Heavy metal response plant molecular beacon vector and construction method and application thereof

Abstract

The application belongs to the technical field of biotechnology, and discloses a heavy metal response plant molecular beacon vector, which comprises a plant expression vector, a gene core segment 1 and a gene core segment 2; the gene core segment 1 comprises an MTF-1 gene and a promoter thereof; and the gene core segment 2 comprises a reporter gene and a promoter comprising a metal response element. The construction method of the plant molecular beacon vector and a heavy metal response visualization system is also disclosed. The heavy metal in a plant body can be visualized and monitored, which is of great practical significance for efficient identification and screening of heavy metal response mutants of offspring after physical and chemical mutagenesis, and subsequent heavy metal response gene mining. The application also discloses the application in the heavy metal visualization monitoring in the plant body and related primers. The operation is simple, the heavy metal in the plant body can be quickly and accurately visualized and monitored, and a new technical idea is provided for plant production and heavy metal related research.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a heavy metal-responsive plant molecular beacon carrier, its construction method, and its application. Background Technology

[0002] Soil is a vital component of the ecosystem. With rapid economic development and accelerated industrialization and urbanization, soil heavy metal pollution has become an increasingly prominent problem. Currently, commonly used methods for heavy metal detection in rice include atomic absorption spectrometry and mass spectrometry, which offer high sensitivity and accuracy. However, their high testing costs and complex operational techniques limit their widespread application. Therefore, developing a real-time, visualized monitoring system for heavy metals in rice to achieve rapid, high-throughput detection is of great significance for ensuring food security.

[0003] With the increasing severity of heavy metal pollution, metal-responsive beacon systems from various research fields have been developed and utilized over the past few decades. Metal regulatory proteins are specific metal-binding proteins in microorganisms that control the uptake, efflux, and storage of metal ions through transcriptional repression or activation mechanisms. Based on the transcriptional regulation mechanisms of these proteins, a series of whole-cell molecular beacon systems with cells as the primary sensing elements have been constructed, among which the MerR and ArsR / SmtR families of metal regulatory proteins are the most widely used. For example, Corbisier et al. (1993) used LuxAB as a reporter gene to construct recombinant plasmids targeting the Cd and As operons on Staphylococcus aureus plasmids, and induced their expression in Staphylococcus aureus. Subsequently, a series of whole-cell biological beacons using lacZ, lucFF, EGFP, and RFP as reporter genes to detect heavy metals such as Cd, Pb, Zn, Cu, As, and Sb have been reported. Currently, the development and utilization of heavy metal response beacon systems are mostly focused on microorganisms. Rice is a crop that easily absorbs and accumulates heavy metals, and the problem of heavy metal pollution in rice is particularly prominent. However, there are still no reports on the visualization and monitoring of heavy metals in rice by establishing molecular beacons. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a heavy metal-responsive plant molecular beacon vector based on the heavy metal transcription factor MTF-1, and to provide its construction method and application.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0006] In a first aspect, the present invention provides a heavy metal-responsive plant molecular beacon vector, comprising a plant expression vector, a gene core fragment 1, and a gene core fragment 2; wherein the gene core fragment 1 comprises the MTF-1 gene and its promoter; and the gene core fragment 2 comprises a reporter gene and a promoter comprising a metal-responsive element.

[0007] Metal-regulated transcription factor-1 (MTF-1) is a multifunctional transcriptional regulator that is highly conserved throughout evolution from insects to mammals. This nucleoplasmic shuttle protein accumulates in the nucleus when cells are subjected to heavy metal stress, specifically binding to metal-responsive elements (MREs) on the promoter of metallothionein genes to activate transcription.

[0008] Preferably, the plant expression vector described above is pEGFC.

[0009] Preferably, the plant is rice or Arabidopsis thaliana.

[0010] Preferably, the promoter of the MTF-1 gene is a Ubi or 35S promoter; the reporter gene is an EGFP or GUS gene; and the promoter containing the metal-responsive element is a 35S mini promoter containing the metal-responsive element MRE8.

[0011] Preferably, the sequence of the gene core fragment 1 is as shown in SEQ ID NO:1 or SEQ ID NO:2; and the sequence of the gene core fragment 2 is as shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0012] Secondly, the present invention provides a method for constructing a heavy metal-responsive plant molecular beacon carrier, comprising the following steps:

[0013] (1) Based on plant codon preference, the MTF-1 gene was synthesized, linked to the promoter, and the gene core fragment 1 was constructed.

