and infection of the cells. Complete medium of DMEM + 10% FBS was then added back. Cells were periodically observed for cytopathic effects. When cell rounding or adherent cells detached, the virus solution was collected through repeated freeze-thaw cycles. The amplified carp spring viremia virus obtained was stored at -80°C for later use.

[0057] 2. Titer determination of SVCV virus solution

[0058] EPC cells were passaged into 96-well plates, and the cells were inoculated with the virus once they covered the entire well. The virus was serially diluted 10-fold (100 μL per well), with 8 replicates per group. Incubation was allowed for 2 hours, during which the virus dilution was gently mixed every 30 minutes to ensure adequate virus contact and infection of the cells. The virus dilution was then aspirated with a pipette, and 100 μL of complete culture medium (DMEM + 10% FBS) was added to each well. The wells were then incubated for 3 days. The number of wells with plaque formation in each group was counted according to TCID values. 50 Calculate the viral titer.

[0059] 3. SVCV infection of zebrafish embryos

[0060] With 1.5×10 6 TCID 50 10 mL of zebrafish embryos were added to each embryo for infection. The mortality rate of zebrafish embryos or juveniles was recorded every 12 or 24 hours, and a line graph of zebrafish juvenile mortality was plotted. The mortality rate (%) was calculated as follows: 100% × (number of deaths per replicate / total number of embryos per replicate (30)). The mean mortality rate (%) was the average of the mortality rates measured in multiple replicates for each group.

[0061] The results are as follows Figure 2 As shown, 24 hours after SVCV infection, the mortality rate of cox17-mutant zebrafish was not significantly different from that of wild-type zebrafish; however, 36 hours after SVCV infection, the mortality rate of cox17-mutant zebrafish was significantly lower than that of wild-type zebrafish, and even 96 hours after infection, the mortality rate of cox17-mutant zebrafish was significantly lower than that of wild-type zebrafish. These results suggest that the mortality rate of cox17-mutant zebrafish is significantly reduced after exposure to SVCV virus stress, and that cox17-mutant zebrafish have significantly enhanced resistance to the virus.

[0062] IFN1, IFN3 gene promoter driven dual luciferase activity analysis and qRT-PCR of antiviral related genes

[0063] Some test cases also included analysis of dual-luciferase activity driven by IFN1 and IFN3 gene promoters and qRT-PCR detection of antiviral-related genes in zebrafish embryos with cox17 mutations and wild-type zebrafish embryos under SVCV stress.

[0064] 1. Dual-luciferase activity analysis

[0065] (1) Construction of recombinant plasmids pGL3-IFN1 and pGL3-IFN3

[0066] Using IFN1-F (GGGGTACCTCAGCAAAAGCGAACCTTCTGTAGA, SEQ ID NO:30) and IFN1-R (CCCTCGAGGCTCAAGAGAAAGTTTCAGAGACAT, SEQ ID NO:31) as primer pairs, zebrafish DNA was used as a template to amplify the IFN1 gene promoter sequence by PCR.

[0067] Using IFN3-F (CGGGGTACCACTAGGGTGCTGATTTTGA, SEQ ID NO:32) and IFN3-R (CCTCGAGACTATACATTACCAGGTTAATTATG, SEQ ID NO:33) as primer pairs, zebrafish DNA was used as a template to amplify the IFN3 gene promoter sequence by PCR.

[0068] The amplification products were purified using the AxyPrep DNA purification kit (AP-GX-250, Axygen, USA). The purified amplification products were ligated into the pGL3-Basic linearized vector (Addgene, Catalog #212936) using T4 DNA ligase (C301-01, Vazyme, China). The ligation product was transformed into *E. coli* DH5α competent cells, and positive colonies were screened. Recombinant plasmids pGL3-IFN1 and pGL3-IFN3 were extracted from the positive colonies. Recombinant plasmid pGL3-IFN1 is a plasmid carrying the promoter sequence of the IFN1 gene (gene ID: 360134). Recombinant plasmid pGL3-IFN3 is a plasmid carrying the promoter sequence of the IFN3 gene (gene ID: 100126803).

[0069] (2) Recombinant plasmids pGL3-IFN1 and pGL3-IFN3 were used for dual-luciferase activity analysis:

[0070] 1) pGL3-IFN1 and pGL3-IFN3 were mixed with Renilla (Addgene, Catalog #118016) at a ratio of 25 ng / μL: 5 ng / μL and then microinjected into zebrafish 1-cell stage embryos.

[0071] 2) Take 30 zebrafish embryos at 24 hpf and put them into a 1.5 mL EP tube. Add 400 μL of 1xPBS and grind them. Centrifuge at 4℃ and 1000 rcf for 5 min and discard the supernatant.

[0072] 3) Resuspend the cells in 1 mL PBS, filter through a 30-mesh filter cloth into a 2 mL EP tube, centrifuge at 4°C and 1000 rcf for 5 min, and discard the supernatant;

[0073] 4) Add 100 μL of 1× cell lysis buffer, incubate at room temperature for 30 min, and it can be used directly or stored in a -80℃ refrigerator.

[0074] 5) Take 20 μL of the processed sample into a 96-well plate, set up three replicates for each group, place it on ice, and wait for testing;

[0075] 6) First, add 15 μL of luciferase detection reagent LAR II, mix well, and then test on the instrument. Start reading the first time. The result displayed is the value of firefly luciferase. Record the result.

