A method for preparing a mouse smarca4-aid knock-in model

CN119020423BActive Publication Date: 2026-08-18NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411243241.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-05
Publication Date
2026-08-18
Estimated Expiration
2044-09-05

AI Technical Summary

Technical Problem

在其它非植物的真核生物中,存在类似SCF降解途径,但缺乏生长激素的诱导作用

Benefits of technology

[0021]This invention utilizes CRISPR/Cas9-mediated gene editing technology to knock in an AID tag sequence (e.g., the Arabidopsis AXR3 protein-coding sequence) into the mouse SMARCA4 gene and introduce a synonymous mutation, thereby establishing a mouse SMARCA4-AID knock-in model. This mouse SMARCA4-AID knock-in model can stably and efficiently express the SMARCA4 protein fused with the AID tag protein (hereinafter referred to as the SMARCA4-AID fusion protein). Furthermore, the mouse SMARCA4-AID knock-in model of this invention has the advantage of a short operation cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119020423B_ABST
    Figure CN119020423B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method of a mouse SMARCA4-AID knock-in model. An In-Fusion technology is used to construct a Donor vector containing an AID tag sequence; based on a CRISPR / Cas9-mediated gene editing technology, the AID tag sequence is knocked into a mouse genome by microinjecting the Donor vector, Cas9 mRNA and gRNA into a mouse fertilized ovum; the fertilized ovum is transplanted into a surrogate mouse, and a born mouse is identified, and then the mouse is crossed with a wild type mouse, so that a mouse expressing a SMARCA4-AID fusion protein, i.e. the mouse SMARCA4-AID knock-in model, is obtained. The application has the advantages of a short operation period and high efficiency, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to the establishment of a mouse SMARCA4-AID knock-in model based on CRISPR / Cas9-mediated gene editing technology. Specifically, it relates to the preparation method of transgenic mice with the Arabidopsis thaliana (L.) Heynh.) AXR3 gene sequence knocked in. Background Technology

[0002] CRISPR / Cas9-mediated gene editing is a genetic manipulation technique that can modify DNA at the genomic level. The CRISPR / Cas9 gene editing system relies on two key components: the CRISPR-associated Cas protein and small guide RNA (sgRNA). The Cas9 protein is a nuclease that binds to sgRNA. Activation of the Cas9 protein via a 20-nt nucleotide chain within the sgRNA targets the protospacer adjacent motif (PAM) site. The Cas9 protein then cleaves the double-stranded DNA near the PAM site, causing a double-strand break (DSB). This allows the foreign gene to be inserted into the host chromosome through recombination, deletion, duplication, or translocation within the host genome, thus modifying the host genome. Currently, CRISPR / Cas9-mediated gene editing technology can utilize homologous recombination repair to insert foreign functional genes (genes not previously present in the genome or inactivated) into the genome, ultimately achieving expression within the cell. In addition, this technology is used for many other purposes, such as gene knockout, regulation of endogenous gene expression, live cell labeling of chromosomal loci, editing of single-stranded RNA, and high-throughput gene screening.

[0003] Mice, as classic model organisms, are widely used. With the introduction of gene-editing technology, a series of gene-edited mice have been developed and used to study gene function or physiological mechanisms. Microinjection is a biological micromanipulation method that uses a micromanipulator under a dissecting microscope or microscope to inject exogenous substances, cell nuclei, or cells into recipients. This technique is widely used, highly reliable, and effective. The advantage of microinjection is that, in principle, any DNA can be introduced into any type of cell; therefore, it has been successfully used to create gene-edited animals, including mice, fish, rats, rabbits, and many large livestock such as cattle, sheep, and pigs.

