A SNP site for identifying a tomato early yellowing trait, a KASP molecular marker primer group and application thereof

Abstract

The application provides a SNP site for identifying a tomato early-aging and yellowing trait, a KASP molecular marker primer group and application thereof. The SNP site is located on the 11th chromosome of a tomato. The polymorphic site of the SNP is located at the 3675th base of a magnesium ion transporter gene SlT11G017380 of the tomato, and the polymorphism is G / C. When the base is G, the tomato is an early-aging mutant. When the base is C, the tomato is a normal green wild type. The method can identify whether the tomato is of the early-aging and yellowing trait. The identification of the sample can be completed through DNA extraction, specific amplification of PCR and KASP genotyping detection. The marker has high specificity and stability. The screening method of the marker is simple, fast and convenient, and is beneficial to the breeding of the tomato.

Description

Technical Field

[0001] This application relates to the fields of genetic engineering and molecular biology, specifically to an SNP site for identifying premature yellowing traits in tomatoes, a KASP molecular marker primer set, and their applications. Background Technology

[0002] Tomatoes are rich in nutrients and have a unique flavor. They can be eaten raw, cooked, processed into tomato sauce, juice, or canned whole. They are one of the most widely cultivated fruits and vegetables in the world. Tomato leaves, as vital organs for photosynthesis and autotrophy, are the site of synthesis of essential substances such as sugars, lipids, and amino acids. Premature leaf senescence is a common phenomenon in tomato production. While leaf senescence is a necessary process for plant growth and development, premature leaf senescence directly or indirectly affects the synthesis and degradation of chlorophyll, thus impacting the leaves' photosynthetic capacity and severely affecting tomato yield and quality, even leading to premature death.

[0003] Many factors influence leaf senescence. Among them, magnesium (Mg), as an essential cation, plays a crucial role in plant growth and development. Magnesium deficiency can lead to leaf yellowing, affecting plant growth and development. Magnesium transporters (MGTs) promote the absorption, transport, and distribution of magnesium within plants. The sequence structure and function of MGTs are of great significance for studying leaf senescence. MGTs are classified into three subfamilies: CorA, MRS2-like, and NIPA. Although the CorA subfamily has been extensively studied, information on the functions of MGTs in the MRS2 and NIPA subfamilies is limited. Recent studies have shown that MGTs are induced by upstream signals related to plant hormones and stress to control magnesium concentrations in different organs. However, the underlying regulatory mechanisms of leaf senescence remain not fully elucidated to date.

[0004] Currently, the identification of premature yellowing traits in tomatoes relies on field testing. This involves manually selecting and removing prematurely yellowing plants or materials identified during variety breeding to ensure the quality of the selected plants. However, this method requires waiting until the tomatoes reach maturity, is time-consuming, and inefficient. Premature yellowing is also prone to occur in poor soil or under adverse conditions such as low light, making it easily influenced by environmental factors and leading to misjudgments. Furthermore, marker-based screening methods are complex, slow, costly, and cannot be used for large-scale marker-based identification. Summary of the Invention

[0005] In view of this, the present invention provides an SNP site for identifying the premature yellowing trait of tomatoes, a KASP molecular marker primer set and its application, which solves the technical problems of the existing technology that the identification of premature yellowing trait of tomatoes is carried out by field identification, which is complicated, slow, costly and cannot be carried out in large-scale marker identification.

[0006] According to a first aspect of the present invention, the present invention provides the application of SNP sites in identifying premature yellowing traits in tomatoes, wherein the SNP site is located on tomato chromosome 11, and the polymorphic site of the SNP is located at 3675 bp of the magnesium ion transporter gene SlT11G017380 in tomatoes, and the polymorphism is G / C. When the base is G, the tomato is a premature yellowing mutant; when the base is C, the tomato is a normal green wild type, wherein the nucleotide sequence of the magnesium ion transporter gene SlT11G017380 is shown in SEQ ID No: 1.

[0007] Furthermore, the types of the SNP sites include type A, type B, and type H.

[0008] According to a second aspect of the present invention, the present invention provides a primer set for identifying KASP markers of the above-mentioned SNP sites, comprising a forward primer 1 with the sequence shown in SEQ ID NO: 2, a forward primer 2 with the sequence shown in SEQ ID NO: 3, and a reverse primer with the sequence shown in SEQ ID NO: 4.

