Use of a zmrin4 protein in modulating plant yield

Abstract

The application discloses application of ZmRIN4 protein in regulating yield of plants, and belongs to the technical field of biological breeding. The technical problem to be solved by the application is how to regulate yield of plants, for example, how to regulate yield of corn. To solve the technical problem, the application provides a method for regulating yield of plants, which comprises regulating yield of a receptor plant by regulating expression of a gene coding the ZmRIN4 protein or regulating activity or content of the ZmRIN4 protein in the receptor plant, wherein the ZmRIN4 protein is a protein with an amino acid sequence shown as SEQ ID No. 1. The application firstly discloses a mechanism of ZmRIN4 in regulating yield of corn, provides a new genetic resource for corn breeding, and can be applied to corn breeding to realize directional and accurate improvement of high yield and stress resistance of corn through molecular design breeding, so the application has a wide market prospect.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically involving the application of ZmRIN4 protein in regulating maize yield. Background Technology

[0002] Corn is a major food crop and also an excellent feed and industrial raw material. Corn is characterized by its high calorie content, high stalk yield, and the stalks being rich in vitamins. Corn cultivation costs are relatively low, and with the rapid development of animal husbandry, the demand for corn as feed is gradually increasing. In recent years, the whole-plant silage method has been promoted in various regions. When using corn as silage, in addition to pursuing high kernel yield, attention is also paid to the yield of non-kernel parts, and the value of improving the overall biomass of corn in production applications is becoming increasingly significant.

[0003] Biomass (total aboveground dry matter per unit area of ​​maize) and harvest index (the ratio of dry weight of maize kernels at maturity to aboveground biomass) are two important components of grain crop yield. Maize, as China's largest grain crop, plays a crucial role in ensuring national food security. Therefore, understanding the spatial distribution characteristics of maize biomass, harvest index, and yield in my country under current conditions, as well as the contributions of biomass and harvest index to yield, is of significant theoretical guiding importance for identifying key pathways to further increase yield. Studies have found that the contribution rate of increased maize biomass to yield in China is 73.71%, significantly higher than the contribution rate of the harvest index (26.28%).

[0004] For different planting ecoregions, the study found that the contribution rate of biomass in Northwest and Northern China was 57.34% and 64.46%, respectively, significantly higher than the contribution rate of the harvest index (42.66% and 35.54%, respectively). However, in the Huang-Huai-Hai Plain and Southwest China, the contribution rate of the harvest index (52.67% and 50.92%, respectively) was slightly higher than that of biomass (47.33% and 49.08%, respectively). The study indicates that differences in biomass among different regions remain the main cause of differences in maize yield. Furthermore, at lower yield levels (less than 15 mg / ha), the increase in yield was mainly due to the synergistic increase in biomass and harvest index; while at higher yield levels (greater than 15 mg / ha), the increase in yield mainly depended on the increase in biomass. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to regulate plant yield, such as how to regulate corn yield.

[0006] To address this technical problem, in a first aspect, the present invention provides a method for regulating plant yield, the method comprising regulating the yield of the recipient plant by regulating the expression of the gene encoding the ZmRIN4 protein in the recipient plant or by regulating the activity or content of the ZmRIN4 protein, wherein the ZmRIN4 protein is any of the following proteins:

[0007] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1;

[0008] a2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) that has more than 80% identity with the amino acid sequence shown in a1).

[0009] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0010] SEQ ID No.1 consists of 80 amino acid residues.

[0011] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0012] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0013] Furthermore, in the method described, the ZmRIN4 protein is derived from corn.

[0014] Furthermore, in the method, the plant is selected from any of the following:

[0015] C1) Monocotyledons;

[0016] C2) Gramineae plants;

[0017] C3), plants of the genus *Zea*;

[0018] C4), corn (Zea mays L).

[0019] Furthermore, the method includes M1) or M2).

[0020] M1) By downregulating or reducing or inhibiting the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize, the yield of the recipient maize is promoted or increased.