[0004] The AID protein degradation system, also known as the plant growth hormone-induced protein degradation system, was first discovered by Nishimura et al. It is a unique system evolved in plants, composed of the plant growth hormone indole-3-acetic acid (IAA), the E3 ubiquitin ligase SCF complex (SKP1-CUL1-F-box), E2 ubiquitin conjugating enzyme, ubiquitin activating enzyme, and proteasome. It relies on the growth hormone and the E3 ubiquitin ligase SCF complex to exert its protein degradation effect. Similar SCF degradation pathways exist in other non-plant eukaryotes, but they lack the induction effect of growth hormone. Therefore, the AID protein degradation system can be transplanted into non-plant cells to form an AID system that rapidly and reversibly degrades target proteins by controlling plant growth hormones. As a novel dynamic protein degradation tool, it has advantages such as simple operation, high efficiency, reversible degradation, and no off-target effects, showing great promise for application. It has already been used in mammalian cells, *Caenorhabditis elegans*, fruit flies, and zebrafish. The most widely used F-box protein in this type of AID system is the TIR1 protein from Arabidopsis thaliana and rice, known as AtTIR1 and OsTIR1, respectively (OsTIR1 works better than AtTIR1 at temperatures above 24°C and is the preferred choice for establishing yeast and mammalian cell models). The widely used small molecule inducers are IAA or their synthetic analogues, such as the synthetic hormones naphthaleneacetic acid (NAA) and K-IAA.

[0005] The SWI / SNF chromatin remodeling complex is a highly conserved, evolutionarily efficient, multi-subunit chromatin structure regulatory complex that utilizes energy provided by ATP. Its primary biological function is to alter and remodel the interactions between histones and DNA in nucleosomes by using energy obtained from the hydrolysis of ATP by its ATPase catalytic subunits (BRM and SMARCA4), thereby influencing the chromatin openness of specific regions of the genome and regulating gene expression. The ATPase catalytic subunit SMARCA4 is a core member of the SWI / SNF protein family, playing a crucial role in all stages of mammalian development. In the mouse genome, the SMARCA4 gene is located on chromosome 9, is 88,150 bp in length, and contains 34 exons and 33 introns. The start codon ATG is located in exon 2, and the stop codon TGA is located in exon 34.

[0006] The AXR3 gene can serve as an AID tag sequence and is used in plant AID protein degradation systems, first discovered in Arabidopsis thaliana. In plants, the binding of the AXR3 protein encoded by the AXR3 gene to the protein being degraded is due to changes in growth hormone concentration, closely related to the external environment and the plant's own development. However, in animals, the protein being degraded cannot bind to the AXR3 protein under external conditions. Therefore, research on the degradation of target proteins using plant growth hormone-induced degradation systems in animals has been achieved through the fusion process of the target protein and the AXR3 protein. In mammals, the efficiency of expressing the fused AXR3 gene and the target protein coding sequence is affected by factors such as the spatiotemporal expression of genes (transcriptional and translational levels) during individual development and morphogenesis. The actual expression of the fusion protein in model animals is limited to a small number of tissue species. Summary of the Invention

[0007] The purpose of this invention is to provide a method for preparing a mouse SMARCA4-AID knock-in model. This method utilizes CRISPR / Cas9 technology and microinjection technology to obtain a mouse model that can stably and efficiently express the SMARCA4-AID fusion protein.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A method for preparing a mouse SMARCA4-AID knock-in model includes the following steps:

[0010] A Donor vector containing a homologous arm and an AID tag sequence was constructed. The homologous arm includes the SMARCA4 gene target site determined by CRISPR / Cas9-mediated gene editing technology and a synonymous mutation sequence set in the target site. gRNA, Cas9 mRNA, and the Donor vector were co-injected into mouse zygotes using microinjection technology to knock the AID tag sequence into the mouse genome. The injected zygotes were cultured in vitro and then transplanted into surrogate mice to continue development until the birth of pups. F0 generation mice with the AID tag sequence knocked into their genome were identified. These F0 generation mice were crossed with wild-type mice, or the offspring from the cross were bred to obtain mice expressing the SMARCA4-AID fusion protein, i.e., the mouse SMARCA4-AID knock-in model.

[0011] Preferably, the AID tag sequence is derived from the coding frame of the Arabidopsis thaliana AXR3 gene.

[0012] Preferably, the knock-in site of the AID tag sequence is located in exon 34 of the SMARCA4 gene on chromosome 9 of the mouse genome (e.g., upstream of the SMARCA4 gene stop codon in exon 34).

