Recombinant pegrna for improving gene editing efficiency and application thereof

CN118995709BActive Publication Date: 2026-08-07NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NORTHEAST AGRICULTURAL UNIVERSITY
Filing Date
2024-08-23
Publication Date
2026-08-07

AI Technical Summary

Technical Problem

3’flap通过与下游基因组序列同源的序列进行单链的入侵,这期间由切口产生的5’flap与3’flap会产生竞争,虽然具有更多同源序列的5’flap更容易与非编辑链杂交,但5’flap更容易被内切酶FEN1和外切酶EXO1切除

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995709B_ABST
    Figure CN118995709B_ABST
Patent Text Reader

Abstract

The application discloses a recombinant pegRNA for improving gene editing efficiency and application thereof, and belongs to the technical field of biology.The application aims to improve the gene editing efficiency and provides a tool for gene editing.The recombinant pegRNA for improving gene editing efficiency takes a pegRNA sequence as a starting sequence, and replaces bases at positions 53 to 56 with a lock sequence, so that a more effective tool is provided for gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant pegRNA that improves gene editing efficiency and its applications. Background Technology

[0002] Prime editor is a highly accurate and versatile editor derived from the CRISPR / Cas9 system. The pegRNA contains a spacer sequence to guide the PE protein to the genomic target site, and an extension sequence at the 3' end. From 5' to 3', the extension sequence consists of an RTT containing the intended editing sequence and a PBS sequence complementary to the target site. In the cell, the PE protein-pegRNA complex binds to a specific site on the DNA via the pegRNA's spacer sequence. The double-stranded DNA is stretched to form an R-loop, where the non-target strand is cleaved by the PE, creating a nick. The nick releases a 3' end, which pairs with the PBS and RTT. Subsequently, using the RTT as a template, reverse transcriptase produces a 3' flap containing the intended editing sequence. The 3'flap invades the genome using a single-stranded sequence homologous to the downstream genomic sequence. During this process, the 5'flap generated from the nick competes with the 3'flap. Although the 5'flap, with its more homologous sequences, is more likely to hybridize with the unedited strand, it is more easily cleaved by the endonuclease FEN1 and the exonuclease EXO1. Successfully invaded 3'flaps are then ligated by ligases to generate heteroduplex DNA containing the intended edit. Finally, during DNA replication or repair, the heteroduplex is eliminated, resulting in double-stranded DNA with the intended edit or reverting to the wild-type DNA sequence. Primeeditor can perform all types of DNA alterations in mammalian cell genomes, including base switching, transversion, insertion, and deletion, without causing DNA double-strand breaks.

[0003] In PE (Programming Edge), pegRNA is responsible for binding to the PE complex and targeting it to the target site. Furthermore, the RTT sequence of pegRNA carries the intended editing information. Whether pegRNA is expressed normally, the amount expressed, and whether it can exist stably in the correct form all affect PE efficiency. Due to its unique sequence composition, pegRNA can form incorrect secondary structures, and its exposed terminal sequences are easily degraded, leading to reduced pegRNA activity and thus affecting editing efficiency.

[0004] When editing certain specific sites, pegRNAs, due to the unique nature of their spacer sequences, can form incorrect secondary structures, leading to low editing efficiency. Furthermore, the 3' extension portion of pegRNA plays a crucial role in the PE system, serving as a template for PE editing and initiating reverse transcription. However, in the complex formed with RT proteins, pegRNAs may be exposed to an environment containing ribonuclease, resulting in the degradation of the 3' extension. Degraded pegRNAs cannot produce correct reverse transcription results. The RNP complex formed between degraded pegRNAs containing the 3' extension and RT proteins competes with the normal RNP complex for binding to target DNA, further reducing PE efficiency. Summary of the Invention

[0005] The purpose of this invention is to improve gene editing efficiency and provide a gene editing tool.

[0006] This invention provides a recombinant pegRNA that improves gene editing efficiency, using the pegRNA sequence as the starting sequence and replacing the 53rd to 56th bases with a locking sequence.

[0007] Further specifying, the recombinant pegRNA also includes a quadrupole sequence inserted at the 3' end.

[0008] Further specifying, the tetrahedra sequence is as shown in SEQ ID NO.2.

[0009] Further specifying, the structure of the pegRNA also includes, from 5' to 3', a spacer sequence, a scaffold sequence, a transcription template containing the intended editing sequence, and a PBS sequence that binds complementary to the target site; the lock-like structure sequence is shown in SEQ ID NO.1.

[0010] Further specifying, the stent sequence is as shown in SEQ ID NO.7.

[0011] This invention provides an application of the above-mentioned recombinant pegRNA in improving gene editing efficiency.

[0012] This invention provides an application of the above-mentioned recombinant pegRNA vector or recombinant microbial cell in improving gene editing efficiency.

[0013] Further specifying, the gene is HEK3, DNMT1, FANCF (Alzheimer's disease-related gene APP), or SLC30A8 (diabetes-related gene); the gene editing refers to base substitution, base deletion, or base insertion.

