A CRIPSR / cas12i3 wheat gene editing system fused with exonuclease

Abstract

The application discloses a CRIPSR / Cas12i3 wheat gene editing system fused with an exonuclease. The application discloses a protein or a coding gene thereof shown in SEQ ID No. 6 and a crRNA expression cassette shown in SEQ ID No. 8 or SEQ ID No. 9. Experiments prove that the CRIPSR / Cas12i3 gene editing system fused with the exonuclease can achieve an editing efficiency of 75.72% to 82.80% in human HEK293T cells, and the gene editing efficiency can reach 60.95% to 88.99% in wheat stable transformation, and a high editing efficiency can be achieved in multiple wheat varieties. The application provides important tools and technical support for the CRIPSR / Cas12i3 gene editing improvement in wheat and other polyploid crops.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically a CRIPSR / Cas12i3 wheat gene editing system fused with an exonuclease. Background Technology

[0002] Wheat is one of the world's most important food crops, and its safe production is crucial to food security in my country and the world. Over the past few decades, with the development of the Green Revolution and breeding technologies, wheat variety improvement has achieved remarkable results. However, with population growth, frequent natural disasters due to global warming, decreasing arable land, and excessive use of chemical fertilizers and pesticides leading to ecological degradation, safe wheat production still faces significant challenges. Due to the redundancy and polyploid nature of wheat genes, genetic improvement of complex agronomic traits controlled by multiple genes using conventional breeding methods is time-consuming, labor-intensive, and inefficient. Gene editing tools, represented by the CRISPR / Cas system, have advantages such as high editing efficiency, simple operation, and low cost, and have become important tools for crop gene function research and genetic improvement. Therefore, applying the CRISPR / Cas gene editing system to improve wheat agronomic traits can accelerate the creation of new high-quality, high-yield, green, and efficient wheat germplasm, thereby accelerating the breeding process.

[0003] The CRISPR / Cas system originates from bacteria or archaea and serves as a defense system for prokaryotes, enabling targeted DNA cleavage (Barrangou and Marraffini, 2014). Based on the number of Cas proteins involved in DNA cleavage, CRISPR / Cas systems can be divided into two main classes: Class I (types I, III, and IV) and Class II (types II, V, and VI) (Barrangou and Marraffini, 2014; Jinek et al., 2012; Makarova et al., 2020; Shmakov et al., 2015). Class II CRISPR / Cas systems, due to their simplicity and high efficiency, have been developed into important tools for gene editing. CRISPR / Cas12i, a new member of the Class II V CRISPR / Cas family, processes pre-crRNA into mature crRNA, which, guided by the crRNA, cleaves target DNA, resulting in double-strand breaks (DSBs) (YANet et al., 2019; ZHANG et al., 2020). Compared to Cas9, Cas12i has a smaller protein molecular weight and a simpler crRNA structure, making it more suitable for multi-gene editing. Furthermore, Cas12i recognizes the 5'-TTN-3' PAM sequence, thus enabling editing of "AT"-rich non-coding regions. Previously, Zhang and Huang et al. measured the editing activity of several members of the Cas12i family in animal cells. Their results showed that Cas12i1, Cas12i2, Cas12i3, Cas12iq, Cas12i10, Cas12i11, and Cas12i12 can all achieve site-specific gene editing in mammalian cells, but the editing efficiency is low and further improvements are needed (Huang et al., 2020; Zhang et al., 2023; Zhang et al., 2020). Recently, Lv et al. analyzed the editing efficiency of CRISPR / Cas12i3 in rice, indicating that the overall gene editing efficiency of Cas12i3 in rice is low (Lv et al., 2024). Its efficiency is also low in mammalian cells and plants (Huang et al., 2020; Zhang et al., 2020a; Zhang et al., 2023).Subsequently, Duan et al. used AI to predict the interaction sites between Cas12i3 and nucleic acids, and obtained the Cas12i3-5M (S7R / D233R / D267R / N369R / S433R) variant by combining candidate protrusions in the Cas nucleic acid recognition region. Its editing efficiency in rice can reach about 75% (Duan et al., 2024).

[0004] However, similar to Cas12a, Cas12i3, guided by crRNA, typically performs staggered cuts at specific sites in the genome, producing sticky 5' ends after cutting (Zetsche et al., 2015). When two sticky ends are perfectly complementary, DSBs can usually be repaired using error-free NHEJ without causing deletions or insertions. Studies have shown that the presence of sticky ends after CRISPR / Cas12a cutting significantly reduces the editing efficiency of this system compared to Cas9 (Wang et al., 2021). Common wheat is an allohexaploid with a large genome, 40 times the size of the rice genome. Common wheat contains three subgenomes (A, B, and D), which have high similarity. When a DSB break occurs at a specific site in one subgenome, the other two subgenomes can serve as templates to guide the repair of genomic DNA at the break site. However, compared to rice, wheat has a lower genetic transformation efficiency. Therefore, wheat gene editing efficiency is low, and research on it is relatively lagging (Li et al., 2021). To date, a wheat gene editing system mediated by CRISPR / Cas12i3 and its variant Cas12i3-5M has not been established.

[0005] Exonucleases can hydrolyze the protruding ends of double-strand breaks, causing the two break ends to not match completely, which is expected to improve editing efficiency. Commonly used exonucleases are mainly of two types: one type digests single-stranded DNA along the 3' to 5' direction, such as E. coli exonuclease I (ExoI) (Clements et al., 2017; Garforth and Sayers, 1997; Shevelev et al., 2002; Tran et al., 2004); the other type digests single-stranded or double-stranded DNA along the 5' to 3' direction, such as bacteriophage T5 exonuclease (T5E). T5E is a 33kD exonuclease that can digest single-stranded DNA (ssDNA) along the 5' to 3' direction (Garforth and Sayers, 1997; Moyer and Rothe, 1977; Wu et al., 2020; Zhang et al., 2020b). Further research is needed to utilize exonucleases to eliminate the effects of sticky ends and to establish and improve the efficiency of CRISPR / Cas12i3 and its variants-mediated wheat gene editing. Summary of the Invention

[0006] The technical problem to be solved by this invention is to realize wheat gene editing using the CRISPR / Cas12i3 system and further improve its gene editing efficiency.

[0007] To address the aforementioned technical problems, this invention provides a product for wheat gene editing, the product containing a T5E-Cas12i3-5M fusion protein or biomaterials related to the T5E-Cas12i3-5M fusion protein;

[0008] The T5E-Cas12i3-5M fusion protein is as follows: A1), A2), A3), or A4):

[0009] A1) Contains the T5E protein shown in positions 2-291 of SEQ ID No. 6 and the Cas12i3-5M protein shown in positions 346-1393;

[0010] A2) The protein represented by positions 2-1393 of SEQ ID No. 6;

[0011] A3) Proteins that have the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of the T5E protein and / or the Cas12i3-5M protein.

[0012] A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1), A2), or A3);

[0013] The biomaterial is any one of B1) to B4) below:

[0014] B1) The nucleic acid molecule encoding the T5E-Cas12i3-5M fusion protein;

[0015] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0016] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0017] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0018] A1) The protein can be obtained by directly linking the T5E protein and the Cas12i3-5M protein end-to-end via peptide bonds, or by linking peptides end-to-end via peptide bonds. The T5E protein can be located at the N-terminus or C-terminus of the Cas12i3-5M protein.

[0019] The protein in A3) above refers to a protein that shares 75% or more amino acid sequence identity with and has the same function as the protein in A1) or A2). Identity refers to the similarity of the amino acid sequences. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained. The phrase "having 75% or more of the sameness" means having 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.

[0020] The proteins mentioned in A3 above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0021] The tag described in A4) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0022] A4) The protein may be the protein shown in positions 1-1393 or 2-1437 of SEQ ID No. 6, or the protein shown in SEQ ID No. 6.

[0023] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0024] Specifically, the nucleic acid molecule described in B1) can be any one of the following: (b11)-(b17)

[0025] b11) A DNA molecule containing the DNA fragment shown in positions 4-873 of SEQ ID No. 5 and the DNA fragment shown in positions 1036-4179 of SEQ ID No. 5;

[0026] b12) The DNA molecule shown in positions 4-4179 of SEQ ID No. 5;

[0027] b13) The DNA molecule shown in positions 1-4179 of SEQ ID No. 5;

[0028] b14) The DNA molecule shown in positions 1-4311 of SEQ ID No. 5;

[0029] b15) The DNA molecule shown in SEQ ID No. 5;

[0030] b16) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and is a DNA molecule encoding the T5E-Cas12i3-5M fusion protein;

[0031] b17) hybridizes under stringent conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes the DNA molecule of the T5E-Cas12i3-5M fusion protein.

[0032] Those skilled in the art can readily mutate the nucleotide sequence encoding the T5E-Cas12i3-5M fusion protein of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides having 75% or higher identity to the nucleotide sequence of the T5E-Cas12i3-5M fusion protein of the present invention, provided they encode and function the T5E-Cas12i3-5M fusion protein, are derived from and equivalent to the nucleotide sequence of the present invention.

[0033] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein (A1) or A2) of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] In the above applications, the stringent conditions can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS.

[0035] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0036] In the above-mentioned products, the expression cassette refers to DNA capable of expressing the target protein in a host cell. This DNA may include not only a promoter to initiate transcription of the target protein-coding gene, but also a terminator to terminate transtranscription of the target protein-coding gene. B2) In the expression cassette, the promoter may be a ubiquitin promoter, and / or the terminator may be an E9 terminator.

[0037] The above-mentioned products may also contain a crRNA expression cassette, wherein the crRNA expression cassette contains the DR sequence of Cas12i3 crRNA shown at positions 533-538 of SEQ ID No. 8, or contains a DNA fragment of tRNA shown at positions 1327-1403 of SEQ ID No. 9, the DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or 1417-1439, and a DNA fragment of HDV shown at positions 1448-1515.

[0038] The crRNA expression cassette can transcribe crRNA that targets the target gene.