[0013] Preferably, the SMARCA4 gene target site is located upstream of the knock-in site of the AID tag sequence.

[0014] Preferably, the synonymous mutation is SMARCA4 gene p.S1612, the pre-mutation sequence (codon for amino acid S before mutation) is AGT, and the post-mutation sequence (codon for amino acid S after mutation) is TCA.

[0015] Preferably, the Donor vector specifically includes a 5' homologous arm, an AXR3 gene sequence, and a 3' homologous arm arranged in sequence. The full length of both homologous arms is 1500-1800 bp, and the full length of the 5' homologous arm (e.g., the full length of the 5' homologous arm is 1700-1800 bp) is greater than that of the 3' homologous arm (e.g., the full length of the 3' homologous arm is 1500-1600 bp).

[0016] Preferably, the construction of the Donor vector specifically includes the following steps: using C57BL / 6J mouse genomic DNA or a plasmid prepared using a homologous sequence of the C57BL / 6J mouse genome as a template, and using Fa / Ra and Fb / Rb as primer pairs, PCR amplification is performed to obtain fragments containing 5' homologous arms and fragments containing 3' homologous arms, respectively. The sequences of primer Fa are shown in SEQ.ID.NO.3, primer Ra in SEQ.ID.NO.4, primer Fb in SEQ.ID.NO.5, and primer Rb in SEQ.ID.NO.6. Using In-Fusion technology, the fragments containing 5' homologous arms, the synthesized AXR3 gene sequence (since this sequence is inserted into the SMARCA4 gene coding frame, no additional start and stop codons need to be added, i.e., it does not contain the start and stop codons of the AXR3 gene coding frame, otherwise it would affect the expression of SMARCA4), and the fragments containing 3' homologous arms are assembled with the vector backbone to form the Donor vector.

[0017] Preferably, the sequence of the Donor vector is shown in SEQ.ID.NO.8.

[0018] Preferably, the mice expressing the SMARCA4-AID fusion protein are F1 generation heterozygous mice with an AID tag sequence knocked into their genome (their parent F0 generation mice can be heterozygous or homozygous mice with an AID tag sequence knocked into their genome).

[0019] Preferably, the tissue in which the SMARCA4-AID fusion protein is expressed includes muscle.

[0020] The beneficial effects of this invention are reflected in:

[0021] This invention utilizes CRISPR / Cas9-mediated gene editing technology to knock in an AID tag sequence (e.g., the Arabidopsis AXR3 protein-coding sequence) into the mouse SMARCA4 gene and introduce a synonymous mutation, thereby establishing a mouse SMARCA4-AID knock-in model. This mouse SMARCA4-AID knock-in model can stably and efficiently express the SMARCA4 protein fused with the AID tag protein (hereinafter referred to as the SMARCA4-AID fusion protein). Furthermore, the mouse SMARCA4-AID knock-in model of this invention has the advantage of a short operation cycle.

[0022] Furthermore, by screening for synonymous mutation sites (referring to synonymous mutations in the codon encoding the 1612th amino acid "S" of the SMARCA4 protein), this invention has obtained model mice capable of expressing the SMARCA4-AID fusion protein in a wider range of tissues (e.g., muscle tissue).

[0023] Furthermore, by extending the length of the homologous arm (e.g., the 5' homologous arm), this invention not only improves the targeting efficiency of the SMARCA4 gene, but also ensures the expression efficiency of the fusion gene after the AID tag sequence is knocked in.

[0024] Furthermore, this invention obtains F1 generation heterozygous mice by breeding positive F0 generation mice with wild-type mice, thereby avoiding gene pollution and the impact on subsequent applications caused by directly using F0 generation mice to obtain model mice through self-pollination. Attached Figure Description

[0025] Figure 1 A schematic diagram illustrating the principle of CRISPR / Cas9-mediated gene editing technology in the preparation of model mice.

[0026] Figure 2 A technical roadmap for preparing model mice.

[0027] Figure 3 The image shows the target carrier (i.e., the Donor carrier).

[0028] Figure 4 This is a diagram of the Donor vector genotyping strategy.

[0029] Figure 5 The image shows an agarose gel electrophoresis result (M is the marker) to verify the enzyme digestion of the Donor vector.