[0021] M2) By upregulating or increasing or promoting the expression of the ZmRIN4 protein encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize, the yield of the recipient maize can be inhibited or reduced.

[0022] To address this technical problem, in a second aspect, the present invention provides a method for preparing high-yield maize, the method comprising obtaining target maize with a yield higher than that of recipient maize by downregulating or reducing or inhibiting the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in recipient maize.

[0023] Furthermore, in the method, downregulating or reducing or inhibiting the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize includes introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding the Cas protein into the recipient maize to downregulate or reduce or inhibit the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient plant.

[0024] Furthermore, in the method, the nucleotide sequence of the ZmRIN4 protein encoding gene is SEQ ID No. 2.

[0025] Furthermore, in the method described, the nucleotide sequence of the ZmRIN4 gene is SEQ ID No. 3.

[0026] Furthermore, in the method, the nucleotide sequence of the target sequence of the gRNA gene is positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0027] Further, in the method described in B1), the nucleotide sequence of the gRNA (gRNA gene) is positions 501-603 of SEQ ID No. 4, where positions 501-520 are the spacer sequence of the sgRNA and positions 521-603 are the backbone sequence of the sgRNA.

[0028] Furthermore, in the method described, the nucleotide sequence of the DNA fragment of the sgRNA expression cassette is SEQ ID No. 4, wherein positions 1-500 of SEQ ID No. 4 are the U6 promoter, and positions 501-603 are the sgRNA gene.

[0029] Furthermore, in the method, the Cas protein may be the Cas9 protein.

[0030] Further, in the method, downregulating or reducing or inhibiting the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize includes any one of the following:

[0031] M1-1) The DNA molecule with the nucleotide sequence SEQ ID No.3 in two homologous chromosomes of the recipient maize is deleted at position 2773, resulting in a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thus achieving the knockout of the target gene;

[0032] M1-2) The nucleotide AA at positions 2773-2774 of the DNA molecule with the nucleotide sequence SEQ ID No.3 in two homologous chromosomes of the recipient maize is deleted, resulting in a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thus achieving the knockout of the target gene;

[0033] M1-3) The AAA nucleotides at positions 2772-2774 of the DNA molecule with the nucleotide sequence SEQ ID No.3 in two homologous chromosomes of the recipient maize are deleted, resulting in a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thus achieving the knockout of the target gene;

[0034] M1-4) The DNA molecule with the nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize is deleted at positions 2776-2796, AAGTTGGTGAATGGGATGTC, resulting in a mutation in the target gene, which in turn prevents the target protein from being expressed normally, thus achieving the knockout of the target gene.

[0035] M1-5) Inserts nucleotide A after position 2773, 2774, or 2775 of the DNA molecule with nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize, causing a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thus achieving the knockout of the target gene.

[0036] To solve this technical problem, in a third aspect, the present invention provides the use of a protein or a substance that regulates gene expression or a substance that regulates the activity or content of said protein in any of the following: said gene encodes said protein, said protein being the ZmRIN4 protein described above.

[0037] A1) Application in regulating plant yield;

[0038] A2) Application in the preparation of products that regulate plant yield;

[0039] A3) Application in regulating plant female ear biomass;

[0040] A4) Application in the preparation of products that regulate the biomass of plant female ears;

[0041] A5) Application in regulating plant seed quantity;

[0042] A6) Application in the preparation of products that regulate the number of plant seeds;

[0043] A7) Application in regulating plant seed size;

[0044] A8) Application in the preparation of products that regulate plant seed size;

[0045] A9) Applications in plant breeding or plant-assisted breeding.

[0046] Furthermore, in the aforementioned application, the purpose of plant breeding is to cultivate high-yielding plants.

[0047] Furthermore, in the aforementioned applications, the high-yielding plants are characterized by: increased female ear biomass per plant and / or increased ear length, row grain number per plant and / or increased grain length and / or width and / or increased grain number per plant.