[0039] In the above products, the promoter in the crRNA expression cassette can be the TaU3 promoter shown in positions 1-524 of SEQ ID No. 8 or the 35S complex promoter shown in positions 1-1326 of SEQ ID No. 9.

[0040] In the crRNA expression cassette, the terminator may be the ployT terminator at positions 569-576 of SEQ ID No. 8 or the tH4 terminator at positions 1515-1765 of SEQ ID No. 9.

[0041] Specifically, the crRNA expression cassette may be as shown in SEQ ID No. 8 or SEQ ID No. 9.

[0042] The above products may also contain bar gene expression cassettes or Hpt gene expression cassettes.

[0043] The above products may be recombinant vectors containing the expression cassette described in B2), the crRNA expression cassette, and the bar gene expression cassette or the Hpt gene expression cassette.

[0044] The application of the product in wheat gene editing is also within the scope of protection of this invention.

[0045] This invention first determined the editing activity of Cas12i3, the Cas12i3-5M variant, Cas12i3-5M fusions with ExoI and T5E (denoted as ExoI-Cas12i3-5M and T5E-Cas12i3-5M, respectively), and LbCas12a in human HEK293T cells. The results showed that Cas12i3-5M and T5E-Cas12i3-5M significantly improved the editing efficiency of Cas12i3, with T5E-Cas12i3-5M showing a higher efficiency than ExoI-Cas12i3-5M. Based on LbCas12a, a CRISPR / Cas12i3-mediated gene knockout system was initially established in wheat using the TaU3 promoter, a DR spacer strategy to release crRNA, and hpt as a selection gene, with TaARE1 as the target gene. Further, a strategy was employed using the 35S complex promoter (35S-CmYLCV-U6), tRNA-crRNA-HDV spacer crRNA, and bar as selection genes, targeting TaARE1-D and TaHCR, respectively. Using -D and TaSBEIIa as target genes, the gene knockout efficiency of three optimized strategies—Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M—in wheat was tested. The results showed that the T5E-Cas12i3-5M strategy achieved the highest editing efficiency at all three target sites. A high-efficiency gene knockout technology system for wheat based on Opt-T5E-Cas12i3-5M was established, with a maximum efficiency of 90.00% and an average efficiency of 63.25 ± 2.31%. The efficiency was 88.99±1.32%. Furthermore, to demonstrate the universality of this system, the present invention utilized Opt-T5E-Cas12i3-5M to target and knock out the TaPsIPK1 gene, with an average efficiency of 60.95±1.91%. The editing efficiency of the endogenous wheat gene TaSBEⅡa mediated by Opt-T5E-Cas12i3-5M was further tested under different genotypes (varieties) Zhengmai 1860 and Zhengshi 9170, with average editing efficiencies of 76.39±1.97% and 75.0±7.07%, respectively. This further demonstrates the high efficiency and universality of this wheat gene editing system. The establishment of the Opt-T5E-Cas12i3-5M-mediated high-efficiency wheat gene editing system provides important tools and technical support for the gene editing improvement of CRISR / Cas12i3 in wheat and other polyploid crops.

[0046] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0047] Figure 1 .EGxxFP Reporting System Diagram.

[0048] Figure 2 Schematic diagram of the HEK293T animal cell editing vector.

[0049] Figure 3 Wheat editing carrier structure diagram.

[0050] Figure 4 Editing efficiency of Cas12i3, Cas12i3-5M, ExoI-Cas12i3-5M, T5E-Cas12i3-5M and Cas12a in HEK293T cells.

[0051] Figure 5 The types of deletion fragment lengths produced by the Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M strategies at 8 genomic loci in 4 endogenous genes. Detailed Implementation

[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0053] Table 1. Primer Summary Table

[0054]

[0055]

[0056]

[0057] Table 2. Target genes and target sequences for wheat gene editing

[0058]

[0059] Note: The first three letters of "target sequence" indicate the PAM sequence.

[0060] Example 1

[0061] 1. Materials and Methods

[0062] 1.1 Experimental Materials

[0063] Wheat materials used for conversion: Zhengmai 7698, Zhengmai 1860 and Zhengshi 9170.

[0064] The Agrobacterium-mediated transformation expression vectors used were pHUE411 and pBUE411; the Cas12i3 fluorescent reporter system vectors S4254, P4190, and Cas12i3-5M template were provided by Shandong Shunfeng Biotechnology Co., Ltd., and the Cas12i3 sequence was provided by China Agricultural University.

[0065] 1.2 Experimental Methods

[0066] 1.2.1 Construction of cell editing vectors

[0067] The S4254 vector contains a codon-optimized Cas12i3 carrying two nuclear localization signals (NLS), and the NLS-Cas12i3-NLS-T2A-BFP expression cassette is driven by the CMV promoter. The crRNA is promoted by the U6 promoter of Pol III. The P4190 vector contains an EGFxxFP reporter system for detecting Cas12i3 editing efficiency in HEK293T cells. In the reporter system, mCherry-T2A-EGFxxFP is driven by the EF-1α core promoter and inserts a PAM-Target sequence into EGFP to disrupt its fluorescence. Target cleavage in the inserted sequence can restore EGFP fluorescence via DNA repair between EGFxxFP repeat sequences mediated by single-stranded annealing (SSA). P4190 and S4254 in this system can constitutively express mCherry and BFP fluorescence, respectively.

[0068] A fragment containing the target sequences of three genes, TaSBEIIa, TaHRC-D, and TaARE1-D, was artificially synthesized: Target(TaSBEIIa)-random sequence-Target(TaHRC-D)-random sequence-Target(TaARE1-D). This fragment was then ligated into the P4190 backbone vector digested with PmeI and AsciI to obtain the reporter vector P4190-EF-1αcore promoter-mCherry-T2A-EGx-Targets-xFP-ter(P4190-Ta). Figure 1). The sequence of Target(TaSBEIIa)-randomsequence-Target(TaHRC-D)-random sequence-Target(TaARE1-D) is as follows: AAGGCTACGTCCAGGAGTAATTTGGTTACACCATCAGTGATTGTTTCCTGCTAACCATTTGTCGGACCAGATAACGGATGATCCGTAAGGCAACTTTCATCACTGTCGCTCTCATCACTAGGGTGCCTCCTTTTCCAACATATCTCATGGCAATCTTGAGTTTAAAGCTTTGACTCGTCGCGGGTCTCCTATAAGGAACTGCGTCTTCTAGAAAGAACCAGGGATCAGACGCCCGCCAGCCTTGCTGGCGTCCGTGTTGAGCAGCGT.

[0069] First, the S4254 vector was digested with SacI to obtain the S4254-SacI fragment. The AvrII-BFP fragment was obtained by overlap PCR (using primers AVR-BPF-1-F / AVR-BPF-1-R and AVR-BPF-2-F / AVR-BPF-2-R, with the artificially synthesized BFP gene as the template). The S4254-SacI and AvrII-BFP fragments were then seamlessly cloned using a seamless cloning assembly kit (TransGen, Beijing, China) to obtain the basic vector S4254-AvrII-BFP. Using artificially synthesized LbCas12a gene fragments (SEQ ID No. 10), Cas12i3 gene fragments (SEQ ID No. 1), Cas12i3-5M gene fragments (SEQ ID No. 3), and T5E-Cas12i3-5M gene fragments (SEQ ID No. 5) as templates, and using AVR-Cas12a-F / AVR-Cas12a-R, AVR-Cas12i3-F / AVR-Cas12i3-R, AVR-5M-F / AVR-5M-R, and AVR-T5E-F / AVR-T5E-R as primers, the PCR amplification products were seamlessly cloned into the AvrII-digested S4254-AvrII-BFP vector to obtain the backbone vectors S4254-CMV enhancer-Cas12i3-T2A-BFP-ter (S4254-Cas12a) and S4254-CMV. The primers used for enhancer-Cas12i3-T2A-BFP-ter (S4254-Cas12i3), S4254-CMV enhancer-Cas12i3-5M-T2A-BFP-ter (S4254-Cas12i3-5M), S4254-CMV enhancer-ExoI-Cas12i3-5M-T2A-BFP-ter (S4254-ExoI-Cas12i3-5M), and S4254-CMV enhancer-T5E-Cas12i3-5M-T2A-BFP-ter (S4254-T5E-Cas12i3-5M) are listed in Table 1.

[0070] The Cas12i3 fragment contains the Cas12i3 gene shown in positions 70-3213 of SEQ ID No. 1; the Cas12i3-5M fragment contains the Cas12i3-5M gene shown in positions 70-3213 of SEQ ID No. 3; the T5E-Cas12i3-5M fragment contains the Cas12i3-5M gene shown in positions 70-3213 of SEQ ID No. 3 and the T5E coding gene shown in positions 4-873 of SEQ ID No. 5; the ExoI-Cas12i3-5M fragment contains the Cas12i3-5M gene shown in positions 70-3213 of SEQ ID No. 3 and the ExoI exonuclease coding gene shown in SEQ ID No. 7, as well as the linker peptide coding gene.

[0071] Nucleotide sequences of the wheat endogenous genes TaARE1, TaHRC, and TaSBEⅡa were retrieved from the EnsemblPlants database (http: / / plants.ensembl.org / Triticum_aestivum / Info / Index). These candidate genes were cloned from the recipient material Zhengmai 7698. Target sites for simultaneous knockout of the three TaSBEⅡa genomes were designed, as well as target sites for individual knockout of TaARE1 and TaHRC genomes (Table 2). Suitable target sites were selected, and upstream and downstream primers were designed to amplify and sequence the target regions, verifying the target sequences in the recipient material. U6-tRNA-crRNA (TaSBEIIa)-HDV, U6-tRNA-crRNA (TaHRC-D)-HDV, and U6-tRNA-crRNA (TaARE1-D)-HDV fragments were obtained by bridged PCR. These fragments were then ligated into S4254-Cas12i3, S4254-Cas12i3-5M, S4254-EXOI-Cas12i3-5M, and S4254-T5E-Cas12i3-5M fragments, which were then digested with NruI and SspI, respectively. This yielded target sequences targeting TaARE1, TaHRC, and TaSBEIIa in the P4190-Ta reporter vector (Table 2), as well as a series of editing vectors based on Cas12i3, Cas12i3-5M, ExoI-Cas12i3-5M, and T5E-Cas12i3-5M. Figure 2 ).