[0014] (2) Based on plant codon preference, synthesize EGFP / GUS gene, link it with promoter containing metal response element, and construct gene core fragment 2;

[0015] (3) The gene core fragment 1 and the gene core fragment 2 are linked to a plant expression vector by homologous recombination to obtain the heavy metal responsive plant molecular beacon vector.

[0016] Thirdly, the present invention provides a method for constructing a heavy metal response visualization system, comprising the following steps: converting the heavy metal-responsive plant molecular beacon carrier into a plant receptor material, and obtaining a transgenic positive plant as the heavy metal response visualization system.

[0017] Fourthly, this invention provides an application of a heavy metal-responsive plant molecular beacon carrier in the visual monitoring of heavy metals in plants.

[0018] The above-described applications, preferably, include the following steps in the application of the heavy metal-responsive plant molecular beacon carrier for visual monitoring of heavy metals in plants:

[0019] (1) The heavy metal-responsive plant molecular beacon carrier was transformed into plant receptor material to obtain transgenic positive plants;

[0020] (2) When planting the transgenic positive plants, if it is necessary to detect heavy metals in the plants, the RNA of the transgenic positive plants is extracted and reversed into cDNA, and PCR amplification and fluorescence quantitative analysis are performed. Based on the fluorescence quantitative analysis results, the visual monitoring of reporter genes in the plants can be realized.

[0021] More preferably, when the reporter gene is the Arabidopsis GUS gene, the qPCR primers used for the PCR amplification are as follows:

[0022] Arabidopsis-qGUS F: 5'-GAATACGGCGTGGATACGTTAG-3',

[0023] Arabidopsis-qGUS R: 5'-GATCAAAGACGCGGTGATACA-3';

[0024] When the reporter gene is the rice GUS gene, the qPCR primers used for the PCR amplification are as follows:

[0025] Rice-qGUS F: 5'-GCAAGCTGACCGACACTATTA-3',

[0026] Rice-qGUS R: 5'-CACGTTCGTACCAGACATATCC-3';

[0027] When the reporter gene is the Arabidopsis thaliana EGFP gene, the qPCR primers used for the PCR amplification are as follows:

[0028] Arabidopsis-qEGFP F:5'-GAACCGCATCGAGCTGAA-3',

[0029] Arabidopsis-qEGFP R: 5'-TGCTTGTCGGCCATGATATAG-3';

[0030] When the reporter gene is the rice EGFP gene, the qPCR primers used for the PCR amplification are as follows:

[0031] Rice-qEGFP F: 5'-GAACCGCATCGAGCTGAA-3',

[0032] Rice-qEGFP R: 5'-TGCTTGTCGGCCATGATATAG-3'.

[0033] The above-described applications, preferably, include the following steps in the application of the heavy metal-responsive plant molecular beacon carrier for visual monitoring of heavy metals in plants:

[0034] (1) Transform heavy metal-responsive plant molecular beacon vectors into plant recipient materials to obtain transgenic positive plants;

[0035] (2) When planting the transgenic positive plant and it is necessary to detect heavy metals in the plant, the tissue of the transgenic positive plant is stained with GUS staining solution and the staining is observed, or the root tip tissue of the transgenic positive plant is placed under a fluorescence microscope for observation. If GUS staining or fluorescence is observed, it indicates that heavy metals are present in the plant; otherwise, it indicates that heavy metals are not present in the plant, thus realizing the visual monitoring of heavy metals in the plant.

[0036] In the above applications, preferably, the heavy metal is any one or more of As, Cd, and Cu.

[0037] Fifthly, this invention provides four pairs of PCR amplification primers for monitoring heavy metals in plants, wherein the primer sequences are any one of the following:

[0038] Primer 1:

[0039] Arabidopsis-qGUS F: 5'-GAATACGGCGTGGATACGTTAG-3',

[0040] Arabidopsis-qGUS R: 5'-GATCAAAGACGCGGTGATACA-3';

[0041] Primer 2:

[0042] Rice-qGUS F: 5'-GCAAGCTGACCGACACTATTA-3',

[0043] Rice-qGUS R: 5'-CACGTTCGTACCAGACATATCC-3';

[0044] Primer 3:

[0045] Arabidopsis-qEGFP F:5'-GAACCGCATCGAGCTGAA-3',

[0046] Arabidopsis-qEGFP R: 5'-TGCTTGTCGGCCATGATATAG-3';

[0047] Primer 4:

[0048] Rice-qEGFP F: 5'-GTCCAGTGCTTCTCAAGGTATC-3',

[0049] Rice-qEGFP R: 5'-TTCACCTCAGCCCTAGTCTTA-3'.