[0048] Furthermore, in the aforementioned application, the substance regulating gene expression or the substance regulating the activity or content of the protein is a biological material, and the biological material is any one of the following:

[0049] B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the ZmRIN4 protein or inhibit or reduce the activity of the ZmRIN4 protein;

[0050] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0051] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0052] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0053] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0054] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0055] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0056] B8), nucleic acid molecules encoding the ZmRIN4 protein;

[0057] B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0058] Furthermore, in the above applications, B1) nucleic acid molecules can be gRNAs (gRNA genes) that target the gene.

[0059] Furthermore, in the above applications, the nucleotide sequence of the target sequence of the above gRNA is positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0060] Furthermore, in the above applications, the nucleotide sequence of the gRNA (gRNA gene) may be positions 501-603 of SEQ ID No. 4, wherein positions 501-520 are the spacer sequence of the sgRNA, and positions 521-603 are the backbone sequence of the sgRNA.

[0061] Furthermore, in the aforementioned applications, the expression cassette described in B2) refers to DNA capable of expressing sgRNA in host cells. This DNA may include not only a promoter that initiates sgRNA gene transcription but also a terminator that terminates sgRNA gene transcription.

[0062] Furthermore, in the aforementioned application, the nucleotide sequence of the DNA fragment of the expression cassette described in B2) is SEQ ID No. 4, wherein positions 1-500 of SEQ ID No. 4 are the U6 promoter, and positions 501-603 are the sgRNA gene.

[0063] Among the aforementioned biological materials, the recombinant microorganisms mentioned in B4) can specifically be yeast, bacteria, algae, and fungi.

[0064] Among the aforementioned biological materials, the plant tissues described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0065] Among the aforementioned biological materials, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of transgenic plants.

[0066] Among the aforementioned biological materials, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0067] Furthermore, in the above applications, the nucleic acid molecule described in B8) is any one of the following DNA molecules described in g1)-g3):

[0068] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2;

[0069] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0070] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0071] In the aforementioned biological materials, the expression cassette described in B9) refers to DNA capable of expressing the ZmRIN4 protein in host cells. This DNA may include not only a promoter that initiates transcription of the ZmRIN4 protein-encoding gene, but also a terminator that terminates transcription of the ZmRIN4 protein-encoding gene.

[0072] Furthermore, the expression box described in B9 may also include an enhancer subsequence.

[0073] In the aforementioned biological materials, the recombinant vector described in B9) may contain the DNA molecule shown in SEQ ID No. 2 that encodes the ZmRIN4 protein.

[0074] Furthermore, in the aforementioned application, the plant is selected from any of the following:

[0075] C1) Monocotyledons;

[0076] C2) Gramineae plants;

[0077] C3), plants of the genus *Zea*;

[0078] C4), corn (Zea mays L).

[0079] In the above applications, identity refers to the similarity between amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0080] In the above applications, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0081] In this invention, the substance regulating the activity or content of the protein can be a substance that downregulates, reduces, or knocks out the coding gene of the protein and / or a substance that downregulates or reduces the expression of the coding gene of the protein. The regulation of plant yield can be to increase plant yield.

[0082] In this invention, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0083] In this invention, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be achieved by gene knockout or gene silencing.

[0084] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0085] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0086] In the above applications, the substance regulating gene expression can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0087] In one embodiment of the present invention, the recombinant expression vector is pCAMBIA3301-ZmRIN4, the nucleotide sequence of which is SEQ ID No. 4. The gene encoding the ZmRIN4 protein is activated by the Ubi promoter (positions 8428-10414 of SEQ ID No. 4).

[0088] The beneficial technical effects achieved by this invention are as follows:

[0089] 1. Knockout of the ZmRIN4 gene increases the biomass of female ears on the day of silking in maize, leading to increased yield; overexpression of ZmRIN4 reduces the biomass of female ears on the day of silking, and reduces yield-related traits such as ear length, ear diameter, grain length, grain width, and number of grains per ear, which can reduce maize yield. ZmRIN4 plays an important role in the regulation of maize yield.