[0072] U6-tRNA-crRNA(TaSBEIIa)-HDV fragment:

[0073]

[0074] U6-tRNA-crRNA(TaHRC-D)-HDV fragment:

[0075]

[0076] U6-tRNA-crRNA(TaARE1-D)-HDV fragment:

[0077]

[0078] The bold text represents the U6 promoter, the underlined text represents the DNA fragment of tRNA, and the italic text represents the DNA fragment of HDV.

[0079] 1.2.2 Animal cell transformation and flow cytometry analysis

[0080] HEK293T cells were seeded into 12-well plates and transfected at ~80% confluence. For all transfections, 2 μg of plasmid (0.7 μg of P4190 series plasmid, 1.3 μg of S4254 series plasmid) was mixed with 100 μL of Opti-MEM (Gibco, 51985091), and then mixed with a solution containing 100 μL of Opti-MEM and 2 μL of Lipofectamine 2000 (Invitrogen, 11668-019). After incubation at room temperature for 15 minutes, the resulting DNA / Lipofectamine mixture was added to the cells. Six hours after transfection, the supernatant was removed, and 1000 μL of DMEM complete medium was added to each transfection well. After incubation for 48 hours, the medium was removed, and the transfected cells in each well were digested with 500 μL of 0.25% trypsin (Gibco, 25200-056). Then, 500 μL of culture medium was added to terminate digestion, and the cells were resuspended in 500 μL of PBS after centrifugation at 1000 rpm for 5 minutes. Cell analysis was performed using BDFACSAria SORP. During data analysis, dead cells and double cells were removed using a scattering gate; approximately 50,000 cells were collected from each sample, and the editing efficiency was calculated as the number of mCherry+BFP+GFP triple-positive cells divided by the total number of mCherry+BFP double-positive cells. For detailed procedures, please refer to [link to detailed procedure]. Figure 1 .

[0081] 1.2.3 Construction of wheat gene editing vector

[0082] Using EnsemblPlants( http: / / plants.ensembl.org / Triticum_aestivum / Info / IndexNucleotide sequences of the wheat endogenous genes TaARE1, TaHRC, TaSBEⅡa, and TaPsIPK1 were retrieved from the database, and these candidate genes were cloned from the recipient material Zhengmai 7698; in addition, TaSBEⅡa was cloned from Zhengmai 1860 and Zhengshi 9170. Target sites for simultaneous knockout of the A, B, and D genomes of TaSBEⅡa and TaPsIPK1 were designed, and target sites for knockout of the D genome of TaARE1 and TaHRC were designed.

[0083] In the pHUE411-Cas9 vector (i.e., the pHUE411 vector), the Cas protein is transcribed by the maize (Zea mays L.) ubiquitin gene promoter and terminated by the E9 terminator. It also contains a 35S-Hpt-Nos expression cassette for tissue culture screening. The basic vectors pHUE411-Cas12i3 and pHUE411-Cas12i3-5M are obtained by replacing Cas9. Further, pHUE411-Cas12i3-5M is fused with T5E to construct the pHUE411-T5E-Cas12i3-5M basic vector. Similarly, in the pBUE411-Cas9 vector (i.e., the pBUE411 vector), the Cas protein is transcribed by the maize (Zea mays L.) ubiquitin gene promoter and terminated by the E9 terminator. It also contains a 35S-Bar-Nos expression cassette for tissue culture screening. The basic vector pBUE411-Cas12i3-5M is obtained by replacing Cas9. Furthermore, pBUE411-Cas12i3-5M was fused with a T5 exonuclease to construct the pBUE411-T5E-Cas12i3-5M basic vector. The primers used are shown in Table 1.

[0084] (1) Construction of basic vectors for pHUE411-Cas12i3, pHUE411-Cas12i3-5M, pBUE411-Cas12i3, and pBUE411-Cas12i3-5M: Using artificially synthesized Cas12i3 and Cas12i3-5M gene fragments as templates, Cas12i3 and Cas12i3-5M fragments were amplified using primers Ubi-Cas12i3-F / E9t-Cas12i3-R and FastPfu high-fidelity enzyme (TransGold, Beijing, China). The amplified products were purified and recovered to obtain homologous recombination fragments. Restriction endonucleases AvrII (NEB, Beijing, China) and Sc The plasmids pHUE411-Cas9 and pBUE411-Cas9 were double-digested using aI (NEB, Beijing, China), and then purified and recovered. Using the pEASY-Uni Seamless Cloning Assembly Kit (TransGold, Beijing, China), the Cas12i3 and Cas12i3-5M fragments were ligated into the linearized vectors pHUE411-Ubi-Cas9-E9t and pBUE411-Ubi-Cas9-E9t, respectively, to obtain the basic vectors pHUE411-Cas12i3, pHUE411-Cas12i3-5M, pBUE411-Cas12i3, and pBUE411-Cas12i3-5M.

[0085] Among them, the pHUE411-Cas12i3 vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411-Cas9 vector with the Cas12i3 fusion gene; the pHUE411-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411-Cas9 vector with the Cas12i3-5M fusion gene; the pBUE411-Cas12i3 vector is a recombinant vector obtained by replacing the Cas9 gene in the pBUE411-Cas9 vector with the Cas12i3 fusion gene; and the pBUE411-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pBUE411-Cas9 vector with the Cas12i3-5M fusion gene.

[0086] The Cas12i3 fusion gene, as shown in SEQ ID No. 1, encodes the Cas12i3 fusion protein shown in SEQ ID No. 2; in SEQ ID No. 2, positions 2-23 represent the 3xFlag tag, positions 24-1071 represent the Cas12i3 protein, and positions 1072-1115 represent the nuclear localization signal peptide (NLS).

[0087] The Cas12i3-5M fusion gene, as shown in SEQ ID No. 3, encodes the Cas12i3-5M fusion protein shown in SEQ ID No. 4. In SEQ ID No. 4, positions 2-23 represent the 3xFlag tag, positions 24-1071 represent the Cas12i3-5M protein, and positions 1072-1115 represent the nuclear localization signal peptide (NLS).

[0088] (2) Construction of basic vectors pHUE411-T5E-Cas12i3-5M and pBUE411-T5E-Cas12i3-5M: The T5 Exonuclease (T5E) fragment was amplified using primers Ubi-T5E-F / SV40-32aa-R (the template was stored in our laboratory, or the fragment could be synthesized directly). After purification and recovery, the homologous recombinant fragment of T5 Exonuclease was obtained. The plasmids pHUE411-Cas12i3-5M and pBUE411-Cas12i3-5M were digested with restriction endonuclease AvrII to obtain linearized vectors. The obtained homologous recombinant fragment was ligated into the linearized vectors using the pEASY-Uni seamless cloning and assembly kit to obtain the pHUE411-T5E-Cas12i3-5M and pBUE411-T5E-Cas12i3-5M vectors.

[0089] Among them, the pHUE411-T5E-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pHUE411-Cas9 vector with the T5E-Cas12i3-5M fusion gene; the pBUE411-T5E-Cas12i3-5M vector is a recombinant vector obtained by replacing the Cas9 gene in the pBUE411-Cas9 vector with the T5E-Cas12i3-5M fusion gene.

[0090] The T5E-Cas12i3-5M fusion gene, as shown in SEQ ID No. 5, encodes the T5E-Cas12i3-5M fusion protein shown in SEQ ID No. 6. In SEQ ID No. 6, positions 2-291 represent the T5E protein, positions 292-323 represent the linker peptide, positions 324-345 represent the 3xFlag tag, positions 346-1393 represent the Cas12i3-5M protein, and positions 1394-1437 represent the nuclear localization signal peptide (NLS).

[0091] (3) Construction of site-directed knockout vector: Transcription of crRNA was initiated by TaU3 and terminated by PolyT to construct an intermediate vector containing the TaU3 promoter and DR sequence. First, the synthesized TaU3 fragment was used as a template to amplify the promoter sequence with primer L-TaU3-F / DR-Pme-R, and the PmeI-DR-polyT sequence was obtained by direct annealing with primer Pme-DR-F / R-DR-R. After purification and recovery, the fragments were subjected to overlap PCR with primer L-TaU3-F / R-DR-R to obtain the homologous recombination fragment of TaU3-PmeI-DR-polyT tandem. The sequence of this fragment is shown in SEQ ID No. 8. In SEQ ID No. 8, positions 1-524 represent the TaU3 promoter, positions 525-532 represent the PmeI recognition sequence, positions 533-538 represent the DR sequence of Cas12i3 crRNA, and positions 569-576 represent the polyT sequence.

[0092] The plasmids pHUE411-Cas12i3, pHUE411-Cas12i3-5M, and pHUE411-T5E-Cas12i3-5M were digested with the restriction endonuclease PmeI, and the linear vector backbones were purified and recovered after digestion. Homologous recombination fragments were ligated into the linearized vectors pHUE411-Cas12i3, pHUE411-Cas12i3-5M, and pHUE411-T5E-Cas12i3-5M using the pEASY-Uni seamless cloning and assembly kit, respectively, to obtain the intermediate vectors pHUE411-Cas12i3-TaU3-PmeI-DR-polyT, pHUE411-Cas12i3-5M-TaU3-PmeI-DR-polyT, and pHUE411-T5E-Cas12i3-5M-TaU3-PmeI-DR-polyT. The DR-ARE1-DR-polyT fragment was obtained by direct annealing of DR-WARE-F and DR-WARE-R. This DR-ARE1-DR-polyT fragment was then ligated into PmeI-digested vectors pHUE411-Cas12i3-TaU3-PmeI-DR-polyT, pHUE411-Cas12i3-5M-TaU3-PmeI-DR-polyT, and pHUE411-T5E-Cas12i3-5M-TaU3-PmeI-DR-polyT to construct knockout vectors using the Cas12i3, Cas12i3-5M, and T5-Cas12i3-5M strategies. Figure 3 The vector obtained here is used to edit the TaARE1-A / B / D gene.