[0030] Figure 6 This is a diagram illustrating the genotyping strategy for F0 mice.

[0031] Figure 7 Agarose gel electrophoresis image of F0 mouse genotyping (M is the marker).

[0032] Figure 8 Western blot diagram for detecting protein levels in model mice (β-Actin as internal reference). Detailed Implementation

[0033] The invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are explanations of the invention and not limitations on the scope of protection of the invention.

[0034] (I) Establishment of C57BL / 6J mouse SMARCA4-AID knock-in model using CRISPR / Cas9-mediated gene editing technology 1. Target site selection and gRNA synthesis

[0035] See Figure 1 We searched for target sites containing PAM (NGG / NGGNG) in exon 34 of the SMARCA4 gene (NM_001174078.1). High-efficiency sites were then selected through screening on the CRISPR Dsign website (http: / / crispr.mit.edu / ), while also screening for synonymous mutations in SMARCA4. Combining the results of these two site screenings, we finally determined the SMARCA4 gene target site (SMARCA4target), and designed forward and reverse primers for gRNA. The primer sequences are shown in Table 1-1.

[0036] Table 1-1. Nucleotide sequences of fitted primers

[0037]

[0038] Note: The bases highlighted in the box are genomic sites where synonymous mutations are proposed.

[0039] The annealing systems for the above-mentioned forward and reverse fitting primers are shown in Table 1-2:

[0040] Table 1-2. Annealing System

[0041]

[0042] After preparing the annealing system according to Table 1-2, anneal the forward and reverse fitting primers to obtain gRNA. The annealing procedure is shown in Table 1-3:

[0043] Table 1-3. Annealing Procedure

[0044]

[0045] 2. Construction of the Donor carrier

[0046] Using high-fidelity Taq DNA polymerase and the BAC(RP23-26K2) plasmid (thermofisher) as a template, fragment-1 (i.e., the fragment containing the 5' homologous arm) and fragment-2 (i.e., the fragment containing the 3' homologous arm) containing homologous sequences from the mouse genome were amplified. The specific sequences of the amplification primers are shown in Table 1-4.

[0047] Table 1-4. Nucleotide sequences of amplification primers

[0048]

[0049]

[0050] Note: Italicized and bolded bases are the corresponding sites after synonymous mutations; underlined parts are bases that do not bind to the template during amplification, and are (or contain) sequences used for seamless cloning.

[0051] The AXR3 gene sequence shown below (i.e., SEQ.ID.NO.7) was synthesized directly:

[0052] 5'-CCTAAAGATCCAGCCAAACCTCCGGCCAAGGCACAAGTTGTGGGATGGCCA CCGGTGAGATCATACCGGAAGAACGTGATGGTTTCCTGCCAAAAATCAAGCGGTGG CCCGGAGGCGGCGGCGTTCGTGAAG-3'

[0053] Using in-fusion technology, the fragments containing 5' homologous arms, the synthesized AXR3 gene sequence, and the fragments containing 3' homologous arms were assembled into the Donor vector. Specifically, the Donor vector backbone was ligated with sequentially arranged 5' homologous arms (including sites of synonymous mutation), the AXR3 gene sequence, and 3' homologous arms. The assembly system is shown in Table 2, and the assembly conditions were: ligation reaction at 50℃ for 15 min.

[0054] Table 2. In-Fusion System

[0055]

[0056] The In-Fusion ligation product was transformed into DH5α competent cells. These competent cells were then added to LB liquid medium and cultured at 37°C with shaking for 30 min. The resulting culture was plated onto LB solid medium containing ampicillin and cultured overnight. After ampicillin resistance (AmpR) selection, single clones growing on the LB solid medium were transferred to LB liquid medium for further culture. Colony PCR was then performed for identification. After confirming successful ligation, the colony was sequenced. Based on the sequencing results, single clones with successful ligation and correct sequences were selected for culture, followed by plasmid extraction to obtain the Donor vector (see...). Figure 3 The sequence of the obtained Donor vector (7693 bp in length) is shown in Table 3. The Donor vector contains the AXR3 gene sequence to be knocked into the mouse genome and fused with the mouse SMARCA4 gene, as well as a 5' homology arm upstream of the AXR3 gene sequence and a 3' homology arm downstream of the AXR3 gene sequence. The synonymous mutation p.S1612=(AGT to TCA) introduced in the 5' homology arm, that is, the codon of the 1612th amino acid "S" of the SMARCA4 protein is changed from AGT to TCA, can prevent the mouse genome after homologous recombination repair and knock-in (Knockin, KI) AXR3 gene sequence from being bound by gRNA and re-cut.