[0090] 2. This invention reveals for the first time the mechanism of ZmRIN4 in regulating maize yield, explores the application prospects of ZmRIN4 in maize bio-breeding, and provides new gene resources for maize breeding; it can be applied to major maize breeding units and breeding departments of maize seed companies to realize molecular design breeding for targeted and precise improvement of maize drought resistance, and has broad market prospects. Attached Figure Description

[0091] Figure 1 For the target gene localization map;

[0092] Figure 2The spectrum of the vector pCAMBIA3301-ZmRIN4;

[0093] Figure 3 The results of PCR detection of the target gene ZmRIN4 in the T1 generation of transformants are shown. Figure 3 In the diagram, M represents the molecular weight standard, from top to bottom: 1.5kb, 1kb, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp, and 100bp. CK+ represents the amplification product using plasmid DNA as a template; CK- represents the amplification product using the genomic DNA of the transgenic recipient inbred line KN5585 as a template; and 1-20 represent the genomic DNA of ZmRIN4 transgenic maize.

[0094] Figure 4 Sequencing results for knockout homozygous lines;

[0095] Figure 5 ZmRIN4 regulation of maize ear biomass (Xinjiang, 2021);

[0096] Figure 6 ZmRIN4 regulates yield per plant (Xinjiang, 2021);

[0097] Figure 7 ZmRIN4 regulates maize ear biomass (Xinjiang, 2022). Figure 7 The length of the ruler is 5cm;

[0098] Figure 8 ZmRIN4 overexpression for spike-related traits (Hainan, 2022);

[0099] Figure 9 Seed phenotype of ZmRIN4 overexpression (Hainan, 2022);

[0100] Figure 10 The plant height and yield per plant of the EMS mutant rin4 under drought and control conditions were measured. Detailed Implementation

[0101] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0102] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0103] The CRISPR / Cas9 gene editing vector CPB was kindly provided by the research group of Professor Xie Chuanxiao at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is disclosed in the literature "Qi X, et al., Genome Editing Enables Next-Generation HybridSeed Production Technology. Molecular Plant, 2020, 13(9):1262-1269." The public can obtain the above-mentioned biological material from the applicant. The above-mentioned biological material is only used for repeating the experiments of this invention and cannot be used for other purposes.

[0104] In the following embodiments, the maize CO1 is sourced from the National Germplasm Resource Bank (website: http: / / www.cgris.net / ), which is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0105] In the following embodiments, the maize KN5585 is sourced from the National Germplasm Resource Bank (website: http: / / www.cgris.net / ), which is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0106] In the following embodiments, the P-Easy-blunt vector was purchased from Beijing TransGen Biotech Co., Ltd., catalog number: CB101-01;

[0107] Escherichia coli DH5α / EC DH5α was purchased from Beijing Qingke Biotechnology Co., Ltd., product number: TSC01;

[0108] Agrobacterium GV3101 (pSoup) competent cells are sourced from Beijing Bomed Gene Technology Co., Ltd., catalog number: C314-01;

[0109] FastPfu PCR SuperMix was purchased from Beijing TransGen Biotech Co., Ltd., product number: AS221-11;

[0110] In the following embodiments, the pCAMBIA3301 vector was preserved in the applicant's laboratory and disclosed in the literature "Zhang X, et al., Overexpression of a maize BR transcription factor ZmBZR1 in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Science, 2020, 292, 110378." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0111] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0112] Example 1: Gene Mapping

[0113] Following several years of field drought tolerance assessments (2017, 2018, 2020), the female ear biomass of 279 inbred lines under normal irrigation and drought stress was evaluated. One row was for drought treatment (WS), and the other for normal irrigation (WW), with three replicates per row. Drought treatment was based on accumulated temperature (GDD). In the drought-affected area, soil water potential reached 150 cBar 7 days before flowering, and drought stress continued until 14 days after silking, during which time soil water potential was maintained at 150-180 cBar. The control area received normal irrigation. GWAS association revealed a SNP (S6_120040853) associated with the female ear biomass drought tolerance coefficient (WS / WW), located in candidate gene Zm00001eb280910, encoding RPM1-interacting protein 4 (RIN4). The mapping results are shown below. Figure 1 The amino acid sequence of ZmRIN4 is SEQ ID No. 1, its coding sequence is SEQ ID No. 2, and its genomic sequence is SEQ ID No. 3.