[0093] To further improve editing efficiency, a strategy was adopted to initiate crRNA transcription using the complex strong promoter 35S-CmYLCV-U6 (35S complex promoter), terminate transcription using the tH4 terminator, and screen for bar genes. Simultaneously, to ensure efficient and precise release of crRNA, tRNA and the nuclease HDV were used as separators. Using the synthesized 35S-CmYLCV-U6 sequence as a template, the promoter sequence was amplified using primer L-35S-F / tRNA-U6-R. Using the synthesized tRNA sequence as a template, the tRNA-DR sequence was amplified using primer U6-tRNA-F / Pme-DR-tRNA-R. Using the synthesized HDV sequence as a template, the HDV sequence was amplified using primer DR-Pme-HDV-F / tH4-HDV-R. Using the synthesized tH4 sequence as a template, the terminator sequence was amplified using primer HDV-tH4-F / R-tH4-R. After purification and recovery, overlapping PCR was performed using primer L-35S-F / R-tH4-R to obtain the homologous recombination fragment of 35S composite-tRNA-DR-PmeI-HDV-tH4, the sequence of which is shown in SEQ ID No. 9. In No. 9, positions 1-1326 represent the 35S complex promoter, positions 1327-1403 represent the DNA sequence of tRNA, positions 1404-1439 represent the DR sequence of Cas12i3crRNA, positions 1440-1447 represent the recognition sequence of PmeI, positions 1448-1515 represent the DNA sequence of HDV, and positions 1515-1765 represent the sequence of the tH4 terminator.

[0094] The obtained fragments were homologously recombinated with the PmeI-digested linear vectors pBUE411-Cas12i3, pBUE411-Cas12i3-5M, and pBUE411-T5E-Cas12i3-5M to obtain intermediate vectors pBUE411-Cas12i3-35S composite-tRNA-DR-PmeI-HDV-tH4, pBUE411-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4, and pBUE411-T5E-Cas12i3-5M-35S composite-tRNA-DR-PmeI-HDV-tH4. The primers DR-ARED-F / HDV-ARED-R, DR-HRC-F / HDV-HRC-R, DR-SBE-F / HDV-SBE-R, and DR-PsIPK-F / HDV-PsIPK-R were annealed to obtain DR-ARED-HDV, DR-HRCD-HDV, DR-SBEIIa-HDV, and DR-PsIPK-HDV fragments, respectively. These fragments were then ligated into intermediate vectors digested with PmeI to obtain knockout vectors using the Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M strategies. Figure 3 The vectors obtained here are used to edit the TaARE1-D, TaHRC-D, TaSBEIIa and TaPsIPK1 genes.

[0095] 1.2.4 Agrobacterium-mediated genetic transformation and tissue culture process in wheat

[0096] Wheat embryos 15 days after flowering were selected, immature seeds were extracted and placed in sterile culture bottles. The bottles were first sterilized with 70% ethanol solution for 5 minutes, then with 10% sodium hypochlorite solution for 15 minutes, with constant shaking during the process. Finally, the seeds were rinsed three times with sterile water, and the embryos were dissected using a dissecting microscope in a sterile laminar flow hood. The knockout vector obtained in steps 1.2.3 was introduced into EHA105, and wheat was transformed using Agrobacterium-mediated genetic transformation. After resistance selection culture, the plants were cultured in the dark at 25°C for 15 days, then transferred to regeneration medium. After 10 days of light culture at 25°C, the green shoots were transferred to rooting medium and cultured in light at 25°C for 5-6 weeks. Molecular identification of the regenerated plants was then performed. After molecular identification, the edited plants were transplanted into soil and, after acclimatization, placed in a cold room at 4°C for 30 days of vernalization (the vernalization time varies depending on the wheat variety). After vernalization, the edited plants were transferred to a controlled greenhouse at 25°C for propagation.

[0097] 1.2.5 Genotyping of T0 generation regenerated plants

[0098] Clusters of leaves were harvested from T0 generation wheat seedlings. Wheat genomic DNA was extracted using a DNA extraction kit (Tiangen, Beijing, China) as a template. Using this genomic DNA as a template, primers were used to detect the genomic DNA samples and identify the number of transgenic plants. Based on this, using the genomic DNA of the transgenic plants as a template, PCR amplification was performed on the transgenic plants using genome-specific detection primers, followed by Sanger sequencing. The sequencing results were obtained through… http: / / dsdecode.scgene.com / The website analyzes genotypes, and for samples with complex editing types, PCR products are ligated into the B-zero vector (Truly Gold, Beijing, China), and single clones are selected to determine the specific editing type.

[0099] 1.2.6 Off-target analysis

[0100] Using the NCBI database and CRISPR RGEN Tools http: / / www.rgenome.net / cas- offinder / The website predicts potential off-target sites for selected targets in wheat TaARE1-D, TaHRC, TaSBEⅡa, and TaPsIPK1 genes, respectively, and designs specific primers for amplification and sequencing. Based on the sequence alignment results, it is determined whether there are off-target situations for the selected targets.

[0101] 2. Experimental Results

[0102] 2.1 Editing efficiency of different Cas12i3 variants in HEK293T cells

[0103] To preliminarily determine the editing efficiency of Cas12i3, Cas12i3-5M, ExoI-Cas12i3-5M, T5E-Cas12i3-5M, and LbCas12a (hereinafter simplified as Cas12a), a series of editing vectors, S4254-Cas12i3, S4254-Cas12i3-5M, S4254-EXOI-Cas12i3-5M, S4254-T5E-Cas12i3-5M, and S4254-Cas12a, were constructed by targeting the endogenous wheat targets TaARE1-D, TaHRC-D, and TaSBEIIa (Table 2). Figure 2 The editing efficiency of each vector was determined using the EGxxFP reporter system. The P4190 vector contained the EGxxFP reporter system. When P4190 and the above editing vectors were co-transformed into human HEK293T cells, the GFP fluorescence signal could only be detected when the target region inside the GFP was cleaved by nuclease.

[0104] Flow cytometry analysis showed that at the TaARE1-D target site, Cas12i3 exhibited the highest editing efficiency (25.40%), the lowest (19.10%), and an average efficiency of 21.01 ± 1.83%; Cas12i3-5M showed the highest editing efficiency (69.40%), the lowest (60.10%), and an average efficiency of 63.70 ± 3.59%, representing an approximately 3.03-fold increase in editing efficiency compared to Cas12i3 (63.70% / 21.01%); ExoI-Cas12i3-5M showed the highest editing efficiency (14.20%), the lowest (9.40%), and an average efficiency of 11.66 ± 1.83%, representing a 1.80-fold decrease in efficiency compared to Cas12i3 (21.01% / 11.66%); T5E-Cas12i3- The Cas12A's editing efficiency ranged from a high of 83.10% to a low of 75.30%, with an average efficiency of 80.44 ± 2.34%. This represents a 3.83-fold increase in efficiency compared to Cas12i3 (80.44% / 21.01%), and a 1.07-fold increase compared to Cas12i3-5M (80.44% / 75.30%). The Cas12A's editing efficiency ranged from a high of 71.40% to a low of 63.10%, with an average efficiency of 67.33 ± 3.10%. This is 3.00 times (67.33% / 21.01%) and 1.06 times (67.33% / 63.70%) more efficient than Cas12i3 and Cas12i3-5M, respectively, and 1.19 times (80.44% / 67.33%) less efficient than T5E-Cas12i3-5M. Figure 4 ).

[0105] At the TaHRC-D target, Cas12i3 showed the highest editing efficiency at 26.10%, the lowest at 18.20%, and an average efficiency of 21.38 ± 2.34%. Cas12i3-5M showed the highest editing efficiency at 74.20%, the lowest at 53.30%, and an average efficiency of 61.92 ± 6.76%, representing an approximately 2.90-fold increase in editing efficiency compared to Cas12i3 (61.92% / 21.38%). ExoI-Cas12i3-5M showed the highest editing efficiency at 18.00%, the lowest at 11.30%, and an average efficiency of 14.47 ± 2.49%, representing a 1.48-fold decrease in efficiency compared to Cas12i3 (21.38% / 14.47%). The T5E-Cas12i3-5M has the highest editing efficiency at 86.70%, the lowest at 78.20%, and an average efficiency of 82.80±3.01%, representing a 3.87-fold increase in efficiency compared to the Cas12i3 (82.80% / 21.38%), and a 1.34-fold increase in efficiency compared to the Cas12i3-5M (82.80% / 61.92%). The Cas12a has the highest editing efficiency at 74.70%, the lowest at 64.20%, and an average efficiency of 68.56±3.31%, representing 3.21 times (68.56% / 21.38%) and 1.11 times (68.56% / 61.92%) of the Cas12i3 and Cas12i3-5M, respectively, and is 1.21 times (82.80% / 68.56%) lower than the T5E-Cas12i3-5M. Figure 4 ).

[0106] At the TaSBEIIa target, Cas12i3 showed the highest editing efficiency at 23.50%, the lowest at 17.00%, and an average efficiency of 20.69 ± 1.76%. Cas12i3-5M showed the highest editing efficiency at 68.70%, the lowest at 51.90%, and an average efficiency of 59.37 ± 4.72%, representing an approximately 2.87-fold increase in editing efficiency compared to Cas12i3 (59.37% / 20.69%). ExoI-Cas12i3-5M showed the highest editing efficiency at 18.800%, the lowest at 5.91%, and an average efficiency of 10.89 ± 4.76%, representing a 1.90-fold decrease in efficiency compared to Cas12i3 (20.69% / 10.89%). The T5E-Cas12i3-5M has the highest editing efficiency at 81.20%, the lowest at 73.10%, and an average efficiency of 75.72±3.03%, representing a 3.66-fold increase (75.72% / 20.69%) compared to the Cas12i3, and a 1.28-fold increase (75.72% / 59.37%) compared to the Cas12i3-5M. The Cas12a has the highest editing efficiency at 73.40%, the lowest at 51.20%, and an average efficiency of 65.04±7.05%, representing 3.14 times (65.04% / 20.69%) and 1.10 times that of the Cas12i3 and Cas12i3-5M, respectively, and 1.16 times (75.72% / 65.04%) lower than the T5E-Cas12i3-5M. Figure 4 ).

