Degradation of polyurethane plastic gene purh and application thereof

By developing the polyurethane degrading enzyme PurH and its gene purh, we have achieved efficient degradation of polyurethane plastics through genetic engineering, solving the environmental pollution problem of polyurethane plastics and providing an environmentally friendly degradation solution.

CN118995662BActive Publication Date: 2026-07-31NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANJING AGRICULTURAL UNIVERSITY
Filing Date
2024-07-09
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

Existing polyurethane plastics degrade slowly in the natural environment, resulting in serious waste pollution. Traditional treatment methods pose environmental risks, and there is a lack of efficient and environmentally friendly recycling technologies.

Method used

We developed the polyurethane degrading enzyme PurH and its related gene purh, and achieved efficient degradation of PUR plastics through recombinant expression vectors and genetically engineered strain E.coli BL21(DE3).

Benefits of technology

PurH enzymes achieved a degradation rate of 72.69% for PUR plastics, providing a new approach for preparing environmentally friendly degradable products and reducing environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995662B_ABST
    Figure CN118995662B_ABST
Patent Text Reader

Abstract

This invention discloses the PurH enzyme capable of degrading polyurethane plastics and its encoding gene, purh. Its nucleotide sequence is SEQ ID NO.1, and its amino acid sequence is SEQ ID NO.2. By constructing a phylogenetic tree with polyurethane-degrading enzymes reported in the PAZy plastic active enzyme database, PurH is most closely related to keratinase and forms a separate branch, indicating that PurH is a novel keratinase among plastic depolymerization enzymes. The specific contents of this invention include: cloning the purh gene; construction of the pET29a-purh expression vector; expression, purification, and functional verification of the PurH protein; and the production of a clear zone by the PurH enzyme on Impranil plates, resulting in a 72.69% weight loss of PUR foam, demonstrating that the protein encoded by the purh gene has the function of degrading polyurethane plastics and has great application potential in the biodegradation of polyurethane plastics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a polyurethane degradation gene, phurh, and its applications. Background Technology

[0002] Polyurethane (PUR), a high-performance polymer material, is widely used in various fields such as home furnishings, automobiles, construction, and textiles due to its excellent mechanical properties, heat resistance, and durability. However, due to its structural stability, PUR plastics degrade very slowly in the natural environment, resulting in serious environmental pollution problems caused by its waste. Currently, PUR waste is mainly treated through landfill, incineration, mechanical recycling, and chemical recycling, but these traditional disposal methods all pose potential risks of environmental pollution. Therefore, optimizing and upgrading existing recycling technologies is crucial in promoting a circular plastics economy. Simultaneously, we urgently need to explore innovative recycling strategies for PUR waste to achieve a more efficient and environmentally friendly recycling process.

[0003] Against this backdrop, the development of novel PUR-degrading enzymes and their application technologies is particularly important. In recent years, various microorganisms capable of growing using PUR as their sole carbon source have been identified, and enzymes capable of degrading PUR have been isolated from them. However, related reports are still relatively few, and few degrading enzymes have been applied to the degradation of commercial PUR plastics. This situation highlights the necessity for further research in this field. Due to the environmental durability issues of polyurethane materials, the development of novel and efficient polyurethane-degrading enzymes is of great significance for promoting a circular economy for plastics and reducing the impact of plastic waste on ecosystems. Summary of the Invention

[0004] The purpose of this invention is to provide a novel protein, its encoding gene, and its uses, wherein the protein has the function of degrading polyurethane plastics.

[0005] To achieve the above objectives, the present invention provides a protein comprising:

[0006] The gene purh encodes the polyurethane degrading enzyme PurH.

[0007] A recombinant expression vector containing the aforementioned gene purh.

[0008] The recombinant expression vector is preferably obtained by inserting the purh gene between the Nde I and XhoI sites of pET-29a(+).

[0009] Genetically engineered bacteria containing the aforementioned gene purh.

[0010] The preferred expression strain of the genetically engineered bacteria is E. coli BL21(DE3).

[0011] The application of the polyurethane degrading enzyme PurH in the degradation of polyurethane plastics.

[0012] The application of the purh gene in the genetic engineering of degrading polyurethane plastics.

[0013] The application of the polyurethane degrading enzyme PurH, the gene purh, the recombinant expression vector, and the engineered bacteria in the preparation of polyurethane plastic degradation products.