[0114] Table 1: Sequences of ZmRIN4 protein and its related genes

[0115]

[0116]

[0117]

[0118] Example 2: Vector Construction and Transformation

[0119] 2.1 Construction of overexpression vectors

[0120] (1) Cloning the target gene

[0121] The reverse-transcribed cDNA was used as a template for cloning the Zm00001eb280910 gene, and PCR amplification was performed using RIN4-FW / RIN4-RV primers. The cloning PCR reaction used... Amplification was performed using FastPfu PCR SuperMix.

[0122] The nucleotide sequence of primer RIN4-FW / RIN4-RV is as follows (5'-3'):

[0123] RIN4-FW: ATGGCGGAGGAATCAGGCC;

[0124] RIN4-RV: TCAGGATTGCGTAGGGCTGG.

[0125] The PCR reaction system is as follows:

[0126] 2.5mM dNTPs 2μL Forward and reverse primers (10 μM) 1 μL each 5×FastPfu Buffer 4μL Fast Pfu DNA polymerase 2μL <![CDATA[ddH2O]]> Add to a total volume of 20 μL

[0127] The PCR reaction procedure is as follows:

[0128] 94℃ for 5 min; 94℃ for 30 s, 62℃ for 30 s, 72℃ for 1 min, 30-35 cycles; 72℃ for 10 min.

[0129] After the amplified products were detected by agarose gel electrophoresis, the target band was cut off, and the total amount of DNA was estimated according to the brightness of the band in the Mark electrophoresis. An appropriate amount of elution buffer was added to make the final DNA concentration suitable for subsequent experiments, and the target fragment was recovered using the Tiangen DNA Recovery Kit.

[0130] (2) Constructing an intermediate carrier

[0131] The intermediate vector was constructed using a 9zf vector with a UBI promoter and homologous recombination. First, the 9zf vector was linearized by EcoRV digestion. The target fragment for homologous recombination was amplified using primers 9zf-RIN4-FW / 9zf-RIN4-RV (prepared in step (1)). Homologous sequences were added to both sides of the vector insertion site at the 5' end of the primers. The target gene was ligated into the 9zf vector using the principle of homologous recombination to construct the intermediate vector 9zf-ZmRIN4-Tnos. Subsequently, E. coli transformation and identification of positive recombinants were performed. First, 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min. Then, the cells were heat-shocked in a 42℃ water bath for 42 s and immediately placed on ice for 2 min. Finally, 500 μL of antibiotic-free liquid LB medium was added, and the cells were cultured at 37℃ with shaking at 200 rpm for 1 h. Centrifuge at 3,000g for 2 min, discard some of the supernatant, and gently pipette the bacterial cells until fully resuspended. Spread the entire bacterial culture onto solid LB agar plates containing ampicillin and incubate overnight at 37°C. Select medium-sized single colonies and incubate in 5 mL of LB liquid medium containing antibiotics at 37°C with shaking at 200 rpm for approximately 10–16 h. Extract plasmids for restriction enzyme digestion, PCR, and sequencing identification. Sequencing results show that the structure of the intermediate vector 9zf-ZmRIN4-Tnos is: replacing the fragment between the two EcoRV restriction enzyme recognition sites of the 9zf vector with the DNA molecule whose nucleotide sequence is SEQ ID No. 2, while keeping the other nucleotide sequences of the 9zf vector unchanged. The correctly sequenced clones were used for subsequent construction of overexpression vectors.