[0057] Table 3. Nucleotide sequence of Donor vector

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065] Note: The start position of the 5' homologous arm is 690 bp in the Donor vector, and the end position is 2407 bp in the Donor vector (i.e., the full length of the 5' homologous arm is 1718 bp, where the boxed bases are introduced synonymous mutations). The start position of the 3' homologous arm is 2540 bp in the Donor vector, and the end position is 4121 bp in the Donor vector (i.e., the full length of the 3' homologous arm is 1582 bp). Exon 34 of the SMARCA4 gene (full length 1295 bp) is located at the end of the 5' homologous arm (i.e., ...). Figure 3 The region where “34Exon-1” is located and the beginning of the 3' homologous arm (i.e. Figure 3 The region containing “34Exon-2”; the 2408 to 2539 bp bases of the Donor vector (shown in italics) are the AXR3 gene sequence to be knocked in; the ori of the Donor vector is a base with an underlined part, and other elements such as selection markers (such as NeoR / KanR, AmpR gene sequences) are located on both sides of it, that is, the Donor vector backbone can be directly synthesized.

[0066] See Figure 4 Based on the Donor vector sequence, the primers designed to identify the homologous arms of the Donor vector and the AXR3 gene sequence by bacterial PCR are shown below:

[0067] 5'KI forward primer (F1), namely SEQ.ID.NO.9: 5'-AGGAAGACCCTAAAGATCCAGC-3'

[0068] 3'arm reverse primer (R1), namely SEQ.ID.NO.10: 5'-AGTTCATTCAGGGCACCGG-3'

[0069] 5'arm forward primer (F2), namely SEQ.ID.NO.11: 5'-TGATCCTCGACTTAGCCAGTC-3'

[0070] 3'KI reverse primer (R2), namely SEQ.ID.NO.12: 5'-ATCACGTTCTTCCGGTATGATCT-3'

[0071] Prepare the PCR system according to Table 4, and then perform the PCR reaction according to the procedure shown in Table 5. The obtained PCR products are a 2.1kb Donor vector fragment (F1 / R1) and a 1.8kb Donor vector fragment (F2 / R2).

[0072] Table 4. Bacterial PCR System

[0073]

[0074] Table 5. Bacterial PCR Procedure

[0075]

[0076]

[0077] Based on the Donor vector sequence, the Sanger sequencing primers designed to identify the homologous arms of the Donor vector and the AXR3 gene sequence by sequencing are shown below:

[0078] 5'Sequence primer (F), namely SEQ.ID.NO.13: 5'-CTTAAGGATCTAGGCCCTTCCAC-3'

[0079] 3' Sequence primer(R), i.e., SEQ.ID.NO.14: 5'-AGTAAGATACAGTACAAGGAGCGG-3'3. Enzyme digestion verification of the Donor vector.

[0080] The Donor vector was digested with AgeⅠ / SacⅠ, DrdⅠ, and FspⅠ respectively for verification, and the size of the digested products was detected by agarose gel electrophoresis.

[0081] 3.1 Plasmid Extraction

[0082] 1) Prepare 2mL clean sterile centrifuge tubes, transfer the bacterial culture (bacterial culture obtained by shaking after verification of the correctness of Donor vector sequencing) into the centrifuge tubes in batches, centrifuge at 8000r / min for 2min, discard the supernatant and collect the bacterial precipitate.

[0083] 2) Add 250 μL of Buffer P1 (add RNase before use and store at 4°C) to the bacterial precipitate, shake thoroughly to completely dissolve the precipitate.