[0014] This invention provides a kit for improving gene editing efficiency, the kit comprising the above-mentioned histotype pegRNA.

[0015] Furthermore, the kit also includes nCas9-RT protein and ngRNA.

[0016] To further define the method for constructing the nCas9-RT protein: using the pCMV-PE2 plasmid as the base vector, digesting it with EcoRI, then ligating the sequence P2A-EGFP-P2A-PURO with restriction sites at both ends into the vector to obtain an intermediate vector, then digesting the intermediate vector with PciRI, and constructing the left and right homologous arms containing the restriction sites in the middle into the vector to obtain the final AAVS1-KI vector.

[0017] Beneficial effects: Adding a locking sequence (GGACTTCGGTCC, SEQ ID NO.1) to pegRNA provides a nucleation site for the formation of pegRNA secondary structures, which helps in the correct formation of pegRNA secondary structures. Adding a four-stranded helix sequence (TTCCTCTGCATCTCGTGCTCAGTCTGGGGGTGGCCTGGGAGGG, SEQ ID NO.2) to the 3' end of pegRNA protects the pegRNA terminus from degradation by intracellular enzymes.

[0018] PegRNAs are less efficient in their function due to two factors. First, during intracellular function, pegRNAs undergo terminal degradation, reducing the amount of functional pegRNAs and thus lowering efficiency. Second, when editing certain specific sites, pegRNAs are prone to forming incorrect secondary structures. These incorrect secondary structures prevent pegRNAs from forming complexes with nCas9, further reducing efficiency at these sites. To address these two deficiencies, two modifications were made to pegRNAs: (1) GC base pairs were added to the second stem-loop structure of pegRNAs to increase the GC content. There are three hydrogen bonds between GCs and two hydrogen bonds between ATs. Increasing the GC content provides stable sites for the correct folding and formation of stable secondary structures, reducing the formation of incorrect secondary structures; (2) A four-stranded helix sequence of RNA was added to the ends to reduce the terminal degradation of pegRNAs by RNases in vivo, prolonging the survival time of pegRNAs in vivo and improving gene editing efficiency.

[0019] To verify the gene editing capability of the optimized pegRNA in the PE system, three types of gene sites were selected for testing. Five sites frequently used for gene editing efficiency testing are: (1) HEK3, DNMT1, and FANCF, and three types of editing were designed at these three sites: single base substitution, 24bp insertion, and 15bp deletion; (2) GPSM2, where pegRNA targeting this site will form different degrees of mismatch due to the special nature of the spacer sequence, thus forming incorrect secondary structures; and (3) APP and SLC30A8, two disease treatment-related sites. The editing results show that the improved pegRNA can improve the PE editing efficiency. Attached Figure Description

[0020] Figure 1 Schematic diagram of pegRNA; A: Schematic diagram of optimized pegRNA sequence; B: Schematic diagram of 4 pegRNA structures NC-pegRNA: Unchanged pegRNA; L-pegRNA: PegRNA backbone with added high GC content structure in the first stem-loop structure; G-pegRNA: PegRNA with added quadrature helicoid sequence at the end; LG-pegRNA: PegRNA with added high GC content structure in the first stem-loop structure and added quadrature helicoid sequence at the end;

[0021] Figure 2 Comparison of free energies for pegRNAs with different secondary structures;

[0022] Figure 3 A schematic diagram of the optimized pegRNA stability detection process in nuclear lysates;

[0023] Figure 4 The results show the stability of optimized pegRNA in nuclear lysates; A: Electrophoresis diagrams of the stability of optimized and unoptimized pegRNA; B: Corresponding to A Figure 4 Gray-scale analysis of electrophoretic bands of pegRNAs;

[0024] Figure 5 Schematic diagram of gene knock-in targeting the AAVS1 site;

[0025] Figure 6 The following are the structure and identification results of the AAVS1-KI vector; A: AAVS1-KI vector map; B: Electrophoresis image of the AAVS1-KI vector and its digested products, M is the marker; lane 1 is the electrophoresis image of the AAVS1-KI vector alone, with a length of 12832bp; lane 2 is the product of AAVS1-KI vector digested with HindIII and MluI, with lengths of 2866bp and 9966bp, respectively; C: Sequencing results of the AAVS1-KI vector.

[0026] Figure 7 Flowchart for constructing a stable HEK293T cell line expressing Prime editor protein;

[0027] Figure 8 Results for cell line construction; A: Electrophoresis image after AAVS1-KI vector digestion and purification; B: HEK293T cells expressing Prime editor protein under a fluorescence microscope;

[0028] Figure 9 This is a diagram showing the DNA level identification results; M is the marker; lane1 shows the 5' end identification results, 1110bp in length; lane2 shows the intermediate identification results, 999bp in length.