[0050] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0051] 1. This invention is based on the principle that the heavy metal transcription factor MTF-1 specifically binds to metal response elements (MREs), and constructs a molecular beacon system and a heavy metal response visualization system in plants; thereby realizing the visual monitoring of heavy metals in plants, which has important practical significance for the efficient identification and screening of heavy metal response mutants in the progeny of physicochemical mutagenesis, as well as the subsequent discovery of new heavy metal response genes.

[0052] 2. The application of this invention and related primers are simple to operate and can quickly and accurately visualize and monitor the heavy metal status in plants, providing new technical ideas for plant production and heavy metal-related research. Attached Figure Description

[0053] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0054] Figure 1 This is a schematic diagram of the heavy metal-responsive molecular beacon vector pEGFC-MTF1-MRE8-EGFP / GUS in Example 1;

[0055] Figure 2 This refers to the relative expression level of the GUS gene in the transgenic Arabidopsis thaliana in Example 2;

[0056] Figure 3 This is a staining observation image of the transgenic Arabidopsis thaliana in Example 2;

[0057] Figure 4 This refers to the relative expression level of the GUS gene in the transgenic rice in Example 2;

[0058] Figure 5 This is a staining observation diagram of the transgenic rice in Example 2;

[0059] Figure 6 This refers to the relative EGFP expression level of the transgenic Arabidopsis thaliana in Example 3;

[0060] Figure 7 This is a fluorescence observation image of the transgenic Arabidopsis thaliana in Example 3;

[0061] Figure 8 This represents the relative expression level of EGFP in the transgenic rice in Example 3.

[0062] Figure 9 This is a fluorescence observation image of the transgenic rice in Example 3. Detailed Implementation

[0063] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0064] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0065] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0066] This invention utilizes the principle of the mouse heavy metal transcription factor MTF-1 specifically binding to metal response elements (MREs) to construct heavy metal-responsive molecular beacon systems using EGFP and GUS as reporter genes, and verifies their expression using Arabidopsis thaliana and rice as recipient materials. When transgenic positive plants were treated with different metals and concentrations, MTF-1 specifically bound to the metal response elements (MREs), thereby activating the expression of downstream reporter genes.

[0067] Example 1: Construction of a heavy metal-responsive plant molecular beacon carrier

[0068] A heavy metal-responsive plant molecular beacon vector, the metal-responsive transcription factor MTF-1, is a multifunctional transcriptional regulator that regulates the expression of metal-responsive elements (MREs) on the promoters of metal-dependent MT (metal-dependent metal) genes, thereby participating in cellular responses to various stress conditions. MTF-1 has been relatively conserved throughout evolution from insects to mammals, and has been validated in multiple species, including humans, mice, capybaras, and fruit flies. The construction method of this molecular beacon vector is as follows:

[0069] 1. Referring to the core sequence of the mouse heavy metal transcription factor MTF-1 protein (MGI:101786), and based on the codon preference of transgenic plants, the MTF-1 gene was synthesized and linked to either the Ubi or 35S promoter to construct gene core fragment 1 (Ubi / 35S-MTF1); the Ubi-MTF1 sequence of rice is shown in SEQ ID NO:1, and the 35S-MTF1 sequence of Arabidopsis thaliana is shown in SEQ ID NO:2;

[0070] 2. Synthesize codon-biased EGFP or GUS reporter genes for transgenic plants. The EGFP or GUS reporter genes are linked to 35S mini promoters containing the metal-responsive element MRE8 to construct gene core fragment 2 (MRE8-35S mini-EGFP / GUS). The MRE8-35S mini-GFPEGFP sequence of rice is shown in SEQ ID NO:3, the MRE8-35S mini-GUS sequence of rice is shown in SEQ ID NO:4, the MRE8-35S mini-EGFP sequence of Arabidopsis thaliana is shown in SEQ ID NO:5, and the MRE8-35S mini-GUS sequence of Arabidopsis thaliana is shown in SEQ ID NO:6.