[0107] In summary, in mammalian cells, T5E-Cas12i3-5M can improve the editing efficiency of Cas12i3 and Cas12i3-5M, and its editing efficiency is higher than that of Cas12a at all three tested target sites.

[0108] 2.2 Comparison of the efficiency of Cas12i3, Cas12i3-5M and T5-Cas12i3-5M strategies in TaARE1-A / B / D target sites in stable wheat plants

[0109] For the TaARE1-A / B / D knockout vector using the Cas12i3 strategy, Zhengmai 7698 wheat was genetically transformed using Agrobacterium. Two replicates were used to transform 714 and 572 wheat immature embryos, respectively. After wheat tissue culture, 59 and 41 regenerated plants were obtained, respectively. Transgenic primer detection yielded 11 and 10 transgenic positive plants, respectively. Genome-specific primer amplification and sequencing identification showed no editing events, indicating an editing efficiency of 0.00%.

[0110] For the TaARE1-A / B / D knockout vector using the Cas12i3-5M strategy, genetic transformation of Zhengmai 7698 was performed using Agrobacterium tumefaciens. Two replicates were used to transform 158 and 243 wheat immature embryos, respectively. After wheat tissue culture, 55 and 87 regenerated plants were obtained, respectively. Transgenic primer detection yielded 5 and 7 transgenic positive plants, respectively. Genome-specific primer amplification and sequencing identification showed no editing events, indicating an editing efficiency of 0.00%.

[0111] For the TaARE1-A / B / D knockout vector using the T5E-Cas12i3-5M strategy, genetic transformation of Zhengmai 7698 was performed using Agrobacterium. The first transformation involved 387 wheat embryos, followed by wheat tissue culture, yielding 146 regenerated plants, including 10 transgenic plants. Further identification revealed that one of these plants had edited both the A and D genomes, with an editing efficiency of 10.00% (1 / 10). The second transformation involved 476 wheat embryos, followed by wheat tissue culture, yielding 254 regenerated plants, including 5 transgenic plants. Further identification revealed that one of these plants had edited the A genome, with an editing efficiency of 20.00% (1 / 5). The third transformation involved 513 wheat embryos, followed by wheat tissue culture, yielding 225 regenerated plants, including 6 transgenic plants. Further identification revealed that two of these plants had edited the B genome, with an editing efficiency of 33.33% (2 / 6). Three replicates were conducted, with the highest efficiency at 33.33% and the lowest at 10.00%, resulting in an average editing efficiency of 21.11 ± 11.70%. These preliminary results indicate that, consistent with the findings in the HEK293T cell line, the fusion of the exonuclease T5E improves editing efficiency and can preliminarily achieve wheat gene editing; however, further improvements in gene editing efficiency are needed.

[0112] 2.3 Optimize carrier construction strategies to further improve editing efficiency

[0113] Although wheat gene editing was achieved using T5E-Cas12i3-5M, its efficiency remained low. Previously, it was reported that the 35S complex promoter exhibited higher initiation activity than the Pol III promoters U3 or U6 (Jiang et al., 2020; Jiang et al., 2022). In addition, replacing the release strategy of DR-crRNA-DR spacer cRNA with the tRNA-crRNA-HDV spacer strategy can improve gene editing efficiency (Jiang et al., 2020); to further improve the editing efficiency of Cas12i3 in wheat, this experiment constructed Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M, and further optimized the structure of the knockout vector: (1) the crRNA promoter TaU3 was replaced with the 35S complex promoter (35S-CmYLCV-U6); (2) the release strategy of DR-crRNA-DR spacer crRNA was replaced with the tRNA-crRNA-HDV spacer crRNA strategy, with tH4 as the terminator; (3) the selection gene hpt was replaced with bar.

[0114] Based on this, target sites designed for the D genome of the endogenous wheat TaARE1 gene, the D genome of the TaHRC gene, and the A / B / D genome of the TaSBEIIa gene were used to construct knockout vectors for the above three target genes using three strategies: Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M. Figure 3 ).

[0115] 2.3.1 Opt-Cas12i3-mediated gene editing of endogenous genes in wheat

[0116] Using Zhengmai 7698 as the recipient material, wheat embryos were transformed using Agrobacterium-mediated transformation. The optimized Opt-Cas12i3 strategy achieved the editing of TaARE1-D, TaHRC-D, and TaSBEIIa.

[0117] For the TaARE1-D target, the experiment was repeated three times. In the first transformation, 181 wheat immature embryos were transformed, and after wheat tissue culture, 21 regenerated plants were obtained, including 17 transgenic plants. Two of these were further identified as edited plants, with an editing efficiency of 11.76%. In the second transformation, 107 wheat immature embryos were transformed, and after wheat tissue culture, 14 regenerated plants were obtained, including 11 transgenic plants. One of these was further identified as an edited plant, with an editing efficiency of 9.10%. In the third transformation, 171 wheat immature embryos were transformed, and after wheat tissue culture, 18 regenerated plants were obtained, all of which were transgenic. Three of these were further identified as edited plants, with an editing efficiency of 16.67%. The highest editing efficiency across the three replicates was 16.67%, the lowest was 9.10%, and the average efficiency was 12.51 ± 3.84%. Sequencing and genotyping results showed that all lines exhibited heterozygous editing of the D genome.

[0118] For the TaHRC-D target, the experiment was repeated three times. In the first transformation, 70 wheat immature embryos were transformed, and after wheat plant tissue culture, 11 regenerated plants were obtained, 10 of which were transgenic. One of these was further identified as an edited plant, with an editing efficiency of 10.00%. In the second transformation, 81 wheat immature embryos were transformed, and after wheat plant tissue culture, 11 regenerated plants were obtained, 9 of which were transgenic. One of these was further identified as an edited plant, with an editing efficiency of 11.11%. In the third transformation, 73 wheat immature embryos were transformed, and after wheat plant tissue culture, 8 regenerated plants were obtained, all of which were transgenic. One of these was further identified as an edited plant, with an editing efficiency of 12.50%. The average editing efficiency of the three replicates was 11.20 ± 1.25%. Sequencing and genotyping results showed that all edited lines obtained from the three replicates were heterozygous edits, and the genotype was Dd.

[0119] For the TaSBEIIa target, the experiment was repeated three times. In the first transformation, 70 wheat embryos were transformed, and after wheat tissue culture, 12 regenerated plants were obtained, all of which were transgenic. Further identification showed that 2 of these were edited plants, with an editing efficiency of 16.67%. In the second transformation, 113 wheat embryos were transformed, and after wheat tissue culture, 17 regenerated plants were obtained, all of which were transgenic. Further identification showed that 3 of these were edited plants, with an editing efficiency of 20.00%. In the third transformation, 91 wheat embryos were transformed, and after wheat tissue culture, 11 regenerated plants were obtained, all of which were transgenic. Further identification showed that 2 of these were edited plants, with an editing efficiency of 18.18%. The highest editing efficiency across the three replicates was 20.00%, the lowest was 16.67%, and the average efficiency was 18.28 ± 1.67%. Sequencing and genotyping results showed that all edited lines obtained from the three replicates were heterozygous edits, with 4 plants of genotype AABbDD, 1 plant of genotype AaBBDd, 1 plant of genotype AaBBDD, and 1 plant of genotype AABBDd. No plants with simultaneous editing of all three genomes were obtained.

[0120] 2.3.2 Opt-Cas12i3-5M-mediated gene editing of endogenous wheat genes

[0121] Using Zhengmai 7698 as the recipient material, wheat embryos were transformed using the Opt-Cas12i3-5M strategy, targeting TaARE1-D, TaHRC-D, and TaSBEIIa, via Agrobacterium-mediated transformation.

[0122] For the TaARE1-D target, the experiment was repeated three times. In the first transformation, 156 wheat embryos were transformed, and after wheat tissue culture, 12 regenerated plants were obtained, all of which were transgenic. Further identification revealed 7 of these as edited plants, with an editing efficiency of 58.33%. In the second transformation, 160 wheat embryos were transformed, and after wheat tissue culture, 7 regenerated plants were obtained, all of which were transgenic. Further identification revealed 4 of these as edited plants, with an editing efficiency of 57.14%. In the third transformation, 181 wheat embryos were transformed, and after wheat tissue culture, 15 regenerated plants were obtained, of which 14 were transgenic. Further identification revealed 8 of these as edited plants, with an editing efficiency of 57.14%. The highest editing efficiency across the three replicates was 58.33%, the lowest was 57.14%, and the average efficiency was 57.54 ± 0.68%. Sequencing and typing results showed that among the edited lines, there were 7 plants with genotype Dd and 12 plants with genotype dd. Homozygous D-genome and biallelic edited lines accounted for 63.19% (12 / 19) of the total number of edited plants.

[0123] For the TaHRC-D target, the experiment was repeated three times. In the first transformation, 98 wheat embryos were transformed, and after wheat plant tissue culture, 12 regenerated plants were obtained, all of which were transgenic. Further identification revealed 8 of these as edited plants, with an editing efficiency of 66.67%. In the second transformation, 95 wheat embryos were transformed, and after wheat plant tissue culture, 9 regenerated plants were obtained, 8 of which were transgenic. Further identification revealed 5 of these as edited plants, with an editing efficiency of 62.50%. In the third transformation, 105 wheat embryos were transformed, and after wheat plant tissue culture, 21 regenerated plants were obtained, all of which were transgenic. Further identification revealed 15 of these as edited plants, with an editing efficiency of 71.43%. The highest editing efficiency across the three replicates was 71.43%, the lowest was 62.50%, and the average efficiency was 66.87 ± 4.47%. Sequencing and typing results showed that among the edited lines, 13 plants had the genotype Dd and 15 plants had the genotype dd. D-genome homozygous and biallelic edited lines accounted for 53.57% (15 / 28) of the total number of edited plants.