[0084] 3) Add 250 μL of Buffer P2 to the centrifuge tube, immediately and gently invert the centrifuge tube 8 to 10 times, and let it stand at room temperature for 2 to 4 minutes.

[0085] 4) Add 350 μL of Buffer P3 to the centrifuge tube, immediately and gently invert the centrifuge tube 8 to 10 times, and let it stand at room temperature for 2 minutes.

[0086] 5) Centrifuge at 12000 r / min for 10 min.

[0087] 6) Transfer the supernatant to the adsorption column, not exceeding 750 μL each time, centrifuge at 9000 r / min for 30 s, and discard the filtrate.

[0088] 7) Add 500 μL Wash Solution (add anhydrous ethanol before use) to the adsorption column, centrifuge at 9000 r / min for 30 s, and discard the filtrate.

[0089] 8) Repeat step 7.

[0090] 9) Centrifuge the adsorption column at 9000 r / min for 1 min to completely remove anhydrous ethanol.

[0091] 10) Place the adsorption column into a clean, sterile centrifuge tube.

[0092] 11) Add 30 μL of ultrapure water (preheated to 60°C) to the center of the adsorption column and let it stand at room temperature for 2 min.

[0093] 12) Centrifuge at 9000 r / min for 1 min, collect the filtrate, and detect the DNA concentration after it is fully dissolved. Store at -20℃ for later use.

[0094] 3.2 Enzyme digestion

[0095] The enzyme digestion systems were prepared according to Tables 6, 7, and 8, respectively:

[0096] Table 6. AgeⅠ and SacⅠ enzyme digestion system

[0097]

[0098] Table 7. DrdⅠ Enzyme Digestion System

[0099]

[0100] Table 8. FspⅠ enzyme digestion system

[0101]

[0102] The three enzyme digestion systems prepared above were incubated at 37℃ for 30 min, followed by incubation at 65℃ for 20 min. The size of the digested products was then determined by agarose gel electrophoresis. (See also...) Figure 5Lane 1 corresponds to band sizes of 3200bp, 2700bp, 900bp, 600bp, and 400bp, representing the Donor vector after double digestion with AgeI and SacI. Lane 2 corresponds to band sizes of 4300bp, 1900bp, and 1500bp, representing the Donor vector after digestion with DrdI. Lane 3 corresponds to band sizes of 3500bp, 2400bp, 1200bp, 400bp, and 200bp, representing the Donor vector after digestion with FspI.

[0103] 4. Microinjection and embryo transfer

[0104] After superovulation in female C57BL / 6J mice, zygotes were obtained from C57BL / 6J mice via in vitro fertilization. Then, according to... Figure 2 The obtained Donor vector (100 ng / μL), gRNA (50 ng / μL), and Cas9 mRNA (20 ng / μL, Thermofisher) were injected into C57BL / 6J mouse zygotes (collected in June 2022) using a glass microinjection needle with an extremely fine tip (0.1–0.5 μm). The microinjected zygotes were then transferred to the oviducts of surrogate C57BL / 6J mice via embryo transfer. F0 generation mice were obtained after the pups were born.

[0105] The specific procedures for embryo transfer are as follows: After microinjection, the fertilized eggs are cultured in vitro to the morula stage and quality is tested; a small opening is made in the fallopian tube capsule of the surrogate mother mouse, and after the direction of the fallopian tube fimbriae is clearly seen, the transfer tube is inserted into the fallopian tube fimbriae 2-3 mm from the opening, and a well-developed embryo is blown into the enlarged part. After a short pause, the transfer tube is pulled out.

[0106] 5. Genotyping and sequencing of F0 generation mice

[0107] 5.1 DNA Extraction

[0108] 1) Cut off a 2-3 mm tip of the mouse tail and place it in a centrifuge tube pre-filled with 100 μL of lysis buffer.

[0109] 2) Incubate overnight at 55℃.

[0110] 3) Incubate centrifuge tubes at 95°C to inactivate proteinase K.

[0111] 4) Centrifuge at 12000 r / min for 15 min, and collect the supernatant for later use.