[0076] 7) Take out the 96-well plate, quickly add 15 μL of Stop & Glo reagent, mix well, take the second reading, and the result shown is the value of Renina luciferase. Record the result as the ratio of firefly luciferase value to Renina luciferase value, and normalize it by Renina luciferase activity.

[0077] Interferon (IFN) is a class of cytokines secreted by the body that can interfere with viral replication. When the body is infected by a virus, host cells release IFN to eliminate the pathogen. The results are as follows... Figure 3 Dual-luciferase activity assays revealed that, 48 hours after SVCV infection of cox17-mutant zebrafish embryos and wild-type zebrafish embryos, the cox17-mutant zebrafish embryos exhibited significantly higher relative luciferase activity. This indicates that, compared to wild-type zebrafish embryos, the cox17-mutant zebrafish embryos positively regulate the IFN1 and IFN3 promoters, suggesting that the antiviral genes IFN1 and IFN3 in cox17-mutant zebrafish are significantly activated, and that cox17-mutant zebrafish can significantly enhance their resistance to viruses.

[0078] 2. Quantitative Real-Time PCR

[0079] Real-time quantitative PCR reaction was performed using iQTM The Green Supermix SYBR Green IDye (Bio-Rad) was run on a Bio-Rad CFX96™ Real-Time system. The reaction system shown in Table 4 was used for fluorescent PCR. The reaction steps included: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 15 s, 40 cycles; temperature increase of 0.5℃ / cycle from 65℃ to 95℃, collecting fluorescence signals every 6 s; 30℃ for 30 s. Primer sequences are shown in Table 4. The expression of the 18S gene was used as an internal control. The method calculates the expression level of the target gene relative to the internal reference gene.

[0080] Table 3

[0081]

[0082] Table 4

[0083]

[0084]

[0085] Interferon regulators (IRFs) can specifically bind to the IFN gene promoter, activating antiviral-related immune signals. In zebrafish, IRF1, IRF3, IRF5, IRF7, IRF8, IRF9, and IRF11 effectively stimulate the expression of IFN1, while IRF1, IRF7, and IRF11 effectively stimulate the expression of IFN3. IRF2 and IRF10 act as repressors, negatively regulating IFN gene transcription.

[0086] like Figure 4 As shown, after SVCV virus infection, the mRNA expression levels of the IRF1, IRF3, IRF5, IRF7, IRF9, and IRF11 genes in cox17 mutant zebrafish embryos were significantly higher than those in wild-type zebrafish, while the mRNA expression levels of the IRF2 and IRF10 genes were significantly lower than those in wild-type zebrafish. This indicates that cox17 mutant zebrafish can significantly activate antiviral-related immune signals and thus enhance viral resistance after SVCV virus stress.

[0087] Antiviral ability test

[0088] Some test cases also examined the antiviral capabilities of wild-type zebrafish embryos and Cox17 mutant embryos. Specifically, these included:

[0089] (1) Collect 10 wild-type and 10 homozygous Cox17 mutant embryos from 72hpf zebrafish after SVCV infection at 48hpi (Hours after infection), 96hpi, and 10 embryos. Rinse the embryos with sterile deionized water and place them in a 1.5mL sterile EP tube. Add 500μL of sterile triple-distilled water and grind the embryos evenly with a grinding stick until no fragments are observed.

[0090] (2) Take 100 μL of the grinding solution and put it into another 1.5 mL sterile EP tube. Add serum-free DMEM medium to a final volume of 0.5 mL. Discard the monolayer EPC cell culture supernatant and add virus diluent. Add 0.5 mL of virus diluent to each well of cells.

[0091] (3) Place the virus-infected EPC cells back into the CO2 cell culture incubator and allow the virus to infect the cells for 1-2 hours. During this period, gently mix the virus dilution solution every 30 minutes to ensure that the virus fully contacts and infects the cells.

[0092] (4) After viral infection, the unadsorbed free virus was aspirated and discarded using a pipette; the cytopathic effect of the virus on EPC cells was observed 24 h and 48 h after infection.

[0093] The results are as follows Figure 5 , Figure 6 As shown, 24 h and 48 h after SVCV infection of cox17-mutant zebrafish embryos and wild-type zebrafish, EPC cells cultured from the tissue homogenate dilution of SVCV-infected cox17-mutant zebrafish embryos exhibited a lower lesion rate. This indicates that, within the same time frame, cox17-mutant zebrafish embryos had less residual virus, a stronger ability to kill SVCV in vivo, and thus possessed stronger antiviral capabilities.

[0094] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. The application of cox17-gRNA or a CRISPR / Cas9 kit for targeted editing of the cox17 gene in the construction of zebrafish resistant to spring viremia virus infection, characterized in that, The nucleotide sequence of the cox17-gRNA is shown in SEQ ID NO:1; The CRISPR / Cas9 kit for targeted editing of the cox17 gene includes Cas9 mRNA as shown in SEQ ID NO:29 and cox17-gRNA as shown in SEQ ID NO:1; The application yielded homozygous mutant zebrafish with loss of function of the cox17 gene, the homozygous mutant zebrafish containing the sequence shown in SEQ ID NO:8; Under conditions of infection with carp spring viremia virus, the mortality rate of the homozygous mutant zebrafish was lower than that of wild-type zebrafish.

Images