[0124] For the TaSBEIIa target, the experiment was repeated three times. In the first transformation, 181 wheat embryos were transformed, and after wheat tissue culture, 12 regenerated plants were obtained, all of which were transgenic. Further identification showed that 7 of these were edited plants, with an editing efficiency of 58.33%. In the second transformation, 174 wheat embryos were transformed, and after wheat tissue culture, 17 regenerated plants were obtained, all of which were transgenic. Further identification showed that 11 of these were edited plants, with an editing efficiency of 64.71%. In the third transformation, 185 wheat embryos were transformed, and after wheat tissue culture, 17 regenerated plants were obtained, of which 15 were transgenic. Further identification showed that 7 of these were edited plants, with an editing efficiency of 46.67%. The highest editing efficiency across the three replicates was 64.71%, the lowest was 46.67%, and the average efficiency was 56.57 ± 9.15%. Sequencing and typing results showed that among the edited lines, there was 1 line with a single A genome edited, 3 lines with a single B genome edited, 4 lines with a single D genome edited, 1 line with both A and B genomes edited, 2 lines with both A and D genomes edited, 1 line with both B and D genomes edited, and 13 lines with all three genomes edited simultaneously, accounting for 52.00% (13 / 25) of the total number of edited plants.

[0125] In summary, compared with the Opt-Cas12i3 strategy, the Opt-Cas12i3-5M strategy improved the efficiency of TaARE-D, TaHRC-D and TaSBEIIa targets by 4.66 times (58.33% / 12.51%), 5.97 times (66.87% / 11.20%) and 3.09 times (56.57% / 18.28%), respectively.

[0126] 2.3.3 The Opt-T5E-Cas12i3-5M strategy can significantly improve the efficiency of endogenous gene editing.

[0127] Using Zhengmai 7698 as the recipient material, wheat embryos were transformed using an Agrobacterium-mediated transformation method targeting TaARE1-D, TaHRC-D, and TaSBEIIa with the Opt-T5E-Cas12i3-5M strategy.

[0128] For the TaARE1-D target site, the first transformation involved 269 wheat immature embryos, which, after wheat plant tissue culture, yielded 48 regenerated plants, of which 46 were transgenic. Further identification revealed 30 of these to be edited plants, resulting in an editing efficiency of 65.22%. The second transformation involved 277 wheat immature embryos, which, after wheat plant tissue culture, yielded 48 regenerated plants, of which 47 were transgenic. Further identification revealed 30 of these to be edited plants, resulting in an editing efficiency of 63.83%. The third transformation involved 192 wheat immature embryos, which, after wheat plant tissue culture, yielded 28 regenerated plants, all of which were transgenic. Further identification revealed 17 of these to be edited plants, resulting in an editing efficiency of 60.71%. The highest editing efficiency across the three replicates was 65.22%, the lowest was 60.71%, and the average efficiency was 63.25 ± 2.31%. Sequencing and typing results showed that among the edited lines, 45 plants had the genotype Dd and 32 plants had the genotype dd. Homozygous D-genome and biallelic edited lines accounted for 41.56% (32 / 77) of the total number of edited plants.

[0129] For the TaHRC-D target site, the experiment was repeated three times. In the first transformation, 187 wheat immature embryos were transformed, and after wheat tissue culture, 24 regenerated plants were obtained, including 19 transgenic plants. Further identification revealed 17 of these to be edited plants, with an editing efficiency of 89.47%. In the second transformation, 202 wheat immature embryos were transformed, and after wheat tissue culture, 23 regenerated plants were obtained, including 20 transgenic plants. Further identification revealed 18 of these to be edited plants, with an editing efficiency of 90.00%. In the third transformation, 124 wheat immature embryos were transformed, and after wheat tissue culture, 17 regenerated plants were obtained, including 16 transgenic plants. Further identification revealed 14 of these to be edited plants, with an editing efficiency of 87.50%. The highest editing efficiency across the three replicates was 90.00%, the lowest was 87.50%, and the average efficiency was 88.99 ± 1.32%. The sequencing and genotyping results of the gene-edited lines obtained in the three replicate experiments showed that there were 16 plants with genotype Dd and 33 plants with genotype dd. The D genome homozygous and biallelic edited lines accounted for 67.35% (33 / 49) of the total number of edited plants.

[0130] For the TaSBEIIa target site, the experiment was repeated three times. In the first transformation, 222 wheat embryos were transformed, and after wheat plant tissue culture, 11 regenerated plants were obtained, all of which were transgenic. Further identification showed that 8 of these were edited plants, with an editing efficiency of 72.73%. In the second transformation, 175 wheat embryos were transformed, and after wheat plant tissue culture, 9 regenerated plants were obtained, all of which were transgenic. Further identification showed that 7 of these were edited plants, with an editing efficiency of 77.78%. In the third transformation, 107 wheat embryos were transformed, and after wheat plant tissue culture, 8 regenerated plants were obtained, 7 of which were transgenic. Further identification showed that 5 of these 7 transgenic plants were edited plants, with an editing efficiency of 71.43%. The highest editing efficiency across the three replicates was 77.78%, the lowest was 71.43%, and the average efficiency was 73.98 ± 3.35%. Among the gene-edited lines obtained in the three replicate experiments, there were 2 plants with genotype AaBbDd, 5 plants with genotype AaBBDd, 5 plants with genotype AaBBDD, 2 plants with genotype AABBDd, 3 plants with genotype AABbDd, 1 plant with genotype aabbdd, 3 plants with genotype aaBBDd, and 1 plant with genotype aaBBdd. The number of plants with simultaneous editing of the A, B, and D genomes accounted for 20.00% (4 / 20) of the total number of edited plants.

[0131] In summary, compared with the Opt-Cas12i3 strategy, the Opt-T5E-Cas12i3-5M strategy, which incorporates a T5 exonuclease, showed a 5.06-fold (63.25% / 12.51%), 7.95-fold (88.99% / 11.20%), and 4.05-fold (73.98% / 18.28%) improvement in efficiency at the TaARE-D, TaHRC-DD, and TaSBEIIa targets, respectively. Furthermore, compared with the Opt-Cas12i3-5M strategy, the Opt-T5E-Cas12i3-5M strategy, which incorporates a T5 exonuclease, showed a 1.10-fold (63.25% / 57.54%), 1.33-fold (88.99% / 66.87%), and 1.31-fold (73.98% / 56.57%) improvement in efficiency at the TaARE-D, TaHRC-DD, and TaSBEIIa targets, respectively.

[0132] 2.3.4 Adding T5 exonuclease increased the length of the deleted fragment.

[0133] At the TaARE-D target site, all six edited lines obtained by the Opt-Cas12i3 strategy showed deletions of 1-30 bp, accounting for 100%; all 19 edited lines obtained by the Opt-Cas12i3-5M strategy showed deletions of 1-30 bp, accounting for 100%, with some lines accompanied by SNPs and 2 bp insertions; among the 77 edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 55.36%, deletions of 31-100 bp accounted for 39.55%, and deletions greater than 100 bp accounted for 5.09%, with the longest deleted fragment reaching 182 bp, and some lines accompanied by 1-32 bp insertions. Figure 5 ).

[0134] At the TaHRC-D target site, all three edited lines obtained by the Opt-Cas12i3 strategy showed deletions of 1-30 bp, accounting for 100%; all 28 edited lines obtained by the Opt-Cas12i3-5M strategy showed deletions of 1-50 bp, with 1-30 bp deletions accounting for 92.89% and 31-50 bp deletions accounting for 7.11%; among the 49 edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, 1-30 bp deletions accounted for 39.87%, 31-100 bp deletions accounted for 51.72%, and deletions greater than 100 bp accounted for 8.41%, with the longest deleted fragment reaching 249 bp. Some lines also included insertions of 1-21 bp. Figure 5 ).

[0135] At the TaSBEIIa-A site, the edited lines obtained by the Opt-Cas12i3 strategy consisted of deletions of 1-20 bp; the edited lines obtained by the Opt-Cas12i3-5M strategy all consisted of deletions within 40 bp, with deletions of 1-30 bp accounting for 96.67% and deletions of 31-40 bp accounting for 3.33%; in the edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 32.59%, deletions of 31-100 bp accounted for 63.70%, and deletions greater than 100 bp accounted for 3.70%, with the longest deletion fragment reaching 206 bp, and some lines accompanied by insertions of 2-3 bp. At the TaSBEIIa-B site, the edited lines obtained by the Opt-Cas12i3 strategy consisted of deletions of 1-40 bp, with 1-30 bp deletions accounting for 66.67% and 31-40 bp deletions accounting for 33.33%. The edited lines obtained by the Opt-Cas12i3-5M strategy consisted of deletions within 60 bp, with 1-30 bp deletions accounting for 94.29% and 31-60 bp deletions accounting for 5.71%. In the edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, 1-30 bp deletions accounted for 52.38%, 31-100 bp deletions accounted for 36.51%, and deletions greater than 100 bp accounted for 11.11%. The longest deleted fragment was 119 bp, and some lines were accompanied by 1 bp insertions. At the TaSBEIIa-D site, the edited lines obtained by the Opt-Cas12i3 strategy consisted of deletions within 20 bp; among the 20 edited lines obtained by the Opt-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 93.10%, deletions of 31-60 bp accounted for 3.45%, and deletions greater than 100 bp accounted for 3.45%; among the 9 edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 33.33%, deletions of 31-100 bp accounted for 66.67%, of which deletions of 91-100 bp accounted for 16.67%, and the longest deleted fragment was 97 bp (…). Figure 5 ).

[0136] In summary, by comparing the optimized Opt-Cas12i3, Opt-Cas12i3-5M, and Opt-T5E-Cas12i3-5M strategies on the target genes TaARE1-D, TaHRC-D, and TaSBEIIa, we demonstrated that the addition of the T5 exonuclease not only improves editing efficiency but also expands the length of the deleted fragment. This established a highly efficient CRISPR / Cas12i3-based gene knockout system in wheat, providing important tools and technical support for the widespread application of CRISPR / Cas12i3 variants in gene editing improvement of wheat and other crops.