[0071] 3. Homologous recombination was used to ligate gene core fragment 1 and gene core fragment 2 into the plant expression vector pEGFC to construct the heavy metal-responsive molecular beacon vector pEGFC-MTF1-MRE8-EGFP / GUS. Figure 1 );

[0072] Example 2: Application of GUS reporter gene-based molecular beacons for plant heavy metal response

[0073] The heavy metal-responsive molecular beacon vector pEGFC-MTF1-MRE8-GUS constructed in Example 1 was genetically transformed using Arabidopsis thaliana and rice as recipient materials to obtain T2 generation transgenic positive plants.

[0074] 1. Take an appropriate amount of T2 generation transgenic positive Arabidopsis seeds and place them into 1.5ml centrifuge tubes. Add 1ml of sterile water and place them in a 4℃ refrigerator for vernalization for 3 days. After 3 days of vernalization, use a toothpick to sow the seeds in areas containing different concentrations of As. 3+ Cd 2+ and Cu 2+ In 1 / 2 MS solid medium, Arabidopsis thaliana was grown for 7 days. RNA was extracted from Arabidopsis thaliana treated with heavy metals and from normally cultured Arabidopsis thaliana using the Trizol method. The RNA was then reverse-engineered into cDNA. qPCR primers were designed using the GUS cDNA sequence: qGUSF: 5'-GAATACGGCGTGGATACGTTAG-3' (as shown in SEQ ID NO:7); qGUSR: 5'-GATCAAAGACGCGGTGATACA-3' (as shown in SEQ ID NO:8). Quantitative PCR was performed using a Roche 480 real-time PCR instrument. The results are shown below. Figure 2 As shown, the expression of the GUS gene in Arabidopsis thaliana treated with heavy metals was significantly increased compared with the control. Heavy metal-treated and normally cultured Arabidopsis thaliana were placed in 1.5 ml centrifuge tubes, and an appropriate volume of freshly prepared GUS staining working solution was added. The tubes were wrapped in aluminum foil and incubated overnight at room temperature. After elution with 70% ethanol, the staining was observed. Figure 3 Transgenic Arabidopsis thaliana showed a clear blue color after being treated with 5 μL of different concentrations of NaAsO2, CdCl2, and CuSO4 solutions, while normally cultured Arabidopsis thaliana was basically colorless.

[0075] 2. T2 generation transgenic positive rice seeds were soaked at room temperature for 24 hours and then germinated in a 37℃ incubator in the dark for 12 hours. Rice seeds with uniform germination were sown in a 96-well PCR plate (bottom removed) and cultured in a rice incubator. When the plants reached the 2-leaf-1-heart stage, they were treated with NaAsO2, CdCl2, and CuSO4 solutions for 7 days, respectively. RNA was extracted from the heavy metal-treated rice and normally cultured rice using the Trizol method, and the RNA was reverse-engineered into cDNA. qPCR primers were designed using the GUS cDNA sequence: qGUS F: 5'-GCAAGCTGACCGACACTATTA-3' (as shown in SEQ ID NO: 9); qGUS R: 5'-CACGTTCGTACCAGACATATCC-3' (as shown in SEQ ID NO: 10). Quantitative PCR analysis was performed using a Roche 480 real-time PCR instrument. The results are shown below. Figure 4As shown; the expression of the GUS gene in rice treated with heavy metals was significantly increased compared with the control; the leaves, roots and stems of transgenic rice treated with heavy metals and normally cultured rice were cut into small pieces and placed in 5ml centrifuge tubes, an appropriate volume of freshly prepared GUS staining working solution was added, the tubes were wrapped in aluminum foil and incubated overnight at room temperature, and the staining was observed after elution with 70% ethanol. Figure 5 The leaves of transgenic rice turned blue after treatment with 5 μM and 10 μM NaAsO2, CdCl2 and CuSO4 solutions, while the roots and stems of normally cultured rice were basically colorless.

[0076] Example 3: Application of plant heavy metal response molecular beacons based on EGFP reporter gene

[0077] The heavy metal-responsive molecular beacon vector pEGFC-MTF1-MRE8-EGFP constructed in Example 1 was genetically transformed using Arabidopsis thaliana and rice as recipient materials to obtain T2 generation transgenic positive plants.