[0029] Figure 10 Figure 1 shows the results of protein level identification; A: Western blot detection of nCas9-RT protein expression, with β-ACTIN as the internal reference protein; B: Gray-scale analysis of protein bands, with the vertical axis representing the ratio of nCas9-RT protein to β-ACTIN protein, and 11 and 14 compared with WT respectively;

[0030] Figure 11 This diagram illustrates the three editing types at the HEK3 site. Note: Yellow lines indicate pegRNA target sites, red indicates single-base substitutions, green indicates 24bp insertions, and magenta indicates 15bp deletions. The nCas9 cut is marked as +1, and the downstream direction is marked as +2, etc.

[0031] Figure 12 A schematic diagram of the optimized pegRNA-driven PE3 architecture;

[0032] Figure 13 The following are the results of ngRNA expression plasmid construction and sequencing identification: A: ngRNA plasmid construction process; B: Electrophoresis detection of the constructed ngRNA expression plasmid; M is the marker, and lanes 1 to 6 are electrophoresis images of the ngRNA expression plasmids corresponding to APP, SLC30A8, HEK3, DNMT1, FANCF, and GPSM2, respectively, with a length of 2279bp; C: Sequencing verification results of the ngRNA expression plasmid.

[0033] Figure 14 Flowchart for editing using optimized pegRNA;

[0034] Figure 15 Electrophoresis image of bands from deep sequencing samples;

[0035] Figure 16The effect of optimized pegRNA on single-base editing efficiency; AC: NC, L, G, LG refer to NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA, respectively. In each bar chart, the L, G, and LG groups are compared with the NC group. Only groups with significant differences are marked in the chart, and those not marked are those with no significant differences.

[0036] Figure 17 The effect of optimized pegRNA on insertion editing efficiency; AC: NC, L, G, LG refer to NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA, respectively. In each bar chart, the L, G, and LG groups are compared with the NC group. Only groups with significant differences are marked in the figure, and those not marked are those with no significant differences.

[0037] Figure 18 The effect of optimized pegRNA on deletion editing efficiency; AC: NC, L, G, LG refer to NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA, respectively. In each bar chart, the L, G, and LG groups are compared with the NC group. Only groups with significant differences are marked in the chart. Groups without markings have no significant differences.

[0038] Figure 19 Prediction of secondary structure of pegRNA targeting the GPSM2 site; A: Schematic diagram of mismatched pegRNA structure at the GPSM2 site; B: Prediction diagram of secondary structure of four types of pegRNA at the GPSM2 site.

[0039] Figure 20 Editing efficiency at GPSM2 site; Note: NC, L, G, LG refer to NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA, respectively. In each bar chart, the L, G, and LG groups are compared with the NC group. Only groups with significant differences are marked in the chart; those not marked are those with no significant differences.

[0040] Figure 21 Schematic diagram of base modifications at the APP and SLC30A8 sites;

[0041] Figure 22 Editing efficiency of pegRNA optimized for deep sequencing detection at APP and SLC30A8 sites; Note: The parts marked in red boxes represent the expected editing.

[0042] Figure 23To optimize the editing efficiency of pegRNA at APP and SLC30A8 sites; AB: NC, L, G, LG refer to NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA, respectively. In each bar chart, the L, G, and LG groups are compared with the NC group. Only groups with significant differences are marked in the chart, and those not marked are those with no significant differences. Detailed Implementation

[0043] The pCMV-PE2 plasmid was provided by Fenghui Biotechnology Co., Ltd., ZT281.

[0044] The BPK1520 plasmid was purchased from Addgene:BPK1520.

[0045] 5' modifications to CRISPR-Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage. Literature records stem-loop structures, kink structures, and hairpin structures.

[0046] Example 1. Method for constructing pegRNA

[0047] Structure as Figure 1 As shown, Figure 1 A in the text represents LG-pegRNA;

[0048] NC-pegRNA without any changes, SEQ ID NO.3: NNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNN;

[0049] L-pegRNA containing only a high GC content structure, SEQ ID NO.4: NNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGGACTTCGGTCCAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN; the modified GC content is 66.6%.

[0050] G-pegRNA containing only four-stranded spirochetal structure, SEQ ID NO.5: NNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNTTCCT CTGCCATCTCGTGCTCAGTCTGGGGGTGGGCCTGGGAGGG;

[0051] LG-pegRNA containing a high GC content and a four-stranded helix structure SEQ ID NO.6:NNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGGACTTCGGTCCAAGTGGCACCGAGTCGGTGCNNNNNNNNNNNNNNNNNNNNNNNN NNNTTCCTCTGCCATCTCGTGCTCAGTCTGGGGGTGGGCCTGGGAGGG.

[0052] Stent sequence, SEQ ID NO.7: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGC.