[0132] The nucleotide sequences of primers 9zf-RIN4-FW / 9zf-RIN4-RV are as follows (5'-3'):

[0133] 9zf-RIN4-FW: GTTACTTCTGCAGGAATTCGATATC ATGGCGGAGGAATCAGGC (underlined parts are homologous arms);

[0134] 9zf-RIN4-RV: TAACGAGCTCTAGAAGCTTGATATC TCAGGATTGCGTAGGGCTGG (underscores indicate the homologous arm).

[0135] (3) Construction of overexpression vectors

[0136] The overexpression vector was constructed using pCAMBIA3301 via enzyme ligation. Based on the multiple cloning site on the vector, the pCAMBIA3301 vector and the intermediate vector 9zf-ZmRIN4-Tnos were double-digested with restriction endonucleases BamHI and AflII. The large fragment of pCAMBIA3301 and the small fragment of the intermediate vector 9zf-ZmRIN4-Tnos were recovered, and the two fragments were ligated together using T4 DNA ligase to construct the overexpression vector pCAMBIA3301-ZmRIN4-Tnos.

[0137] Vector linearization enzyme digestion system (20 μL system):

[0138] BamHI / AflII 0.5 μL each 10×CutSmart 2μL Sterilization water replenishment 20μL

[0139] Enzyme digestion conditions: 37℃ water bath digestion (24 hours or more).

[0140] The enzyme digestion products were detected by 1% agarose gel electrophoresis, and the linearized vector was recovered according to the instructions of the Tiangen DNA Recovery Kit. The recombinant reaction system was designed based on the Seamless Assembly Cloning Kit from Sino-American Taihe Biotechnology Co., Ltd., using 20-60 ng of linearized vector and DNA fragments at a molar ratio of 3:1 to the vector.

[0141] The recombination reaction system is as follows (10 μL):

[0142] Linearized carrier 0.5-5μL 2×Seamless Master Mix 5μL

[0143] Conditions for the recombination reaction: 50℃ for 15 min.

[0144] Following this, *E. coli* transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of *Trans1-T1* competent *E. coli* cells thawed on ice, gently mixed, and incubated on ice for 30 min; followed by heat shock at 42°C for 42 s; immediately placed on ice for 2 min; 500 μL of antibiotic-free liquid LB medium was added, and the cells were incubated at 37°C with shaking at 200 rpm for 1 h; centrifuged at 3,000 g for 2 min, discarding some of the supernatant, and the cells were gently resuspended by pipetting. All bacterial culture was spread onto solid LB agar plates containing kanamycin and incubated overnight at 37°C; medium-sized single colonies were picked and incubated in 5 mL of antibiotic-containing LB liquid medium at 37°C with shaking at 200 rpm for approximately 10-16 h; plasmids were extracted for enzyme digestion, PCR, and sequencing identification. Clones with correct sequencing were used for subsequent genetic transformation. Figure 2The image shows the overexpression vector pCAMBIA3301-ZmRIN4 of the ZmRIN4 gene, which is 10.749 kb in size. The ZmRIN4 gene is derived from maize, driven by the Ubi promoter, and terminated by the Agrobacterium tumefaciens NOS terminator. The bar gene is driven by the CaMV 35S promoter and terminated by the CaMV 35S terminator.

[0145] 2.2 Construction of CRISPR-Cas9 vector

[0146] (1) Design of sgRNA

[0147] Using the sgRNA design website: http: / / www.rgenome.net / cas-designer / , we designed the sgRNA for the Zm00001eb280910 gene. The final nucleotide sequence of the target sgRNA obtained through screening is as follows:

[0148] sgRNA: GGCCGTCCCTTGCCAAAGTT TGG (The underlined part is the PAM sequence, and the rest are the target sequences. The target sequences are positions 16-35 of SEQ ID No. 2 and positions 2759-2778 of SEQ ID No. 3).