[0078] 1. Take an appropriate amount of T2 generation transgenic positive Arabidopsis seeds and place them into 1.5ml centrifuge tubes. Add 1ml of sterile water and place them in a 4℃ refrigerator for vernalization for 3 days. After 3 days of vernalization, use a toothpick to sow the seeds in areas containing different concentrations of As. 3+ Cd 2+ and Cu 2+ In 1 / 2 MS solid medium, Arabidopsis thaliana was grown for 7 days. RNA was extracted from both heavy metal-treated and normally cultured Arabidopsis thaliana using the Trizol method, and the RNA was reverse-engineered into cDNA. qPCR primers were designed using the EGFP cDNA sequence: qEGFPF: 5'-GAACCGCATCGAGCTGAA-3' (as shown in SEQ ID NO: 11); qEGFP R: 5'-TGCTTGTCGGCCATGATATAG-3' (as shown in SEQ ID NO: 12). Quantitative PCR was performed using a Roche 480 real-time PCR instrument. The results are shown below. Figure 6 As shown, the expression of the EGFP gene in Arabidopsis thaliana treated with heavy metals was significantly increased compared with the control; the root tips of Arabidopsis thaliana treated with heavy metals and those of normally cultured Arabidopsis thaliana were observed under a fluorescence microscope. Figure 7 Transgenic rice root tips showed green fluorescence after treatment with NaAsO2, CdCl2, and CuSO4 solutions, while normally cultured rice root tips showed almost no fluorescence.

[0079] 2. T2 generation transgenic positive rice seeds were soaked at room temperature for 24 hours and then germinated in a 37℃ incubator in the dark for 12 hours. Rice seeds with uniform germination were sown in a 96-well PCR plate (bottom removed) and cultured in a rice incubator. When the plants reached the 1-leaf-1-heart stage, they were treated with NaAsO2, CdCl2, and CuSO4 solutions for 7 days, respectively. RNA was extracted from the heavy metal-treated rice and normally cultured rice using the Trizol method, and the RNA was reverse-engineered into cDNA. qPCR primers were designed using the EGFP cDNA sequence: qEGFP F: 5'-GTCCAGTGCTTCTCAAGGTATC-3' (as shown in SEQ ID NO:13); qEGFP R: 5'-TTCACCTCAGCCCTAGTCTTA-3' (as shown in SEQ ID NO:14). Quantitative PCR analysis was performed using a Roche 480 real-time PCR instrument. The results are shown below. Figure 8 As shown, the expression of the EGFP gene in rice treated with heavy metals was significantly increased compared to the control; the root tips of transgenic rice treated with heavy metals and normally cultured transgenic rice were observed under a fluorescence microscope. Figure 9 Transgenic rice root tips showed fluorescence after treatment with NaAsO2 and CdCl2 solutions, while normally cultured rice root tips showed almost no fluorescence.

[0080] In summary, the heavy metal-responsive plant molecular beacon vector of this invention comprises constructing core fragment 1 (Ubi / 35S-MTF1) and core fragment 2 (MRE8-35S mini-EGFP / GUS), and ligating core fragments 1 and 2 into the plant expression vector pEGFC using homologous recombination to construct the heavy metal-responsive plant molecular beacon vector pEGFC-MTF1-MRE8-EGFP / GUS. The constructed molecular beacon vector was transformed into Arabidopsis thaliana and rice to obtain transgenic positive plants. After treatment with different metals and concentrations, transgenic positive plants containing the GUS reporter gene showed blue fluorescence after GUS staining, while transgenic plants containing the EGFP reporter gene emitted green fluorescence at an excitation wavelength of 488 nm. The establishment of this plant molecular beacon vector is of significant practical importance for subsequent visualization and monitoring of heavy metals in rice, as well as for the efficient identification and screening of heavy metal-responsive mutants in physicochemically induced mutagenesis and the discovery of new genes.

[0081] Ubi-MTF1 sequence (rice), SEQ ID NO:1:

[0082]

[0083] 35S-MTF1 sequence (Arabidopsis thaliana), SEQ ID NO:2:

[0084]

[0085] MRE8-35S mini-EGFP (rice), SEQ ID NO:3:

[0086]

[0087] MRE8-35S mini-GUS (rice), SEQ ID NO:4:

[0088]

[0089] MRE8-35S mini-EGFP (Arabidopsis thaliana), SEQ ID NO:5:

[0090]

[0091] MRE8-35S mini-GUS (Arabidopsis thaliana), SEQ ID NO:6:

[0092] TTTTGCACACGGCCCTTTTGCACACGGCCCTTTTGCGCTCGGCCCTTTTGCGCTCGGCCCTTTTGCACACGGCCCTTTTGCACACGGCCCTTTTGCGCTCGGCCCTTTTGCGCTCGGCCCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGAAGCTAGTCGACTAGAGCCACCATGTTACGTCCTGTAGAAACCCCAACCCGTGAAATCAAAAAACTCGACGGCCTGTGGGCATTCAGTCTGGATCGCGAAAACTGTGGAATTGATCAGCGTTGGTGGGAAAGCGCGTTACAAGAAAGCCGGGCAATTGCTGTGCCAGGCAGTTTTAACGATCAGTTCGCCGATGCAGATATTCGTAATTATGCGGGCAACGTCTGGTATCAGCGCGAAGTCTTTATACCGAAAGGTTGGGCAGGCCAGCGTATCGTGCTGCGTTTCGATGCGGTCACTCATTACGGCAAAGTGTGGGTCAATAATCAGGAAGTGATGGAGCATCAGGGCGGCTATACG

[0093] CCATTTGAAGCCGATGTCACGCCGTATGTTATTGCCGGGAAAAGTGTACGTATCACCGTT

[0094] TGTGTGAACAACGAACTGAACTGGCAGACTATCCCGCCGGGAATGGTGATTACCGACGA

[0095] AAACGGCAAGAAAAAGCAGTCTTACTTCCATGATTTCTTTAACTATGCCGGAATCCATCG

[0096] CAGCGTAATGCTCTACACCACGCCGAACACCTGGGTGGACGATATCACCGTGGTGACGC

[0097] ATGTCGCGCAAGACTGTAACCACGCGTCTGTTGACTGGCAGGTGGTGGCCAATGGTGAT

[0098] GTCAGCGTTGAACTGCGTGATGCGGATCAACAGGTGGTTGCAACTGGACAAGGCACTA

[0099] GCGGGACTTTGCAAGTGGTGAATCCGCACCTCTGGCAACCGGGTGAAGGTTATCTCTAT

[0100] GAACTGTGCGTCACAGCCAAAAGCCAGACAGAGTGTGATATCTACCCGCTTCGCGTCGG

[0101] CATCCGGTCAGTGGCAGTGAAGGGCGAACAGTTCCTGATTAACCACAAACCGTTCTACT

[0102] TTACTGGCTTTGGTCGTCATGAAGATGCGGACTTGCGTGGCAAAGGATTCGATAACGTG

[0103] CTGATGGTGCACGACCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTC

[0104] GCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGA

[0105] TTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTCGAAGCGGGCA

[0106] ACAAGCCGAAAGAACTGTACAGCGAAGAGGCAGTCAACGGGGAAACTCAGCAAGCGC

[0107] ACTTACAGGCGATTAAAGAGCTGATAGCGCGTGACAAAAACCACCCAAGCGTGGTGAT

[0108] GTGGAGTATTGCCAACGAACCGGATACCCGTCCGCAAGGTGCACGGGAATATTTCGCGC

[0109] CACTGGCGGAAGCAACGCGTAAACTCGACCCGACGCGTCCGATCACCTGCGTCAATGTA

[0110] ATGTTCTGCGACGCTCACACCGATACCATCAGCGATCTCTTTGATGTGCTGTGCCTGAAC

[0111] CGTTATTACGGATGGTATGTCCAAAGCGGCGATTTGGAAACGGCAGAGAAGGTACTGGA

[0112] AAAAGAACTTCTGGCCTGGCAGGAGAAACTGCATCAGCCGATTATCATCACCGAATACG

[0113] GCGTGGATACGTTAGCCGGGCTGCACTCAATGTACACCGACATGTGGAGTGAAGAGTAT

[0114] CAGTGTGCATGGCTGGATATGTATCACCGCGTCTTTGATCGCGTCAGCGCCGTCGTCGGT

[0115] GAACAGGTATGGAATTTCGCCGATTTTGCGACCTCGCAAGGCATATTGCGCGTTGGCGGT

[0116] AACAAGAAAGGGATCTTCACTCGCGACCGCAAACCGAAGTCGGCGGCTTTTCTGCTGC

[0117] AAAAACGCTGGACTGGCATGAACTTCGGTGAAAAACCGCAGCAGGGAGGCAAACAAT

[0118] GAATCAACAACTCTCCTGGCGCACCATCGTCGGCTACAGCCTCGGGAATTGCTACCGAG

[0119] CTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTT

[0120] GCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAA

[0121] CATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACA

[0122] TTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGG

[0123] TGTCATCTATGTTACTAGATC。

Claims

1. A heavy metal-responsive plant molecular carrier, characterized in that, It includes the plant expression vector pEGFP, gene core fragment 1, and gene core fragment 2; the gene core fragment 1 contains MTF-1 The gene and its promoter; the core fragment 2 of the gene contains a reporter gene and a promoter containing a metal-responsive element; When the plant is rice, the sequence of the gene core fragment 1 is as shown in SEQ ID NO:1, and the sequence of the gene core fragment 2 is as shown in SEQ ID NO:3 or SEQ ID NO:

4. When the plant is Arabidopsis thaliana, the sequence of the gene core fragment 1 is as shown in SEQ ID NO:2, and the sequence of the gene core fragment 2 is as shown in SEQ ID NO:5 or SEQ ID NO:

6.

2. A method for constructing a heavy metal-responsive plant molecular carrier as described in claim 1, characterized in that, Includes the following steps: (1) Synthesis based on plant codon preference MTF-1 Genes are linked to promoters to construct gene core fragment 1; (2) Based on the plant codon preference, a reporter gene was synthesized and linked to a promoter containing a metal response element to construct the gene core fragment 2; (3) The gene core fragment 1 and the gene core fragment 2 are linked to the plant expression vector by homologous recombination to obtain the heavy metal responsive plant molecular vector.

3. A method for constructing a heavy metal response visualization system, characterized in that, The process includes the following steps: transforming the heavy metal-responsive plant molecular carrier described in claim 1 into a plant receptor material, and obtaining transgenic positive plants, which are the heavy metal response visualization system.

4. The application of the heavy metal-responsive plant molecular carrier as described in claim 1 in the visual monitoring of heavy metals in plants, characterized in that, The plant is rice or Arabidopsis thaliana, and the heavy metal is any one or more of As, Cd, and Cu.

5. The application according to claim 4, characterized in that, The application of the heavy metal-responsive plant molecular carrier in the visual monitoring of heavy metals in plants includes the following steps: (1) The heavy metal-responsive plant molecular carrier is transformed into plant receptor material to obtain transgenic positive plants; (2) When planting the transgenic positive plants, if it is necessary to detect heavy metals in the plants, the RNA of the transgenic positive plants is extracted and reversed into cDNA, and PCR amplification and fluorescence quantitative analysis are performed. Based on the fluorescence quantitative analysis results, the visualization monitoring of heavy metals in the plants can be realized.

6. The application according to claim 5, characterized in that, The reporter gene is Arabidopsis thaliana. GUS For gene amplification, the qPCR primers used are as follows: Arabidopsis thaliana-q GUS F: 5’-GAATACGGCGTGGATACGTTAG-3’, Arabidopsis-q GUS R: 5'-GATCAAAGACGCGGTGATACA-3'; The reporter gene is rice. GUS For gene amplification, the qPCR primers used are as follows: Rice-q GUS F: 5'-GCAAGCTGACCGACACTATTA-3', Rice-q GUS R: 5'-CACGTTCGTAACCAGACATATCC-3'; The reporter gene is Arabidopsis thaliana. EGFP For gene amplification, the qPCR primers used are as follows: Arabidopsis-q EGFP F: 5'-GAACCGCATCGAGCTGAA-3', Arabidopsis-q EGFP R: 5'-TGCTTGTCGGCCATGATATAG-3'; The reporter gene is rice. EGFP For gene amplification, the qPCR primers used are as follows: Rice-q EGFP F: 5'-GAACCGCATCGAGCTGAA-3', Rice-q EGFP R: 5'-TGCTTGTCGGCCATGATATAG-3'.

7. The application according to claim 4, characterized in that, The application of the heavy metal-responsive plant molecular carrier in the visual monitoring of heavy metals in plants includes the following steps: (1) The heavy metal-responsive plant molecular carrier is transformed into plant receptor material to obtain transgenic positive plants; (2) When planting the transgenic positive plants, and it is necessary to test for heavy metals in the plants, the tissue of the transgenic positive plants is subjected to... GUS After staining with the staining solution, observe the staining condition, or observe the root tip tissue of the transgenic positive plants under a fluorescence microscope. If staining is observed... GUS Staining or fluorescence indicates the presence of heavy metals in the plant; Conversely, it indicates that there are no heavy metals in the plant, thus achieving visual monitoring of heavy metals in the plant.

Images