[0053] Example 2. Optimized pegRNA secondary structure prediction

[0054] The free energy of different pegRNAs at all sites in Example 1 was statistically analyzed. The free energies of the four pegRNAs were listed and presented in a violin diagram. The results showed that compared with the unmodified NC-pegRNA, the L-pegRNA with the addition of a high GC content structure had a significantly lower free energy. The G-pegRNA with the addition of a quadruplex helical sequence also showed a decrease in free energy, but not as significantly as the L-pegRNA. The LG-pegRNA with both sequences added showed the most significant decrease in free energy. Figure 2 This indicates that these two modifications make the structure of pegRNA more stable, thereby affecting gene editing efficiency.

[0055] Example 3. Investigation of the stability of optimized pegRNA in nuclear lysates

[0056] I. Stability Testing

[0057] 1. Extraction of nuclear proteins

[0058] (1) Transfer the cultured HEK293T cells to a centrifuge tube, centrifuge at 3000 rpm for 10 min at 4℃, discard the culture medium, add 10 mL of pre-cooled 1×PBS, centrifuge at 3000 rpm for 5 min at 4℃, and repeat the washing twice.

[0059] (2) Add 5 μL of phosphatase inhibitor, 10 μL of PMSF and 1 μL of DTT to each 1 mL of pre-chilled Hypotonic Buffer, mix well, and let stand on ice until ready to use. Add 5 μL of phosphatase inhibitor, 10 μL of PMSF and 1 μL of DTT to each 1 mL of pre-chilled Lysis Buffer, and let stand on ice until ready to use.

[0060] (3) According to each 1×10 7 Add the prepared Hypotonic Buffer to the centrifuge tube at a ratio of 0.6 mL to 0.9 mL per cell.

[0061] (4) Tap the centrifuge tube wall with your finger to suspend the precipitate, place it in an ice bath for 10 minutes, and shake for 10 seconds to mix.

[0062] (5) Centrifuge the suspension at 3000 rpm for 5 min at 4℃, discard the supernatant immediately, add 0.4 mL of pre-cooled Hypotonic Buffer and shake to wash the precipitate for 30 s, then centrifuge at 5000 rpm for 5 min at 4℃, discard the supernatant and retain the precipitate.

[0063] (6) Add 0.2 mL of prepared Lysis Buffer to the precipitate, shake to suspend the precipitate, incubate on ice for 20 min, centrifuge at 15000 rpm for 10 min at 4℃, discard the precipitate, and aliquot the supernatant and store at -80℃.

[0064] 2. Prepare the system according to the components and concentrations in Table 1 below, and add 0.5 μg of pegRNA to the system.

[0065] Table 1 PCR reaction system

[0066]

[0067] (2) After incubating the above system at 37°C for 20 min, add an equal volume of RNA Buffer and perform electrophoresis on a 2% agarose gel. Use ImageJ for grayscale analysis.

[0068] Results: To better simulate the intracellular function of pegRNA, this study used an in vitro co-incubation method with pegRNA and nuclear lysate to verify the stability of pegRNA. Figure 3 Nuclear lysate (nuclear extract) was obtained, and a mixed solution containing 3 μL nuclear extract, 1 μL Tris-HCl, 1 μL MgCl2, 1 μL NaCl, 1 μL DTT, 1 μL NTP, and 1 μL LRNase inhibitor was prepared. 0.5 μg of NC-pegRNA, L-pegRNA, G-pegRNA, and LG-pegRNA were added to the mixed solution (HEK3 site as an example), and the mixture was incubated at 37°C for 20 min. The reaction was terminated by adding RNA buffer, and electrophoresis was performed on a 2% agarose gel. The agarose gel was imaged using an imager, and the brightness of the bands was analyzed using ImageJ.

[0069] Taking the pegRNA at the HEK3 site as an example, the incubation experiment was conducted, and the sequence is shown in Table 10. The results showed that the modified L-pegRNA, G-pegRNA, and LG-pegRNA had stronger stability in nuclear lysates. Figure 4 ).

[0070] Example 3. Optimized pegRNA-driven gene editing

[0071] The construction of a stable HEK293T cell line expressing PE protein typically involves simultaneously transfecting PE protein expression plasmids and pegRNA expression plasmids into cells using a standard Prime editor for gene editing, followed by expression and the formation of the RNP complex. This study aimed to insert a gene expressing PE protein into the AAVS1 safe site in HEK293T cells, thereby enabling stable intracellular expression of the PE protein.

[0072] I. Site Knock-in Vector Construction Strategy

[0073] 1. Construction of AAVS1 knock-in plasmid

[0074] The required homologous arm sequences and sgRNA sequences were designed for knock-in. The AAVS1 site was proven to be a "safe site" in the genome, capable of accepting the insertion and expression of exogenous fragments without adverse effects. Based on the design principles of sgRNA, the spacer sequence of the sgRNA targeting the AAVS1 site is: AGAGCUAGCACAGACUAGAG. 800 bp fragments were selected on either side of the cleavage site as the homologous arm sequences. Figure 5 ).