[0009] According to a third aspect of the present invention, the present invention provides a kit for detecting the above-mentioned SNP sites, comprising the above-mentioned KASP-labeled primer set, wherein the volume ratio of the primer set is 2:2:5.

[0010] According to a fourth aspect of the present invention, the present invention provides a method for identifying the premature aging mutant trait in tomatoes, comprising using the primer set labeled with KASP to amplify the NIPA gene sequence of tomato premature aging using the tomato genomic DNA to be tested as a template to obtain an amplified product; cloning and sequencing the amplified product and comparing it with the tomato genome in the National Genome Science Data Center to obtain the SNP site;

[0011] The premature yellowing trait in tomatoes can be determined based on the type of SNP loci. When the KASP gene typing result is type A, the tomato is identified as a line containing the premature yellowing mutant gene. When the KASP gene typing result is type B, the tomato is identified as a line containing the wild-type gene.

[0012] Furthermore, the mutant MT318 and wild-type WT were selected as parents for hybridization to obtain F1 generation. F1 generation was self-crossed to obtain F2 generation. Parental mixed pool and extreme phenotype pool were constructed in F2 generation. DNA was extracted from the constructed extreme phenotype pool and parental mixed pool and BSA sequencing was performed. The gene NIPA that regulates premature yellowing of tomatoes was screened using BSA technology.

[0013] Furthermore, the construction of the extreme phenotype pool includes: selecting equal amounts of leaves from 30 wild-type plants with extreme green color and 30 mutant plants with extreme yellow color and premature aging in the obtained F2 generation to construct the extreme phenotype pool.

[0014] Furthermore, the construction of the parental mixed pool includes: selecting equal amounts of leaves from 30 wild-type aomei-318 plants and 30 mutant parent plants MT318 to construct the parental mixed pool.

[0015] Furthermore, the reaction system used for the PCR amplification was: 5 μL of 2×KASP Mastermix, 1.4 μL of KASP Assay Mix, 1 μL of tomato genomic DNA at a concentration of 100 ng / μL, and 2.6 μL of Dnase / RNase-free deionized water;

[0016] PCR amplification program: (1) 95℃ pre-denaturation for 15 min; (2) 95℃ denaturation for 20 s, 61℃ annealing extension for 60 s, 10 cycles, each annealing extension temperature decreased by 0.6℃; (3) 95℃ denaturation for 20 s, 55℃ annealing extension for 40 s, 35 cycles; (4) 25℃ for 60 s.

[0017] The SNP site provided by this invention is located on chromosome 11 of tomato. The polymorphic site of the SNP is located at 3675 bp of the tomato magnesium ion transporter gene SlT11G017380, and the polymorphism is G / C. When the base is G, the tomato is a premature aging mutant; when the base is C, the tomato is a normal green wild type. This method does not require planting seeds in the field and identifying them after they mature; it can be completed in the laboratory, saving time and the cost of using experimental fields. Sample identification can be completed simply through DNA extraction, PCR-specific amplification, and KASP genotyping. The marker has high specificity and stability, and the marker screening method is simple and quick to operate. The marker detection accuracy is high, suitable for large-scale, high-throughput, and automated processes, accelerating the breeding process and providing technical support for molecular breeding of tomatoes. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 The image shown is a comparison of the MT318 natural mutant strain and the wild-type WT seedling stage provided in an embodiment of this application;

[0020] Figure 2 The image shown is a comparison of the first cluster of flowers of the MT318 natural mutant strain and the wild-type WT strain provided in an embodiment of this application.

[0021] Figure 3 The image shown is a comparison of the MT318 natural mutant strain and the wild-type WT strain 40-60 days after colonization, according to an embodiment of this application.