[0137] 2.4 Determination of the universality of gene editing for different endogenous genes and different varieties using the optimized strategy Opt-T5E-Cas12i3-5M

[0138] 2.4.1 Determination of the universality of Opt-T5E-Cas12i3-5M for different endogenous genes

[0139] To further verify the editing activity of the optimized Opt-T5E-Cas12i3-5M strategy, the TaPsIPK1 editing vector was constructed. Using Zhengmai 7698 as the recipient material, wheat immature embryos were transformed using Agrobacterium-mediated transformation. The experiment was repeated three times. In the first transformation, 156 wheat immature embryos were transformed, and after wheat plant tissue culture, 14 regenerated plants were obtained, of which 13 were transgenic plants. Further identification revealed 8 of these to be edited plants, with an editing efficiency of 61.54%. In the second transformation, 241 wheat immature embryos were transformed, and after wheat plant tissue culture, 19 regenerated plants were obtained, of which 17 were transgenic plants. Further identification revealed 10 of these to be edited plants, with an editing efficiency of 58.82%. In the third transformation, 187 wheat immature embryos were transformed, and after wheat plant tissue culture, 16 regenerated plants were obtained, all of which were transgenic plants. Further identification revealed 10 of these to be edited plants, with an editing efficiency of 62.50%. The highest efficiency of the three-repeated editing was 62.50%, the lowest was 58.82%, and the average efficiency was 60.95 ± 1.91%. Among the gene-edited lines obtained in the three-repeated experiments, there were 5 plants with genotype AaBbDd, 5 plants with genotype aabbdd, 1 plant with genotype AaBBDD, 2 plants with genotype AaBbdd, 4 plants with genotype aaBbdd, 1 plant with genotype AaBBdd, 3 plants with genotype AabbDd, 2 plants with genotype AaBbDD, 2 plants with genotype AaBBDd, 2 plants with genotype aaBbDd, and 1 plant with genotype Aabbdd. Plants with simultaneous editing of all three genomes (A, B, and D) accounted for 78.57% (22 / 28) of the total edited plants. At the TaPsIPK1-A site, in the edited lines obtained using the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 18.77%, deletions of 31-100 bp accounted for 63.77%, and deletions greater than 100 bp accounted for 17.52%. The longest deleted fragment was 295 bp, and some lines were accompanied by insertions of a relatively large fragment of 83 bp. At the TaPsIPK1-B site, in the edited lines obtained using the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 36.06%, deletions of 31-100 bp accounted for 51.02%, and deletions greater than 100 bp accounted for 12.92%. The longest deleted fragment was 157 bp, and some lines were accompanied by insertions of 1-9 bp. At the TaPsIPK1-D site, in the edited lines obtained by the Opt-T5E-Cas12i3-5M strategy, deletions of 1-30 bp accounted for 26.48%, deletions of 31-100 bp accounted for 56.36%, and deletions greater than 100 bp accounted for 17.17%. The longest deleted fragment was 500 bp, and some lines were accompanied by insertions of 1-9 bp. Figure 5 ).

[0140] 2.4.2 Evaluation of the editing efficiency of Opt-T5E-Cas12i3-5M on TaSBEIIa in different wheat varieties

[0141] For the optimized TaSBEIIa editing vector, Zhengmai 1860 and Zhengshi 9170 were used as recipient materials, and wheat immature embryos were transformed using Agrobacterium-mediated transformation. The aim was to further test the universality of the optimized Opt-T5E-Cas12i3-5M wheat gene editing system under different genotype backgrounds. The genetic transformation experiment with Zhengmai 1860 was repeated twice. In the first transformation, 78 wheat immature embryos were transformed, and after wheat plant tissue culture, 10 regenerated seedlings were obtained, including 9 transgenic plants. Further identification showed that 7 of these were edited plants, with an editing efficiency of 77.78%. In the second transformation, 70 wheat immature embryos were transformed, and after wheat plant tissue culture, 5 regenerated plants were obtained, including 4 transgenic plants. Further identification showed that 3 of these were edited plants, with an editing efficiency of 75.00%. The average editing efficiency of the two replicates was 76.39 ± 1.97%. Sequencing and genotyping results showed that there were 4 plants with genotype aabbdd, 4 plants with genotype Aabbdd, 1 plant with genotype AaBbdd, and 1 plant with genotype aaBBDD. Plants with simultaneous editing of all three genomes (A, B, and D) accounted for 90.90% (10 / 11) of the total edited plants. Among the obtained edited lines, deletions of 1-30 bp accounted for 41.10%, deletions of 31-100 bp accounted for 54.24%, and deletions greater than 100 bp accounted for 4.65%, with the longest deleted fragment reaching 379 bp.

[0142] Using Zhengshi 9170 as the recipient material, wheat immature embryos were transformed using Agrobacterium-mediated transformation. The experiment was repeated twice. In the first repeat, 73 wheat immature embryos were transformed, and after wheat plant tissue culture, 11 regenerated plants were obtained, of which 10 were transgenic plants. Further identification showed that 7 of these were edited plants, with an editing efficiency of 70.00%. In the second repeat, 78 wheat immature embryos were transformed, and after wheat plant tissue culture, 5 regenerated plants were obtained, all of which were transgenic plants. Further identification showed that 4 of these were edited plants, with an editing efficiency of 80.00%. The average editing efficiency of the two repeats was 75.00 ± 7.07%. Sequencing and genotyping results showed that there were 2 plants with genotype aabbdd, 2 plants with genotype AaBbDd, 2 plants with genotype AabbDd, 3 plants with genotype aaBbdd, 1 plant with genotype Aabbdd, and 1 plant with genotype AaBbdd. Plants with simultaneous editing of all three genomes (A, B, and D) accounted for 100% of the total edited plants. Among the obtained edited lines, deletions of 1-30 bp accounted for 28.38%, deletions of 31-100 bp accounted for 47.65%, and deletions greater than 100 bp accounted for 23.97%, with the longest deleted fragment reaching 274 bp.

[0143] In summary, by transforming the optimized Opt-T5E-Cas12i3-5M strategy TaSBEIIa editing vector into Zhengmai 1860 and Zhengshi 9170 wheat varieties with different genetic backgrounds, efficient targeted knockout of the TaSBEIIa gene was achieved in both recipient materials. This further confirms the universality of the optimized vector in wheat gene editing and provides important support for the application of the CRISPR / Cas12i3 system in wheat and other important polyploid crops.

[0144] Off-target analysis of 2.5T0 generation edited plants

[0145] Comparison of target sequences with the NCBI database and the CRISPR RGEN Tools website ( http: / / www.rgenome.net / cas-offinder / Potential off-target sites were identified, and specific primers were designed based on these potential off-target sequences for PCR amplification. Sequencing was then performed to determine if any off-target effects occurred. The predicted potential off-target sites are shown in Table 3, and the primers are shown in Table 1.

[0146] For the TaARE1-D target, a total of 72 edited plants were identified. Among them, there were two sites in the predicted OFF-TaARE1-1 potential off-target sequence. At one of these sites, 3 edited plants experienced off-target events, with an off-target rate of 4.17%. No off-target events were detected at the remaining potential off-target sites. For the TaHRC-D target, a total of 35 edited plants were identified. For the TaSBEIIa target, a total of 15 edited plants were identified. For the TaPsIPK1 target, a total of 25 edited plants were identified. No off-target events were detected at any of the potential off-target sites (Table 3).

[0147] Table 3. Off-target analysis of wheat edited plants

[0148]

[0149] Note: The first three letters of "potential off-target sequence" indicate the PAM sequence, bold text indicates mismatched bases, and italic text indicates prominent mismatched bases in the sequence.

[0150] 2.6 Analysis of offspring genetic stability and transgenic status

[0151] To investigate whether mutations generated through the CRISPR / Cas12i3 system could be passed on to the next generation, further genotyping analysis was performed on the T1 generation of TaARE-D, TaHRC-D, and TaSBEIIa edited lines (Table 4). All mutations detected in the T0 generation plants were passed on to the T1 generation, and no new mutations occurred. For homozygous mutations in the T0 generation, the heritability was 100%, and heterozygous mutations in the T0 generation segregated in the T1 generation, conforming to Mendelian inheritance laws (homozygous / heterozygous / wild type = 1:2:1) (Table 4). To determine the presence of plasmid DNA sequences in these mutant systems, primer sets designed for specific amplification of Cas12i3, crRNA cassette, and Bar sequences were used for PCR amplification (Table 1). Transgenic-free plants lacking Cas12i3, crRNA cassette, and Bar were successfully identified from the T1 generation (Table 4).

[0152] Table 4. Analysis of genetic stability and transgenic status in the T1 generation.

[0153]

[0154] Note: a The uppercase letters A, B, and D, and the lowercase letters a, b, and d represent the wild-type and mutant alleles of specific target genes in the A, B, and D subgenomes, respectively.

[0155] b wt, wild type; "d" indicates the absence of nucleotides;

[0156] cAccording to the chi-square test, the segregation of the heterozygous line conforms to Mendel's 1:2:1 ratio. * indicates 0.1 < P < 0.5, and the segregation ratio is close to 1:2:1, ** indicates P > 0.5, and the segregation ratio is very close to 1:2:1;

[0157] d "+" indicates that Cas12i3 / crRNA / Bar can be detected in progeny plants, and "–" indicates that Cas12i3 / crRNA / Bar cannot be detected.

[0158] 3. Conclusion

[0159] On the basis of Cas12i3-5M, a CRISPR / Cas12i3-mediated gene knockout system was preliminarily established in wheat by fusing T5 exonuclease at the N-terminus of Cas12i3-5M, using the TaU3 promoter for initiation, adopting the DR spacing strategy to release crRNA and using hptII as the selection marker; after further optimization of the above system, a high-efficiency gene knockout technical system of Opt-T5E-Cas12i3-5M in wheat was first constructed by using the 35S composite promoter (35S-CmYLCV-U6) for initiation, adopting tRNA-crRNA-HDV spaced crRNA and bar as the selection marker, and comparing Cas12i3, Cas12i3-5M and T5E-Cas12i3-5M. The successful construction of the Opt-T5E-Cas12i3-5M-mediated high-efficiency gene knockout technical system in wheat provides important tools and technical support for realizing functional analysis and gene editing improvement of genes conferring important agronomic traits in wheat and other polyploid crops, rapidly creating new crop germplasm and accelerating the process of molecular breeding.