[0075] This study used the pCMV-PE2 plasmid (Addgene:pCMV-PE2) as the basic vector. The main functional elements of the pCMV-PE2 plasmid include the CMV promoter, CMV enhancer, Cas9 (H840A) protein, and the reverse transcriptase expressed fused with it. First, the vector was digested with EcoRI, and then the sequence P2A-EGFP-P2A-PURO with restriction sites at both ends was ligated into the vector to obtain the intermediate vector. Then, the intermediate vector was digested with PciRI, and the left and right homologous arms containing the restriction sites in the middle were constructed into the vector to obtain the final AAVS1-KI vector.

[0076] P2A is a self-cleaving peptide that does not play a major role in the experimental objective; EGFP is used for cell screening; PURO is used for drug screening after cell electroporation.

[0077] P2A-EGFP-P2A-PURO,SEQ ID NO.8:

[0078]

[0079] The left and right homologous arms containing restriction enzyme sites are used for vector insertion via homologous recombination; the restriction enzyme sites are used to linearize the plasmid vector.

[0080] The left and right homologous arms containing the restriction enzyme site in the middle are SEQ ID NO.9:

[0081]

[0082] 2. Validation of AAVS1 site knock-in vector

[0083] The constructed AAVS1-KI plasmid ( Figure 6 A) Agarose gel electrophoresis showed that the vector size was correct. Double digestion of the AAVS1-KI plasmid with HindIII and MluI restriction enzymes yielded fragments of 2866 bp and 9966 bp in length, and agarose gel electrophoresis showed the correct bands. Figure 6 (B in the original text). Sanger sequencing of the inserted homologous arm and the added restriction site showed that the constructed partial sequence was correct and no mutations were generated. Figure 6 (C in the middle).

[0084] 3. Gene knock-in targeting the AAVS1 site in HEK293T cells

[0085] 1. Resuscitation of HEK293T cells

[0086] Remove the frozen cells from the -80℃ freezer or liquid nitrogen tank and immediately place them in liquid nitrogen to take them to the experimental site. Then, rapidly shake the cell cryovials in a 37℃ water bath to thaw the frozen cells quickly. Transfer the cells from the cryovials to centrifuge tubes containing culture medium, centrifuge at 1200 rpm for 3 minutes, remove the supernatant and add culture medium to resuspend the cell pellet. Inoculate the resuspended cell suspension into appropriate culture dishes for culture.

[0087] HEK293T cells were cultured and passaged using 15% FBS medium at 37°C and 5% CO2, with the medium changed daily.

[0088] HEK293T cell transfection

[0089] (1) Electroporation of HEK293T cells

[0090] 1) First, aspirate the old culture medium from HEK293T cells and wash them with DPBS.

[0091] 2) Add 0.25% trypsin that has been warmed, digest at 37°C for 1 min, and then add twice the volume of culture medium of trypsin to stop the digestion.

[0092] 3) Gently resuspend the cells using a pipette, then add the cell suspension to a 15 mL centrifuge tube, centrifuge at 1200 rpm for 3 min, carefully discard the supernatant, and then resuspend the cell pellet in fresh culture medium.

[0093] 4) Count the cells.

[0094] 5) Calculate the volume of cell suspension to be added based on the cell concentration; approximately 1 × 10⁻⁶ is required. 6 Each cell.

[0095] 6) Prepare plasmid mixture by adding Opti-MEM to 5 μg DNA (AAVS1-KI vector) to bring the volume up to 20 μL.

[0096] 7) Use plasmid mixtures on 1×10 6 The cell pellet was resuspended and the suspension was transferred to a new electroporation cuvette. The cuvette was placed in the electroporator and electroporated according to the preset HEK293T cell program: 150V, 10ms, 10 times.

[0097] 8) Add 150 μL of Opti-MEM to the electroporated cells and equilibrate for 5 min, then seed them into cell culture plates for culture.

[0098] Identification of HEK293T cell positive clones

[0099] (1) PCR identification

[0100] The collected monoclonal cell samples were identified according to the following system and procedure.

[0101] Table 2 PCR reaction system

[0102]

[0103] Table 3 PCR reaction procedure

[0104]

[0105] To obtain HEK293T cells stably expressing Prime editor protein, the validated AAVS1-KI plasmid was transfected into wild-type HEK293T cells using electroporation according to the following procedure. Figure 7 ).

[0106] The AAVS1-KI plasmid was linearized by digestion with HindIII restriction endonuclease. After linearization, phenol-chloroform extraction was performed to remove impurities such as restriction endonuclease and small DNA fragments. The extracted linear DNA was then subjected to agarose gel electrophoresis to verify the bands. The results showed that the bands after enzyme digestion and extraction were of correct size and clearly defined. Figure 8 (A) Two cell groups were set up: one experimental group transformed with the AAVS1-KI linearized vector, and the other a wild-type control group. The vector was transformed into the cells by electroporation, with the electroporation program being 150V, 10ms, 10 cycles. Cell status and fluorescence were observed daily during cell culture. Figure 8In step B), after electroporation for 72 hours, 1 mg / mL Puro was added for drug screening. During drug screening, the number of cells in the experimental group and the wild-type control group was observed daily. After all wild-type control group cells died, drug addition to the experimental group was stopped, and the cells were returned to normal culture medium. Subsequently, the cells that had completed drug screening were diluted and identified.