[0014] Beneficial effects:

[0015] This invention clones a novel PUR plastic degrading enzyme from Aleromicrobium tamlense LTX1. This enzyme achieves a PUR plastic degradation rate of 72.69% and is expected to be used to prepare PUR plastic degradation products. Attached Figure Description

[0016] Figure 1: Phylogenetic analysis of the PUR plastic degrading enzyme PurH

[0017] Figure 2: SDS-PAGE electrophoresis image of heterologously expressed PurH enzyme.

[0018] Figure 3: PurH versus Impranil DLN ® Degradation activity of the plate

[0019] Figure 4: PurH's degradation efficiency on polyurethane foam

[0020] Certificate of Preservation of Biological Materials

[0021] Aeromicrobium tamlense LTX1, classified as Aeromicrobium tamlense, is deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number: GDMCC NO: 62956, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, deposited on November 30, 2022.

[0022] Alignment of the 16S rRNA sequence of strain LTX1 with the EzBioCloud database showed that LTX1 had the highest homology with Aeromicrobium tamlense SSW1-57. However, after alignment with the NCBI database and phylogenetic analysis, it showed the highest homology with Aeromicrobium sp. HA. Given that the EzBioCloud database does not include information on Aeromicrobium sp. HA, and considering the comprehensiveness of the NCBI database, the inventors revised the name of this strain from Aeromicrobium tamlense LTX1 to Aeromicrobium sp. LTX1. Detailed Implementation

[0023] Example 1: Obtaining the degradation gene purh

[0024] 1.1 Extraction of total DNA from PUR-degrading strain LTX1 (GDMCC NO: 62956)

[0025] Take 2 mL of LTX1 bacterial culture medium, centrifuge at 10,000 rpm for 1 min, and discard the culture medium. Add 230 μL of Buffer GA and vortex until the bacterial cells are completely resuspended. Add 20 μL of Proteinase K and vortex to mix. Add 250 μL of Buffer GB and vortex to mix, then incubate at 70°C for 10 min. Add 4 μL of RNase A to the digestion solution, vortex for 15 s, and incubate at room temperature for 15 min. Add 180 μL of anhydrous ethanol, vortex to mix, and collect the liquid on the inner wall of the tube cap after a brief centrifugation. Transfer the supernatant to a FastPuregDNA Mini Columns III adsorption column (the adsorption column is already placed in the collection tube), centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Add 500 μL of Buffer PB (with anhydrous ethanol) to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Add 600 μL of Buffer PW (containing anhydrous ethanol) to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Repeat this step. Place the adsorption column back into the collection tube and centrifuge the empty tube at 12,000 rpm for 2 min. After centrifugation of the empty column, leave it open for 5 min to allow residual ethanol to evaporate completely. Transfer the adsorption column to a new 1.5 ml centrifuge tube, add 50 μL of Elution Buffer to the center of the adsorption column membrane, incubate at room temperature for 5 min, and centrifuge at 12,000 rpm for 1 min. Discard the adsorption column, and store the DNA product at -20°C to prevent degradation.

[0026] 1.2 Cloning of the purh gene

[0027] To explore enzymes involved in PUR plastic degradation in Aeromicrobium sp. LTX1 (GDMCC NO: 62956), PUR degrading enzyme sequences were first downloaded from the PAZy plastic active enzyme database (https: / / www.pazy.eu). These sequences were then subjected to local homology alignment (BLAST) with the whole genome sequence of LTX1 using TBtools. The screened genes were further identified by CLEAN function prediction to pinpoint potential PUR plastic degradation genes.

[0028] Amplification primers R1: 5'-GCCGAGAACCCGTACGAGC-3', F1: 5'-TCACTGGATCCGGTAGTCCG-3' were designed to amplify the gene using the genomic DNA of strain LTX1 as a template.

[0029] PCR amplification system:

[0030]

[0031] PCR amplification procedure:

[0032] a. Pre-denaturation at 95℃ for 3 min;

[0033] b. 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 25 s, for 32 cycles;

[0034] c. Extend 5 mi at 72°C, then cool to room temperature.

[0035] 3 μL of PCR product was electrophoresed in a 1% agarose gel and photographed using a gel imaging system; the gel was then extracted using a gel extraction kit (Vazyme) and stored at -20°C.