[0022] Figure 4 The image shown is a Manhattan diagram of the tomato premature aging gene provided in an embodiment of this application;

[0023] Figure 5 The diagram shown is a schematic diagram of the genotyping results of wild-type WT, mutant MT318 and F2 generation lines using primers according to an embodiment of this application;

[0024] Figure 6 The diagram shown is a sequencing schematic of wild-type WT, mutant MT318, and F2 generation provided in an embodiment of this application;

[0025] Figure 7 The diagram shown is a schematic diagram of the detection results of premature aging traits and KASP markers provided in an embodiment of this application. Detailed Implementation

[0026] To facilitate understanding of the present invention, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] 1. Material selection

[0028] The tomato leaf color mutant material MT318 is derived from a mutant offspring of the strain aomei-318. It is a spontaneous yellow mutant, and after multiple self-pollination and selection processes, its mutant traits and various agronomic traits have been stabilized. When the first cluster of flowers opens, the lower leaves of the mutant begin to yellow, and compared with the wild-type WT, the plant is significantly shorter and thinner.

[0029] 2. Phenotypic traits and genetic analysis:

[0030] In 2018, a mutant strain MT318, resulting from a natural leaf color mutation, was found among the progeny of the tomato high-generation inbred line aomei-318. aomei-318 is the female parent of the commercial variety "Aomei." The mutant strain MT318 is a spontaneous yellow mutant. Through multiple self-pollination and selection processes, its mutant traits and various agronomic traits have stabilized. Figure 1 As shown, the mutant MT318 looks the same as the wild-type WT in the seedling stage.

[0031] Figure 2The image shown is a comparison of the MT318 mutant strain provided in an embodiment of this application and the wild-type WT strain when the first cluster of flowers opens. Figure 3 The image shown is a comparison of the MT318 natural mutant strain and the wild-type WT strain 40-60 days after transplanting, according to an embodiment of this application; Figure 2 as well as Figure 3 As shown in Table 2, approximately 40 days after transplanting, when the first cluster of flowers opened, the leaves of the mutant MT318 underwent accelerated senescence, with the lower leaves beginning to yellow. Plant growth was slow, and compared to the wild-type WT, the plant was significantly shorter and thinner. The tip of the first leaf below the flower showed yellowing. At 55 days after transplanting, the leaves of the mutant MT318 underwent accelerated senescence, with noticeable senescence; half of the first leaf below the flower showed yellowing. At 60 days after transplanting, the first leaf below the flower of the naturally occurring mutant MT318 was completely yellow, while the leaves of the control group wild-type WT did not show yellowing. During the mature stage, the plant height, plant diameter, and fruit size of the mutant MT318 differed significantly from the wild type (Table 2).

[0032] Table 1. Agronomic traits of mutant MT318 and wild-type WT

[0033] WT 2018 160.87±0.47a 1.51±0.02a 194.00±3.61a 5.77±0.09a 8.03±0.09a MT318 150.53±0.43b 1.25±0.03b 125.00±2.89b 5.03±0.09b 7.23±0.07b WT 2019 161.97±0.5a 1.61±0.01a 197.67±3.71a 6.00±0.06a 8.13±0.15a MT318 150.97±0.56b 1.31±0.01b 127.33±1.45b 5.03±0.07b 7.07±0.09b WT 2020 162.13±0.38a 1.51±0.01a 203.00±3.61a 6.10±0.06a 7.97±0.12a MT318 149.47±0.49b 1.36±0.02b 138.67±2.33b 5.13±0.03b 7.10±0.06b

[0034] Note: a and b indicate significant differences (P<0.05).

[0035] As shown in Table 1, during the mature stage, the plant height and diameter of the mutant MT318 were significantly lower than those of the wild-type WT. The fruit weight, longitudinal diameter, and transverse diameter of the mutant MT318 were also significantly lower than those of the wild-type WT. Therefore, the main agronomic traits of the wild-type WT were superior to those of the mutant MT318. In terms of fruit weight, the yield of the wild-type WT was significantly higher than that of the mutant MT318.

[0036] To investigate the genetic pattern of this mutant trait, the mutant MT318 was crossed with the wild-type WT. The F1 generation (first generation hybrid) showed stable traits, and the F1 generation was then self-crossed to obtain the F2 generation (second generation hybrid). 300 F2 plants were planted in the field, and the segregation ratio was analyzed. The F2 generation showed phenotypic segregation; 69 plants exhibited premature aging, while 231 plants showed normal traits, with a segregation ratio of 3.34. Chi-square test showed that the segregation ratio of the F2 generation conformed to a 1:3 genetic law, proving that the premature aging trait is controlled by a single recessive gene.