[0107] Validation of the results of AAVS1 gene knock-in targeting HEK293T cells (validation of monoclonal cell suspensions obtained by transfecting AAVS1-KI plasmid into HEK293T cells):

[0108] 10 μL of cell suspension containing monoclonal cells was added to 50 μL of cell lysis buffer, and lysis was performed according to the program at 55 °C for 1 h, then at 99 °C for 30 min. Using the lysis buffer as a template, DNA knock-in identification was performed using primers 5'-F, 5'-R; 3'-F, 3'-R; and middle-F, middle-R (p1, 2, 5, 6, 3, 4), as shown in Table 4, to ensure that the vector was inserted into the correct site in the correct manner. As shown in the results, bands of 1110 bp and 999 bp were detected at the 5' end and the middle portion, respectively. Figure 9 ).

[0109] Table 4

[0110]

[0111]

[0112] To further verify whether a correctly inserted vector can produce a functional protein (the test subjects were monoclonal cells obtained by transfecting HEK293T cells with the AAVS1-KI plasmid), Western blot experiments were performed using an antibody against Cas9. For greater reliability, experiments were conducted on monoclonal cell #11, which was correctly identified at the DNA level; monoclonal cell #14, which was incorrectly identified at the DNA level; and wild-type HEK293T cells. The results showed that Cas9 expression was detected only in cells #11. Figure 10 This indicates that the obtained #11 cell was correctly inserted into the AAVS1-KI vector and can be used for subsequent experiments.

[0113] Example 4. Optimized pegRNA editing at selected sites

[0114] Optimized pegRNA editing at different gene sites

[0115] To better validate the gene editing capabilities of optimized pegRNA in the PE system, this study selected three types of gene loci for testing. Firstly, to explore the role of optimized pegRNA in different editing types, this study selected three loci frequently used for gene editing efficiency testing: HEK3, DNMT1, and FANCF. At these three loci, three types of editing were designed: single-base substitution, 24bp insertion, and 15bp deletion. Figure 11 Using the primers in Table 9, slow annealing was used to obtain the ngRNAs of the HEK3, DNMT1, and FANCF genes. The collected samples were amplified and sent to the company for deep sequencing. Sequencing data analysis directly yielded the efficiency. Table 5 shows the four pegRNAs of the HEK3, DNMT1, and FANCF genes.

[0116] Table 5 shows the DNA sequences of the pegRNAs used in this paper.

[0117]

[0118]

[0119]

[0120]

[0121] 1. Construction of ngRNA expression plasmid

[0122] (1) Slow annealing of the spacer (taking HEK3 as an example), with the following system added:

[0123] Table 6 Slow Annealing Reaction System

[0124]

[0125] After mixing, boil the mixture and let it cool to room temperature before use.

[0126] (2) Digest the BPK1520 plasmid with enzymes, as follows:

[0127] Table 7 DNA restriction endonuclease digestion reaction system

[0128]

[0129] The enzyme digestion reaction conditions are selected according to the requirements of the restriction endonuclease. The digestion product is purified and ready for use.

[0130] (3) The annealed spacer was ligated into the enzyme-digested BPK1520 vector, and the system was as follows:

[0131] Table 8. T4 Connection Reaction System

[0132]

[0133] Table 9

[0134]

[0135] Using the PE3 system (ngRNA, one pegRNA, nCas9-RT protein), HEK293T vectors containing nCas9-RT protein were transfected with AAVS1-KI vector to edit different sites. Figure 12 The PE3 system requires an additional sgRNA to cleave the non-target strand, so the ngRNA expression plasmid is constructed first. Figure 13 (A) Two single-stranded oligonucleotides corresponding to the sgRNA spacer region were synthesized. The components were added according to a slow annealing system, and programmed slow annealing was performed using a PCR instrument. The BPK1520 plasmid containing the sgRNA backbone sequence was digested with the restriction enzyme BbsI to generate a vector with sticky ends. Then, the fragment obtained from slow annealing was ligated to the digested vector using T4 DNA ligase. After transformation, bacterial culture, sequencing, and plasmid extraction, a plasmid expressing ngRNA was obtained. Electrophoresis and sequencing results showed that the vector was correct. Figure 13 (B and C in the middle).