[0149] (2) Amplification of the U6 promoter

[0150] The U6 promoter (nucleotide sequence is SEQ ID No. 4, positions 1-500) was amplified using a plasmid containing the U6 promoter as a template, and the amplification primers were MU61-3F / MU61-1R.

[0151] The PCR reaction system is as follows:

[0152] 2.5mM dNTPs 2μL Primers (10μM) each 1μL 5×FastPfu Buffer 4μL FastPfu DNA polymerase 2μL Total 20μL

[0153] The nucleotide sequences of primers MU61-3F / MU61-1R are as follows (5'-3'):

[0154] MU61-3F: TGCACTGCACAA

[0155] MU61-1R: AATTCGGTGCTTGCGGCTC

[0156] The PCR reaction procedure is as follows:

[0157] 94℃5min; 94℃30s, 60℃20s, 72℃1min, 30-35cycles; 72℃10min.

[0158] (3) Fusion of U6 and sgRNA

[0159] Using the PCR product and synthesized sgRNA from the previous step as templates, U6 and sgRNA were fused together by overlap PCR using primers MUsgR-1F / MUsgR-2R to obtain a DNA fragment containing the sgRNA expression cassette. The PCR system and procedure are the same as in step (2).

[0160] The nucleotide sequence of primer MU61-3F / MUsgR-2R is as follows (5'-3'):

[0161] MUsgR-1F:GAGCCGCAAGCACCGAATTGGCCGTCCCTTGCCAAAGTT;

[0162] MUsgR-2R: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG;

[0163] The nucleotide sequence of the DNA fragment of the sgRNA expression cassette is SEQ ID No. 4, where positions 1-500 of SEQ ID No. 4 are the U6 promoter, positions 501-603 are the sgRNA gene, positions 501-520 are the sgRNA spacer sequence, and positions 521-603 are the sgRNA backbone sequence.

[0164] (4) Finally, using the principle of homologous recombination, the DNA fragment containing the sgRNA expression cassette was fused into the CRISPR-cas9 vector to construct the CRISPR-ZmRIN4 vector. Then, ligation transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min; heat-shocked at 42℃ for 42 s; immediately placed on ice for 2 min; 500 μL of antibiotic-free liquid LB medium was added, and cultured at 37℃ and 200 rpm for 1 h with shaking; centrifuged at 3,000 g for 2 min, discarded part of the supernatant, and the cells were gently resuspended by pipetting. All the bacterial culture was spread onto solid LB medium plates containing kanamycin and cultured overnight at 37℃; medium-sized single colonies were picked and cultured in 5 mL of antibiotic-free LB liquid medium at 37℃ and 200 rpm for about 10-16 h with shaking; plasmids were extracted for enzyme digestion identification, PCR identification, and sequencing identification. Correctly sequenced clones are used for subsequent genetic transformation.

[0165] Example 3: Construction and detection of overexpression plants

[0166] 3.1 Construction of overexpression plants

[0167] The genetic transformation of maize was entrusted to the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd., with the maize inbred line KN5585 serving as the overexpression recipient. Transgenic T0 seedlings were screened for herbicide resistance and identified as positive transgenic plants by PCR. After continuous self-pollination and genotyping, homozygous transgenic T3 (OE-1, OE-2, OE-3, OE-4, OE-6) were obtained for phenotypic determination.

[0168] The preparation method of T0 transgenic maize is as follows:

[0169] 1. Callus preparation

[0170] This type of embryogenic callus is characterized by rapid growth, soft texture, loose and brittle structure, and bright color. It can be subcultured for extended periods and retain its embryogenic capacity for a considerable time.

[0171] 2. Preparation of Agrobacterium

[0172] 1) Two days before infection, streak Agrobacterium on LB medium and incubate in the dark at 28°C, or pick single clones and shake them in liquid LB medium.

[0173] 2) Collect the bacterial cells and transfer them to a 50mL centrifuge tube. Resuspend the bacterial cells in the infection medium to make the concentration of the infection solution between OD=0.8 and 1.5.