[0112] 5.2 PCR amplification

[0113] See Figure 6Primers (e.g., using the aforementioned F / R) were designed to target the AXR3 gene sequence knocked into the mouse genome for mouse genotyping.

[0114] Table 9. PCR System

[0115]

[0116] Table 10. PCR Procedure

[0117]

[0118] Prepare the PCR system according to Table 9, and then perform the PCR reaction according to the procedure shown in Table 10. Perform gel electrophoresis on the amplified products. Results are as follows: Figure 7 As shown, the F0 generation mice were classified into three genotypes based on PCR fragment length: homozygous knock-in (Homozygous, Ho), heterozygous knock-in (Heterozygous, He), and wild-type (Wt). The corresponding PCR fragment lengths for each genotype were: 570 bp band (homozygous knock-in), two bands (570 bp and 438 bp) (heterozygous knock-in), and 438 bp band (wild-type).

[0119] For the F0 generation mice with different genotypes, the expected expression of the SMARCA4-AID fusion protein (specifically, the protein encoded by the knock-in of the AXR3 gene sequence into the SMARCA4 gene) is as follows (refer to Western blot detection): knock-in homozygotes will have one protein band (molecular weight of 193.7 kDa), knock-in heterozygotes will have two protein bands (molecular weights of 193.7 kDa and 189 kDa), and wild-type mice will have one protein band (molecular weight of 189 kDa).

[0120] 5.3 Sequencing

[0121] The 570bp band obtained by PCR amplification was recovered, purified, and sequenced using gel extraction. Based on the sequencing results, mice that have completed accurate knock-in (e.g., the AXR3 gene sequence knocked into the mouse genome is correct) can be screened out, and it can also be ensured that the mice used for subsequent experiments retain the synonymous mutation p.S1612=(AGT to TCA) in the target gene (i.e. SMARCA4 gene).

[0122] 6. Acquisition and identification of model mice

[0123] Sexually mature positive F0 generation mice (specifically, F0 generation homozygous mice with accurate knock-in) were bred with wild-type mice (specifically, C57BL / 6J mice). The resulting F1 generation mice were identified by PCR (using the same primers, PCR system, and PCR reaction procedure as the F0 generation mice), sequencing, and Western blot.

[0124] The Western blot identification involved collecting various tissues from F1 generation mice and detecting the expression of the SMARCA4-AID fusion protein in the corresponding tissues using Western blot experiments. The specific experimental procedure is as follows (taking muscle tissue as an example): First, 200 mg of muscle tissue was placed in RIPA lysis buffer (containing protease inhibitors) and homogenized using a tissue homogenizer. Next, the tissue was lysed on ice for 30 min, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected. 5× protein loading buffer was added to the supernatant, mixed well, and incubated in a metal bath (95°C) for 5 min. Before loading, the protein concentration was detected using a BCA protein detection kit to determine the loading amount. Afterward, the standard operating procedure was followed, namely: preparation of polyacrylamide gel, SDS-PAGE gel electrophoresis, transfer, blocking, antibody (Santa Cruz, sc-10768) incubation, and development.

[0125] The results of Western blot analysis of F1 generation mouse muscle tissue are as follows: Figure 8 As shown in the figure. The results indicate that, unlike wild-type mice, which mainly express SMARCA4 protein in their muscle tissue, F1 generation mice are knock-in heterozygotes. In addition to expressing SMARCA4 protein, their muscle tissue mainly expresses SMARCA4-AID fusion protein (which has a larger molecular weight, a higher band, and a molecular weight as expected compared to SMARCA4 protein).

[0126] The above results demonstrate that the SMARCA4-AID fusion protein was successfully expressed in F1 generation mice, indicating that the mouse SMARCA4-AID knock-in model (model mouse) was successfully established.

[0127] 7. Application of the model mouse

[0128] When offspring of mice crossed with SMARCA4-AID and OsTIR1 knock-in models are fed with SMARCA4-AID and OsTIR1-containing mouse plant growth hormones or their synthetic analogues, SMARCA4 protein is efficiently and reversibly degraded in vivo. This allows for the study of a series of changes resulting from SMARCA4 protein degradation (see the literature "Rapid and specific degradation of endogenous proteins in mouse models using auxin-inducible degrons"). The aforementioned mouse SMARCA4-AID knock-in model provides the possibility for conducting such studies in muscle tissue. In addition to using F1 generation mice as model mice, F2 or F3 generation mice can also be used.