[0136] Using a synthesized DNA sequence containing the T7 promoter as a template, pegRNA (the DNA sequence of pegRNA in Table 9) was obtained through in vitro transcription. Using the obtained ngRNA expression plasmid as a template, PCR amplification was performed using primers containing the T7 promoter sequence to obtain a linear DNA fragment containing the T7 promoter sequence (the downstream primer is T7-R, and the upstream primers for different genes are the primers in Table 10; the resulting linear DNA fragment containing the T7 promoter sequence and sgRNA sequence is Sequence 1). Using Sequence 1 as a template, ngRNA was obtained through in vitro transcription. Then, using the constructed HEK293T cell (HEK293T transfected with the AAVS1-KI vector) that stably expresses PE protein as the experimental subject, pegRNA and ngRNA targeting different genes and performing different gene editing types were transfected into cells via liposome transfection (simultaneous transfection, peg 20 ng, ng 10 ng). Because liposomes are cytotoxic, the medium was changed within 24 hours of transfection, and the cells were cultured for another 72 hours. Cells transfected with pegRNA were then collected, and gene editing efficiency was detected by deep sequencing and analyzed using CRISPResso2 software. Figure 14 ).

[0137] The T7 promoter sequence is TAATACGACTCACTATAGGG.

[0138] Table 10

[0139] DNMT1-ngRNA-F TAATACGACTCACTATAGGGCCCTTCAGCTAAAATAAAGG, SEQ ID NO.76 FANCF-ngRNA-F TAATACGACTCACTATAGGGGGGTCCCAGGTGCTGACGT, SEQ ID NO.77 SLC30A8-ngRNA-F TAATACGACTCACTATAGGGACATTTGGATGGCACTGAGC, SEQ ID NO.78 APP-ngRNA-F TAATACGACTCACTATAGGCTTCATATCCTGAGTCATGT, SEQ ID NO.79 GPSM2-ngRNA-F TAATACGACTCACTATAGGAACATAAGGTTTCTCAAAGA, SEQ ID NO.80 T7-R GCACCGACTCGGTGCCACTT, SEQ ID NO.81

[0140] HEK293T cell transfection

[0141] 1) Seed cells into 48-well plates one day in advance, and prepare for transfection when the cells reach about 60% confluence.

[0142] 2) Dilute Lipofectamine 3000 reagent and pegRNA using Opti-MEM medium.

[0143] 3) Add Opti-MEM to the diluted pegRNA and ngRNA to bring the volume to 50 μL.

[0144] 4) Mix the diluted Lipofectamine 3000 reagent with the diluted pegRNA and ngRNA, and incubate at room temperature for 15 minutes. Pay attention to the incubation time and do not exceed the time limit.

[0145] 5) Add the liposomes and RNA complex to the cells that have been replaced with fresh culture medium, making sure to add them in a clockwise direction while keeping them suspended in the air.

[0146] 6) Place in a 37℃ incubator for incubation.

[0147] Isolation of HEK293T cell positive clones

[0148] Single clones were selected using the limiting dilution method, and the specific steps are as follows:

[0149] (1) Digest the cells after drug screening, add the cell suspension to a 15mL EP tube, centrifuge at 800rpm for 2min, and then resuspend the cells in 1mL DMEM medium.

[0150] (2) Take 20 μL of cell suspension for counting.

[0151] (3) Based on the measured number of cells, dilute the cell suspension to contain 200 cells per milliliter.

[0152] (4) Take 1 mL of the diluted cell suspension and add 19 mL of DMEM medium.

[0153] (5) Add 20 mL of the prepared culture medium suspension to each well of a 96-well plate at a rate of 200 μL, and incubate in an incubator.

[0154] (6) After 4 days of cell culture, observe the cell growth under a microscope and change the medium in the wells containing cells. Continue culturing for 7 days, observe under a microscope whether the cells are monoclonal cells. If they are monoclonal cells, mark them for continued culturing and discard the culture medium in the remaining wells.

[0155] (7) Continue culturing the cells until they clump together, digest the cells in the wells and seed them into 24-well plates, and continue culturing until the samples are ready for collection.

[0156] 2. Preparation of deep sequencing samples

[0157] Gene site selection strategy for amplification of DNA fragments at editing sites

[0158] (1) PCR amplification of DNA fragments at editing sites

[0159] The PCR reaction system is as follows:

[0160] Table 11 PCR reaction system

[0161]

[0162] The PCR reaction procedure is as follows:

[0163] Table 12 PCR reaction procedure

[0164]

[0165] Cell samples were uniformly lysed using lysis buffer according to the program of 55℃ for 1 h, 99℃ for 30 min to obtain cellular genomic DNA. Using the genomic DNA as a template, site-specific primers were used to amplify the target sites (primer sequences in Table 13) to obtain a single target band. Figure 15 The target product is sent to the company for deep sequencing to detect the gene editing status at the target site.

[0166] Table 13

[0167]

[0168] Secondly, in order to explore the function of optimized pegRNA in resisting misfolding, this study selected a "bad" site: GPSM2. PegRNA targeting this site will form different degrees of mismatch due to the special nature of the spacer sequence, thus forming incorrect secondary structures.

[0169] Finally, to test the practical application effect of the optimized pegRNA, this study selected two disease treatment-related sites: APP and SLC30A8, and tested the resulting editing efficiency.