[0037] 3. Construct parental pools and extreme phenotype pools and perform BSA sequencing.

[0038] Based on the phenotypic traits and genetic analysis of tomatoes, 30 wild-type plants with extreme green color and 30 mutant plants with extreme yellow color and premature aging were selected from the F2 generation flowering plants, and equal amounts of leaves were taken to construct two extreme phenotypic pools.

[0039] Two parental pools were constructed by selecting equal amounts of leaves from wild-type WT10 and mutant MT31810.

[0040] The collected leaf samples were entrusted to a third-party company (Gedio Bioinformatics Co., Ltd.) for DNA extraction and subsequent BSA sequencing.

[0041] 4. BSA Analysis

[0042] Sequencing data (clean reads) were compared with the tomato genome GWHBAUD00000000 from the National Genome Science Data Center using BWA (version 0.7.12) software. SNP and InDel detection were performed using the Haplotypecaller module of GATK4 software. Annovar software was used to annotate the SNP and InDel detection results. During the segregating population construction process, the F2 generation obtained by crossing wild-type and mutant strains was selected based on phenotypic identification, resulting in mutant and wild-type progeny pools. According to the law of linkage and recombination, the genotype and phenotype in the progeny pools will co-segregate. Reflected at the physical map level, phenotypic linked chromosomal segments will show stable SNP differences with non-linked chromosomal segments. Based on the sequencing results, screening according to the 99th percentile of G values ​​revealed that GWHBAUD00000011 (i.e., tomato chromosome 11) is located in a significant interval.

[0043] Figure 4 The image shown is a Manhattan diagram of the tomato premature aging gene provided in an embodiment of this application; as shown... Figure 4 As shown in the Manhattan plot, a significant peak appears on chromosome 11, indicating the presence of a gene regulating the formation of the premature senescence trait in tomatoes or a SNP site linked to this trait. Based on the localization results, all predicted genes within the candidate region were analyzed. Combining the expression characteristics of the candidate genes, a site regulating the formation of the premature senescence trait in tomatoes was identified on chromosome 11. This site is the magnesium transporter (NIPA) gene, corresponding to gene SlT11G017380, whose nucleotide sequence is SEQ ID No: 1.

[0044] 5. SNP markers linked to the tomato premature aging gene

[0045] The NIPA gene sequence was amplified using primers designed in Table 2. The nucleotide sequences of the primers are shown in SEQ ID NO: 5-12. The amplified NIPA gene sequence was cloned and sequenced, and compared with the tomato genome sequence GWHBAUD00000000. Multiple SNPs were detected within this gene. After multiple experiments, it was found that only the polymorphism of G / C at position 3675 bp on chromosome 11 (51954644), corresponding to the SlT11G017380 gene sequence, could effectively distinguish the premature aging trait of tomatoes from normal plants. When this base is G, the tomato is a premature aging mutant; when this base is C, the tomato is a normal green wild type.

[0046] Table 2 Primers used for amplifying the NIPA gene sequence.

[0047] 1 NIPA-1F GGAGGAGGAAAAAGGGAAGA -35 to -14 2 NIPA-1R CCCAGCCATTAGCCAATAGCCT 1913 to 1935 3 NIPA-2F GGTGGTTGAATGGAGTAGTCC 1741 to 1762 4 NIPA-2R CATACACTATGTCATCTCTG 2808 to 2828 5 NIPA-3F GGAGCACTTGCAAGTCGTG 2707 to 2726 6 NIPA-3R TCAACTCATCAATTGCACC 4145 to 4164 7 NIPA-4F ACTTCCAGATACCATCATTGAACA 4062 to 4086 8 NIPA-4R CGCGAATCATGGTTCCTTGTGG 5833 to 5855

[0048] 6. KASP molecular markers for identifying SNP sites

[0049] Based on the SNP site at 3675 bp of the tomato magnesium ion transporter SlT11G017380 gene sequence, KASP molecular markers were used. First, leaf DNA was extracted from the F2 segregating population of the mutant MT318 and wild-type WT hybrids. Using genomic DNA as a template, primers were designed based on the KASP detection platform technology. The nucleotide sequence of upstream primer 1 is shown in SEQ ID No: 2, the nucleotide sequence of upstream primer 2 is shown in SEQ ID No: 3, and the nucleotide sequence of downstream primer is shown in SEQ ID No: 4. Then, real-time quantitative PCR amplification was performed on an ABI QuantStudio 5 Q5 real-time fluorescence quantitative PCR instrument. The nucleotide sequences of upstream primer 1 and upstream primer 2 contain FAM and HEX tag sequences.