[0160] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented in a wide range with equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are provided, it should be understood that further improvements can be made to the present invention. In summary, in accordance with the principles of the present invention, the present application intends to cover any alterations, uses or improvements of the present invention, including alterations departing from the scope disclosed in the present application that are carried out using conventional techniques known in the art. The application of the basic features of the present invention can be implemented within the scope of the appended claims below.

[0161] References

[0162] Barrangou R,Marraffini LA.2014.CRISPR-Cas systems:Prokaryotes upgradeto adaptive immunity.Mol Cell,54(2):234-44.

[0163] Clements TP,Tandon B,Lintel HA,McCarty JH,Wagner DS.2017.RICE CRISPR:Rapidly increased cut ends by an exonuclease Cas9 fusion inzebrafish.Genesis.55(8):10.1002 / dvg.23044.

[0164] Duan Z,Liang Y,Sun J,Zheng H,Lin T,Luo P,Wang M,Liu R,Chen Y,Guo S,Jia N,Xie H,Zhou M,Xia M,Zhao K,Wang S,Liu N,Jia Y,Si W,Chen Q,Hong Y,Tian R,Zhu JK.2024.An engineered Cas12i nuclease that is an efficient genome editingtool in animals and plants.Innovation,5(2):100564

[0165] Garforth SJ,Sayers JR.Structure-specific DNA binding by bacteriophageT5 5'-->3'exonuclease.1997.Nucleic Acids Res,25(19):3801-7.

[0166] Huang X,Sun W,Cheng Z,Chen M,Li X,Wang J,Sheng G,Gong W,WangY.Structural basis for two metal-ion catalysis of DNA cleavage byCas12i2.2020.Nat Commun,11(1):5241.

[0167] Jiang Y,Chai Y,Qiao D,Wang J,Xin C,Sun W,Cao Z,Zhang Y,Zhou Y,WangXC,Chen QJ.2022.Optimized prime editing efficiently generates glyphosate-resistant rice plants carrying homozygous TAP-IVS mutation in EPSPS.MolPlant,15(11):1646-1649.

[0168] Jinek M,Chylinski K,Fonfara I,Hauer M,Doudna JA,Charpentier E.2012.Aprogrammable dual-RNA-guided DNA endonuclease in adaptive bacterialimmunity.Science,337(6096):816-21.

[0169] Jiang Y,Chai Y,Lu M,Han X,Lin Q,Zhang Y,Zhang Q,Zhou Y,Wang X,Gao C,Chen Q.Prime editing efficiently generates W542L and S621I double mutationsin two ALS genes in maize.2020.Genome Biol.21(1):257.

[0170] Li S,Zhang C,Li J,Yan L,Wang N,Xia L.2021.Present and futureprospects for wheat improvement through genome editing and advancedtechnologies.Plant Commun,2(4):100211.

[0171] Lu D,Myers AR,George NP,Keck JL.2011.Mechanism of Exonuclease Istimulation by the single-stranded DNA-binding protein.Nucleic Acids Res.39(15):6536-45.

[0172] Lv P,Su F,Chen F,Yan C,Xia D,Sun H,Li S,Duan Z,Ma C,Zhang H,Wang M,Niu X,Zhu JK,Zhang J.2024.Genome editing in rice using CRISPR / Cas12i3.PlantBiotechnol J,22(2):379-385.

[0173] Makarova KS,Wolf YI,Iranzo J,Shmakov SA,Alkhnbashi OS,Brouns SJJ,Charpentier E,Cheng D,Haft DH,Horvath P,Moineau S,Mojica FJM,Scott D,Shah SA,Siksnys V,Terns MP,Venclovas White MF,Yakunin AF,Yan W,Zhang F,Garrett RA,Backofen R,van der Oost J,Barrangou R,Koonin EV.2020.Evolutionaryclassification of CRISPR-Cas systems:a burst of class

[0174] 2 and derived variants.Nat Rev Microbio,18(2):67-83.

[0175] Moyer,R.W.,and Rothe,C.T.1977.Role of the T5 gene D15 nuclease in thegeneration of nicked bacteriophage T5 DNA..J Virol 24,177–193.

[0176] Shevelev,I.V.,Belyakova,N.V.,Kravetskaya,T.P.and Krutyakov,V.M.(2002)The correcting role of autonomous 3'→5'exonucleases contained in mammalianmultienzyme DNA polymerase complexes.Mol Biol+36,857-863.

[0177] Shmakov S,Abudayyeh OO,Makarova KS,Wolf YI,Gootenberg JS,Semenova E,Minakhin L,Joung J,Konermann S,Severinov K,Zhang F,Koonin EV.2015.Discoveryand Functional Characterization of Diverse Class 2 CRISPR-Cas Systems.MolCell,60(3):385-97.Tran,P.T.,Erdeniz,N.,Symington,L.S.and Liskay,R.M.(2004)EXO1-A multi-tasking eukaryotic nuclease.DNA Repair 3,1549-1559.

[0178] WangY,Cheng X,Shan Q,Zhang Y,Liu J,Gao C,Qiu JL.2014.Simultaneousediting of three homoeoalleles in hexaploid bread wheat confers heritableresistance to powdery mildew.

[0179] Nat Biotechno,32:947-951.

[0180] Wang , W. , Tian , B. , Pan , QL , Chen , YY , He , F. , Bai , GH , Akhunova , A. , Trick , HNand Akhunov , E. 2021 19.2428–2

[0181] 2020. Improving FnCas12a Genome Editing by Exonuclease Fusion.CRISPR J.3(6):503-511.

[0182] Yan W,Hunnewell P,Alfonse LE,Carte JM,Keston-Smith E,Sothiselvam S,Garrity AJ,Chong S,Makarova KS,Koonin EV,Cheng DR,Scott DA.

[0183] Zetsche , B. , Gootenberg , Jonathan S. , Abudayyeh , Omar , O. , Slaymaker , Ian M. , Makarova , Kira S. , Essletzbichler , P. , Volz , Sara E. , Joung , J. , van der Oost , J. , Regev , A. , Koonin , Eugene V. et al Zhang,F.(2015)Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System.Cell 163,759-771.

[0184] Zhang H,Li Z,Xiao R,Chang L.2020a.Mechanisms for target recognitionand cleavage by the Cas12i RNA-guided endonuclease.Nat Struct Mol Bio,27(11):1069-1076.

[0185] Zhang H,Kong X,Xue M,Hu J,Wang Z,Wei Y,Li G.,Yang D,Zhang M.,Zhou Yand Yang H.2023.

[0186] An Engineered xCas12i with High Activity,High Specificity and BroadPAM Range.Mol Ther 31,253-253.

[0187] Zhang Q,Yin K,Liu G,Li S,Li M,and Qiu J.2020b.Fusing T5exonucleasewith Cas9 and Cas12a increases the frequency and size of deletion at targetsites.Sci.China Life Sci.63:1918–1927。

Claims

1. Application of products used in wheat gene editing; The product for wheat gene editing contains a T5E-Cas12i3-5M fusion protein or biomaterials related to the T5E-Cas12i3-5M fusion protein and a crRNA expression cassette. The T5E-Cas12i3-5M fusion protein is as follows: A1), A2), or A3). A1) Contains the T5E protein shown in positions 2-291 of SEQ ID No. 6 and the Cas12i3-5M protein shown in positions 346-1393; A2) The protein shown in positions 2-1393 of SEQ ID No. 6; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The biomaterial is any one of B1) to B4) below: B1) The nucleic acid molecule encoding the T5E-Cas12i3-5M fusion protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); The crRNA expression cassette contains a DNA fragment of tRNA shown at positions 1327-1403 of SEQ ID No. 9, a DR sequence of Cas12i3 crRNA shown at positions 1404-1439 or 1417-1439, and a DNA fragment of HDV shown at positions 1448-1515. In the crRNA expression cassette, the promoter is the 35S complex promoter shown in positions 1-1326 of SEQ ID No. 9; the terminator is the tH4 terminator shown in positions 1515-1765 of SEQ ID No.

9.

2. The application according to claim 1, characterized in that: B1) The nucleic acid molecule is any one of the following (b11)-b17): b11) A DNA molecule containing the DNA fragment shown in positions 4-873 of SEQ ID No. 5 and the DNA fragment shown in positions 1036-4179 of SEQ ID No. 5; b12) The DNA molecule shown in positions 4-4179 of SEQ ID No. 5; b13) The DNA molecule shown in positions 1-4179 of SEQ ID No. 5; b14) The DNA molecule shown in positions 1-4311 of SEQ ID No. 5; b15) The DNA molecule shown in SEQ ID No. 5; b16) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and encodes a DNA molecule that encodes the T5E-Cas12i3-5M fusion protein as described in claim 1. b17) hybridizes under stringent conditions with the nucleotide sequence defined by b11) or b12) or b13) and encodes a DNA molecule of the T5E-Cas12i3-5M fusion protein as described in claim 1.

3. The application according to claim 1 or 2, characterized in that: In the expression box described in B2), the promoter is a ubiquitous promoter, and / or the terminator is an E9 terminator.

4. The application according to claim 3, characterized in that: The crRNA expression cassette is shown in SEQ ID No.

9.

5. The application according to claim 3, characterized in that: The product also contains a bar gene expression cassette or an Hpt gene expression cassette.

6. The application according to claim 1 or 2, characterized in that: The product is a recombinant vector containing the expression cassette described in claim 1 or 2 (B2), the crRNA expression cassette described in any one of claims 1-2, and the bar gene expression cassette or the Hpt gene expression cassette.

Images