[0170] 3. Detection and analysis of editing results

[0171] Next-generation sequencing analysis of editing efficiency: The prepared short DNA fragments (150-300bp) were sent to Hangzhou Kaitai Biotechnology Co., Ltd. for library construction and sequencing. The raw sequencing data were quality controlled and screened using FASTP (0.23.4) software. The data were processed using preset parameters without additional restrictions on the parameters.

[0172] Sequencing data analysis was performed using CRISPResso2 (version 2.1.3). CRISPResso2 was run on a Linux system, using both PE and HDR modes. In PE mode, the following basic commands were entered: -r1, -r2, --prime_editing_pegRNA_spacer_seq, --prime_editing_pegRNA_extension_seq, --prime_editing_nicking_guide_seq, --amplicon_seq, --prime_editing_pegRNA_scaffold_seq. In HDR mode, the following basic commands were entered: -r1, -r2, -a, -g, -e. Additionally, the following commands were entered to restrict other parameters: -w, --min_frequency_alleles_around_cut_to_plot, --write_cleaned_report, --place_report_in_output_folder, -n.

[0173] (1) Optimized pegRNA-driven single-base editing

[0174] In single-base substitution editing at the HEK3, DNMT1, and FANCF sites, L-pegRNA improved the efficiency of single-base editing at these sites; G-pegRNA improved the efficiency of protein base editing at these sites; and LG-pegRNA improved the efficiency of single-base editing at all three sites. Figure 16 ).

[0175] (2) Optimized pegRNA-driven insertion editing

[0176] In the insertion editing at the HEK3, DNMT1, and FANCF sites, compared with the control group, L-pegRNA improved the gene insertion editing efficiency at the HEK3, DNMT1, and FANCF sites; G-pegRNA improved the gene insertion editing efficiency at the HEK3, DNMT1, and FANCF sites; and LG-pegRNA improved the gene insertion editing efficiency at all three sites. Figure 17 ).

[0177] (3) Optimized pegRNA-driven deletion editing

[0178] In deletion editing at the HEK3, DNMT1, and FANCF sites, L-pegRNA improved gene editing efficiency at HEK3 and DNMT1 sites; G-pegRNA improved gene editing efficiency at HEK3 and DNMT1 sites; and LG-pegRNA significantly improved gene editing efficiency at HEK3 site. Figure 18 ).

[0179] (4) Optimized pegRNA editing at bad sites

[0180] This study selected the GPSM2 site to investigate the editing efficiency of optimized pegRNA at a specific site.

[0181] Because pegRNA contains a PBS sequence complementary to the non-target strand, it typically forms an incorrect structure with a spacer and 3' extension. Therefore, we designed an insertion of three GAA bases at the GPSM2+2 position, which will cause the pegRNA to form perfect complementarity. As shown in the pegRNA secondary structure prediction results, the mismatched complementary portion is highlighted in red. Figure 19 ).

[0182] The results showed that at the GPSM2 site, L-pegRNA, G-pegRNA, and LG-pegRNA all improved gene editing efficiency compared to the control group. Figure 20 ).

[0183] (5) Optimized pegRNA editing at disease treatment-related sites

[0184] Point mutations related to disease treatment have been designed in Alzheimer's disease-related genes APP and diabetes-related genes SLC30A8. The specific base changes are shown in the figure below. Figure 21 Each gene locus was transfected using four different pegRNAs, and the editing efficiency was assessed.

[0185] The results showed that the expected editing was achieved at both sites. Figure 22 Compared with the control group, L-pegRNA improved gene editing efficiency at two sites; G-pegRNA significantly improved gene editing efficiency at both sites; LG-pegRNA significantly improved gene editing efficiency at the APP and SLC30A8 sites. Figure 23 ).

Claims

1. The application of a recombinant pegRNA in the preparation of a kit to improve gene editing efficiency, characterized in that, The application is for non-diagnostic and non-therapeutic purposes; the sequence of the recombinant pegRNA is shown in SEQ ID NO.

6.

2. The application of a vector containing recombinant pegRNA or recombinant microbial cells in the preparation of a kit to improve gene editing efficiency, characterized in that, The application is for non-diagnostic and non-therapeutic purposes; the sequence of the recombinant pegRNA is shown in SEQ ID NO.

6.

3. The application according to claim 1 or 2, characterized in that, The structure of the pegRNA also includes, from 5' to 3', a spacer sequence, a scaffold sequence, a transcription template containing the intended editing sequence, and a PBS sequence that binds complementary to the target site.

4. The application according to claim 3, characterized in that, The stent sequence is shown in SEQ ID NO.

7.

5. The application according to claim 1 or 2, characterized in that, The genes mentioned are HEK3, DNMT1, FANCF (Alzheimer's disease-related gene APP), or SLC30A8 (diabetes-related gene); the gene editing refers to base substitution, base deletion, or base insertion.

Citation Information

Patent Citations

  • Pair of auxiliary guide RNA / guide RNA for editing human PCSK9 nucleic acid sequence

    CN116656676A