[0050] The quantitative real-time PCR amplification reaction system was as follows: 5 μL of 2×KASP Mastermix, 1.4 μL of KASPAssay Mix, 1 μL of template DNA at a concentration of 100 ng / μL, and 2.6 μL of Dnase / RNase-free deionized water. The KASPAssay Mix contained primer sequences N8Fam-F, N8Hex-F, and N8-R in a volume ratio of 2:2:5. In the KASPAssay Mix, primers N8Fam-F, N8Hex-F, and N8-R at a concentration of 100 μM were mixed in a volume ratio of 2:2:5.

[0051] The quantitative real-time PCR program was as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s, 61℃ annealing and extension for 60 s, for 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ each time; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for 35 cycles; and 25℃ for 60 s, at which point the fluorescence signal was collected.

[0052] The specific methods for analyzing PCR products are as follows: Figure 5 The image shows the genotyping results of wild-type WT, mutant MT318, and F2 generation lines using primers according to an embodiment of this application; Figure 5 As shown, the genotypes of the mutant MT318 and the F2 generation containing the mutant gene that exhibit FAM fluorescence (i.e., the mutant base G in the sequence shown in SEQ ID NO:1) are denoted as type A, representing the lines containing the premature aging mutant gene; the genotypes of wild-type WT tomatoes and the F2 generation containing the homozygous wild-type gene that exhibit HEX fluorescence (i.e., the mutant base C in the sequence shown in SEQ ID NO:1) are denoted as type B, representing the lines containing the wild-type gene; the F2 generation containing the heterozygous gene exhibits a genotype that is different from both the wild-type and the mutant, and is denoted as type H.

[0053] 7. Sequencing and identification

[0054] DNA was extracted from the F2 generation single plants labeled with type A, type B, and type H genes in step 6. Primers 3400F:GGTGGTGCAA GAAGTTGGC and 3871R:GCCACATGGAA CCATTATTGA were designed at the 3675 site. The gene fragment containing the 3675 site was amplified by PCR. The gene fragment was cloned into the pMD-T vector (Dalian Takara Bio Engineering Co., Ltd.) and first-generation sequencing was performed by a gene sequencing company (Beijing Bomeco Biotechnology Co., Ltd.).

[0055] The total volume of the PCR reaction was 25 μL, including 20–60 ng template DNA, 0.5 U Taq DNA polymerase, 0.5 μL dNTPs (10 mmol / L each), 2.5 μL 10× PCR buffer, and 2.5 μL each of primers 3400F and 3871R (10 μmol / L). The PCR reaction conditions were: PCR amplification after a 95℃ hot start. The cycling conditions were: 95℃ denaturation for 5 min, 95℃ for 30 s, annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, followed by a 10 min over-extension at 72℃. The annealing temperature depended on the primers. After mixing all reactants, the mixture was amplified on a PCR instrument (MJ PTC-200), and the PCR products were detected by 1.5% agarose gel electrophoresis.

[0056] like Figure 6As shown, the sequencing results indicate a mutation from C to G at position 3675. This demonstrates that the KSAP labeling method is consistent with the sequencing results, and that this method can be used to screen for premature aging mutants in tomatoes.

[0057] From the perspective of molecular marker utilization, traditional markers such as SSR remain the most commonly used marker techniques by most researchers. This is because, although existing SNP data is abundant, it includes a large amount of redundant information, making it difficult for researchers to quickly and accurately obtain useful SNP information. Secondly, much SNP information is difficult to associate with functional gene loci, limiting its application in genetic breeding focused on functional gene utilization. Furthermore, due to the limitations imposed by SNP loci, KASP primer design is constrained by the sequences near the SNP, resulting in primers that cannot effectively perform PCR amplification. In addition, the quality of the template DNA also significantly impacts the success rate of KASP detection.