[0036] The recovered PCR product was ligated to the pMD19-T vector using T4 ligase. The reaction mixture (10 μL) consisted of 5 μL Solution I, 1 μL pMD19-T, and 4 μL PCR product. The ligation mixture was incubated at 16°C for 4 h. 10 μL of the product was added to 100 μL of competent cells, and the mixture was gently tapped to mix. The mixture was then incubated on ice for 30 min. After heat shock at 42°C for 45 s, the mixture was cooled on ice for 2–3 min. 900 μL of LB medium (antibiotic-free) was added, and the mixture was incubated at 37°C with shaking for 1 h. LB agar plates containing Amp were preheated at 37°C. After 1 h of incubation, the competent cells were centrifuged at 12000 rpm for 5 s, and 900 μL of supernatant was discarded. The cells were resuspended in the remaining medium by pipetting, and then gently spread onto a sterile plate using a spreader. The cells were incubated in an inverted position at 37°C overnight. Select 3-4 transformants, culture them in test tubes, and send the bacterial culture to General Biosciences for sequencing.

[0037] We named this gene purh, with a full length of 783 bp. Based on local homology comparison using TBtool, the purh gene encodes the PurH protein, which shares the highest homology (63.24%) with the Tcur_1278 polyester hydrolase from Thermomonspora curvata DSM43183. We downloaded the amino acid sequences of all PUR-degrading enzymes from the PAZy plastic active enzyme database and constructed a protein phylogenetic tree. The results are as follows... Figure 1 As shown, the reported PUR degrading enzymes are mainly divided into three clusters. The position of PurH in the phylogenetic tree indicates that it is a novel keratinase among plastic depolymerases.

[0038] 2.1 Synthesis and Amplification of the purh Gene

[0039] purh gene recombination primers were designed using CE Design, and amplification was performed using total DNA from strain Aeromicrobium sp. LTX1 as a template. The amplification primers were purh-R: TAAGAAGGAGATATACATATGGCCGAGAACCCGTACGAGC and purh-F: GTGGTGGTGGTGGTGCTCGAGCTGGATCCGGTAGTCCG.

[0040] PCR amplification system:

[0041]

[0042] PCR amplification procedure:

[0043] a. Pre-denaturation at 95℃ for 3 min;

[0044] b. 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 25 s, for 32 cycles;

[0045] c. Extend 5 mi at 72°C, then cool to room temperature.

[0046] 3 μL of PCR product was electrophoresed in a 1% agarose gel and photographed using a gel imaging system; the gel was then extracted using a gel extraction kit (Vazyme) and stored at -20°C.

[0047] 2.2 Double digestion and purification of plasmid pET-29a(+)

[0048] The vector pET-29a(+) was double-digested and purified using NdeI / XhoI restriction enzymes. The digestion system is as follows:

[0049]

[0050] The enzyme was digested at 37 °C for 2 h. After the reaction, the enzyme digestion effect was detected by 1% agarose gel electrophoresis, and the purified double-digested plasmid fragments were recovered using a gel extraction kit.

[0051] 2.3 Construction of expression vector pET29a-purh and screening of positive transformants

[0052] Homologous recombination was performed on the double-digested pET-29a(+) fragment and the target gene fragment (783 bp). The homologous recombination system (20 μL) is as follows, and the steps are in accordance with the instructions of the homologous recombination one-step cloning kit.

[0053]

[0054] After homologous recombination, the recombinant plasmid pET29a-purh was transformed into E. coli DH5α competent cells. Positive clones were then picked from LB agar plates containing Km (50 mg / L) and cultured in corresponding antibiotic-containing liquid LB medium for expansion. PCR was used to verify successful transformation, and sequencing was performed to confirm the correct introduction of the target fragment. Subsequently, the plasmid was transformed into E. coli BL21(DE3) competent cells, and positive clones were picked again for verification.

[0055] Example 3 Expression and purification of PurH protein

[0056] E. coli BL21(DE3) containing recombinant plasmid pET29a-purh was cultured in LB broth containing Km (50 mg / L) at 37 °C and 180 rpm until OD200. 600The concentration was increased to 0.5–0.8. IPTG was then added to a final concentration of 0.2 mM for induction. After 20 h at 16°C, the cells were collected by centrifugation at 4°C (12000 rpm) and briefly stored at -20°C. The cells were resuspended in 20 mM PBS (pH 7.4). The resuspended cells were then sonicated (Auto Science, UH-650B ultrasonic processor, 40% intensity) at 12000 rpm for 20 min at 4°C to remove the precipitate. The prepared crude enzyme solution was then stored in an ice box for short-term preservation.