[0129] In summary, this invention utilizes In-Fusion technology to construct a Donor vector. By co-injecting the Donor vector, gRNA, and Cas9 mRNA into mouse zygotes, the AXR3 gene sequence derived from Arabidopsis thaliana is knocked into the mouse genome using CRISPR / Cas9-mediated gene editing technology. This AXR3 sequence serves as the AID tag sequence for fusion expression with the mouse SMARCA4 gene. Through embryo transfer and breeding of the resulting positive F0 generation mice, heterozygous mice capable of stably and efficiently expressing the SMARCA4-AID fusion protein were finally obtained. This provides an important material basis for studying the function of the SMARCA4 protein in mice and has broad application prospects.

Claims

1. A method for preparing a mouse SMARCA4-AID knock-in model, characterized in that: Includes the following steps: Construct a Donor vector containing homologous arms and an AID tag sequence, wherein the homologous arms include those determined using CRISPR / Cas9-mediated gene editing technology. SMARCA4 The gene target site and the synonymous mutation sequence in the target site were set; gRNA, Cas9 mRNA and the Donor vector were co-injected into mouse zygotes using microinjection technology to knock the AID tag sequence into the mouse genome; the injected zygotes were cultured in vitro and then transplanted into surrogate mice to continue developing until the birth of pups, resulting in F0 generation mice with the AID tag sequence knocked into their genome; the F0 generation mice were crossed with wild-type mice, or the offspring of the cross were further bred to obtain mice expressing the SMARCA4-AID fusion protein, i.e., the mouse SMARCA4-AID knock-in model; The knock-in site of the AID tag sequence is located on chromosome 9 of the mouse genome. SMARCA4 Within exon 34 of the gene; The synonymous mutation is SMARCA4 The gene p. S1612 has the sequence AGT before mutation and TCA after mutation; The Donor carrier specifically includes 5' homologous arms arranged in sequence. AXR3 Gene sequence and 3' homologous arm, both of which are 1500-1800 bp in length; according to SMARCA4 The forward and reverse primer sequences for the gRNA obtained from gene target site design are as follows: Forward gRNA: CCGCTCAGGAAGTGGCAGTG; Reverse gRNA: CCTCACTGCCACTTCCTGAG; The sequence of the Donor vector is shown in SEQ.ID.NO.8; The tissues in which the SMARCA4-AID fusion protein is expressed include muscle.

2. The method for preparing a mouse SMARCA4-AID knock-in model according to claim 1, characterized in that: The AID tag sequence was derived from Arabidopsis thaliana. AXR3 Gene coding frame.

3. The method for preparing a mouse SMARCA4-AID knock-in model according to claim 1, characterized in that: The SMARCA4 The gene target site is located upstream of the knock-in site of the AID tag sequence.

4. The method for preparing a mouse SMARCA4-AID knock-in model according to claim 1, characterized in that: The construction of the Donor vector specifically includes the following steps: using C57BL / 6J mouse genomic DNA or a plasmid prepared using homologous sequences from the C57BL / 6J mouse genome as a template, and using Fa / Ra and Fb / Rb as primer pairs, PCR amplification is performed to obtain fragments containing 5' homologous arms and fragments containing 3' homologous arms, respectively. The sequences of primer Fa are shown in SEQ.ID.NO.3, primer Ra in SEQ.ID.NO.4, primer Fb in SEQ.ID.NO.5, and primer Rb in SEQ.ID.NO.

6. Using In-Fusion technology, the fragments containing 5' homologous arms and the synthesized... AXR3 The gene sequence, the fragment containing the 3' homologous arm, and the vector backbone are assembled into the Donor vector.

5. The method for preparing a mouse SMARCA4-AID knock-in model according to claim 1, characterized in that: The mice expressing the SMARCA4-AID fusion protein are F1 generation heterozygous mice with an AID tag sequence knocked into their genome.