[0058] 8. Verification of traits

[0059] Figure 7 The image shows the results of KSAP labeling of the premature aging trait provided in an embodiment of this application. For example... Figure 7 As shown, to further verify the accuracy of the KASP molecular marker, DNA was extracted from 83 isolates, including the maternal wild-type WT, the paternal mutant MT318, and its F2 generation. The DNA was then used to detect premature senescence traits in tomato leaves and to identify the KASP marker. After amplification using the KASP primer set SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, the genotype of each individual plant was determined based on the fluorescence signal color.

[0060] Molecular marker analysis was performed on the above materials using the obtained tightly linked KASP molecular markers. The results showed that the fluorescence signals of the wild-type WT lines were all red, while the fluorescence signals of the mutant MT318 lines were all blue. Among the 33 lines exhibiting premature yellow phenotype, 31 showed blue fluorescence signals and 2 showed red fluorescence signals, with a marker detection accuracy of 93.93%. Among the 30 lines exhibiting normal green phenotype (wild-type), 29 showed red fluorescence signals and 1 showed blue fluorescence signals, with a marker detection accuracy of 96.6%. The 20 lines exhibiting normal green phenotype (wild-type) showed green fluorescence signals, indicating that they were heterozygous.

[0061] This invention identifies SNP sites linked to the tomato premature aging gene and uses KASP markers for genotyping, enabling rapid identification of whether tomatoes exhibit the premature aging yellow trait. The identification process is simple: DNA extraction, PCR, specific amplification, and KASP genotyping. This method eliminates the need for restriction endonuclease digestion, reducing reagent consumption. It is fast, low-cost, and utilizes the high specificity and stability of KASP markers, making it suitable for large-scale, high-throughput, and automated processes. Marker-assisted selection further enhances selection efficiency and accelerates the breeding process.

[0062] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting SNP sites in identifying premature yellowing traits in tomatoes, characterized in that, The SNP site is located at position 51954644 on chromosome 11 of tomato, and the polymorphism is G / C. When the base is G, the tomato is a premature aging mutant; when the base is C, the tomato is a normal green wild type. The tomato reference genome is GWHBAUD00000000.

2. The application of the reagent for detecting SNP sites according to claim 1 in identifying the premature yellowing trait in tomatoes, characterized in that, The reagent for detecting SNP sites is a KASP-labeled primer set, which includes forward primer 1 with the sequence shown in SEQ ID NO: 2, forward primer 2 with the sequence shown in SEQ ID NO: 3, and reverse primer with the sequence shown in SEQ ID NO:

4.

3. The application of the reagent for detecting SNP sites according to claim 2 in identifying the premature yellowing trait of tomatoes, wherein the volume ratio of the forward primer 1, the forward primer 2 and the reverse primer is 2:2:

5.

4. A method for identifying premature aging mutant traits in tomatoes, characterized in that, Using the primer set labeled with KASP as described in claim 2 or 3, the genomic DNA of the tomato to be tested is amplified. The premature yellowing trait of the tomato is determined according to the type of SNP site. When the typing result is G base, the tomato is identified as a line of the premature yellowing mutant gene. When the typing result is C base, the tomato is identified as a line containing the wild-type gene.

5. The method for identifying premature aging mutant traits in tomatoes according to claim 4, characterized in that, The reaction system used for amplification was: 5 μL of 2×KASP Mastermix, 1.4 μL of KASP Assay Mix, 1 μL of tomato genomic DNA at a concentration of 100 ng / μL, and 2.6 μL of Dnase / RNase-free deionized water; The amplification procedure is as follows: (1) Pre-denaturation at 95℃ for 15 min; (2) 95℃ denaturation for 20s, 61℃ annealing and extension for 60s, cycled 10 times, with the annealing and extension temperature decreasing by 0.6℃ each time; (3) 95℃ denaturation for 20s, 55℃ annealing and extension for 40s, cycled 35 times; （4）25℃60s。

Images