[0057] The recombinant protein PurH was purified by elution using a Ni-IDA-agarose column, as follows (the following operations must be performed at low temperature):

[0058] First, filter the crude PurH enzyme solution through a 0.22 μm filter membrane to remove residual impurities (to prevent column clogging) and place it on ice for later use. Remove Ni from the refrigerator at 4°C. 2+ Affinity chromatography column: After the preservation solution elutes, binding buffer (5 column volumes) is slowly added for washing and equilibration. Next, crude enzyme solution is added to the column and incubated for 5 min to ensure complete binding. Then, 10 mL of elution buffer 1 (16 mM Na₂HPO₄, 274 mM NaCl, 4 mM NaH₂PO₄, 50 mM imidazole, pH 7.4) is used to wash away impurities. Finally, 10 mL of elution buffer 2 (16 mM Na₂HPO₄, 274 mM NaCl, 4 mM NaH₂PO₄, 100 mM imidazole, pH 7.4) is used to collect the target protein. After collecting the eluent, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is used to detect the protein expression level and purity. Figure 2 The results showed that the purified protein exhibited a single band on the SDS-PAGE electrophoresis pattern, approximately 30 kDa in size, consistent with the predicted theoretical value of 27.75 kDa. A dialysis bag with a molecular weight cutoff of 7 kDa was used, placed in wash buffer, and dialyzed overnight at 4 °C to remove imidazole before subsequent experiments.

[0059] Example 4 Functional verification of PurH protein

[0060] PurH enzyme activity assay: The reaction system consisted of 1 mL of: 10 μL 10 mM p-nitrophenol butyrate (pNPB), 10 μL enzyme solution, and 980 μL 20 mM phosphate buffered saline (PBS buffer, pH 7.4). The solution was heated at 37°C for 10 min, and the absorbance was measured at 410 nm using a spectrophotometer. Enzyme activity is defined as the amount of enzyme required to generate 1 μmol of p-nitrophenol per minute at 37°C.

[0061] Using an agar punch in Impranil DLN ® Punch wells in a plate and add 20, 50, and 100 μL of purified PurH enzyme to each well. Incubate overnight at 30°C and observe for the formation of clear transparent zones. Figure 3 90 U of purified PurH enzyme was added to 10 mL of PBS buffer (20 mM, pH 7.4) containing approximately 35 mg of commercial PUR foam, and reacted at 30°C and 180 rpm for 48 h. The control group received no enzyme. After the reaction, the degraded foam was collected by filtration through double-layered filter paper and dried together in a 55°C oven to constant weight. The net weight of the foam after degradation was calculated by weighing the total mass of the dried filter paper and foam, as well as the initial mass of the pre-weighed filter paper. The PUR foam degraded by PurH enzyme for 48 h showed significant degradation compared to the control group, eventually becoming powdery, with a calculated mass loss rate of 72.69%. Figure 4 The results show that PurH enzyme can effectively degrade PUR plastics, thus demonstrating great application potential in the biodegradation of PUR plastics.

Claims

1. Use of the polyurethane-degrading enzyme PurH in the degradation of polyurethane plastics, characterized in that, The polyurethane degrading enzyme PurH was prepared by the following method: (1) The total DNA of strain Aeromicrobium sp. LTX1 with preservation number GDMCC NO: 62956 was used as a template to amplify the purh gene. The amplification primers were purh-R: TAAGAAGGAGATATACATATGGCCGAGAACCCGTACGAGC and purh-F: GTGGTGGTGGTGGTGCTCGAGCTGGATCCGGTAGTCCG. (2) The pET-29a(+) fragment and the purh gene fragment after double enzyme digestion are subjected to homologous recombination, and after the homologous recombination is completed, the recombinant plasmid pET29a-purh is transformed into E. coli DH5α competent cells, and then positive clones are picked on LB plates containing 50 mg / L Km and expanded in corresponding resistant liquid LB medium. After successful transformation is verified by PCR, the correctness of the introduction of the target fragment is verified by sequencing, and then the target fragment is transformed into E. coli BL21(DE3) competent cells, and positive clones are picked for verification. (3) The plasmid containing recombinant plasmid pET29a- purh of E. coli BL21(DE3) was cultured in LB solution containing 50 mg / L Km at 37°C and 180 rpm until OD. 600 The concentration was increased to 0.5-0.8; then IPTG was added to a final concentration of 0.2 mM for induction. After 20 h at 16 °C, the cells were collected by centrifugation at 4 °C and resuspended in 20 mM PBS buffer. The resuspended cells were then sonicated at 12000 rpm for 20 min at 4 °C to remove the precipitate and obtain the crude enzyme solution. (4) The recombinant protein PurH was purified by elution and purification using a Ni-IDA-agarose column to obtain the purified polyurethane degrading enzyme PurH.

2. The application of the polyurethane degrading enzyme PurH as described in claim 1 in the preparation of polyurethane plastic degradation products.