[0174] 3) Activate Agrobacterium by shaking the prepared infection solution on a shaker at 28°C and 200 rpm for 2 hours for infection.

[0175] 3. Infection

[0176] 1) Select pretreated callus tissue and transfer it to an infection culture medium;

[0177] 2) Soak the callus tissue in the invasion staining solution for 10-30 minutes, break up the callus tissue clumps, and shake well to ensure that the callus tissue is fully in contact with Agrobacterium.

[0178] 3) Aspirate the remaining infection solution and transfer the infected callus tissue into a co-culture medium. Incubate in the dark at 19°C for 3 days.

[0179] 4. Restore culture

[0180] Rinse the callus surface 3-5 times with sterile water containing antibiotics. Once the water is no longer cloudy, discard the liquid and transfer the callus to a Petri dish lined with filter paper. Dry the callus surface in a laminar flow hood. Transfer to recovery medium and incubate in the dark at 28°C for 7-10 days. Then transfer to selection medium.

[0181] 5. Filtering

[0182] 1) After recovery culture, the transformed callus tissue was transferred into selection medium supplemented with antibiotics and cultured in the dark at 28°C for 20-30 days;

[0183] 2) Transfer the callus tissue into a sterile petri dish, break it up, and then press it thin.

[0184] 3) Pick out the brighter callus particles on the UV operating table, clump 3-5 particles together, and transfer them into a new selection medium;

[0185] 4) Incubate in the dark at 28℃ for 20 days, then transfer to a new screening medium for subculture and propagation;

[0186] 5) After two more cycles (40 days), the callus tissue is picked again (without breaking it up).

[0187] 6. Differentiation

[0188] 1) After heat shock, the callus tissue was transferred to predifferentiation medium and cultured in the dark at 28°C for 10 days, then transferred to light at 28°C for 10 days.

[0189] 2) Transfer to differentiation medium, and when the regenerated shoots grow to 3-5cm, transfer to rooting medium;

[0190] 3) After the seedlings have developed a large number of strong roots, harden them off and transplant them.

[0191] 8. Hardening off seedlings and transplanting

[0192] 1) After rooting, remove the sealing film from the rooting bottle and harden the seedlings in the culture medium for 2-3 days;

[0193] 2) Wash the roots of the culture medium and transplant them into sterilized nutrient soil. Harden the seedlings indoors for 7 days.

[0194] 3) Transplanting into greenhouses or open fields yielded T0 generation transformants. Self-pollination of T0 generation transformants yielded T1 generation transformants, self-pollination of T1 generation transformants yielded T2 generation transformants, and self-pollination of T2 generation transformants yielded T3 generation transformants. Genotyping identified five homozygous T3 generation transformants: OE-1, OE-2, OE-3, OE-4, and OE-6.

[0195] 3.2 PCR detection of the target gene ZmRIN4

[0196] 3.2.1 Method

[0197] The PCR primers Ubi-Fw / Tnos-Rv were designed based on the gene sequence, with an expected amplification fragment size of 445 bp.

[0198] The nucleotide sequence of primer Ubi-Fw / Tnos-Rv is as follows (5'-3'):

[0199] Ubi-Fw: AGCCCTGCCTTCATACGCTA;

[0200] Tnos-Rv: AATCATCGCAAGACCGGCAA;

[0201] Genomic DNA was extracted and amplified according to the following PCR parameters:

[0202] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primers, 1.5 U Taq enzyme.

[0203] The reaction procedure is as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 45 sec, for a total of 35 cycles; extension at 72℃ for 5 min.

[0204] 3.2.2 Results

[0205] PCR detection was performed on the transformant plants, and the results are as follows: Figure 3 As shown, the size of the target gene amplification fragment in the T1 generation of the transformant is consistent with the size of the amplification fragment in the positive plasmid control PCR, which is approximately 445 bp. Figure 3 The results showed that the ZmRIN4 gene overexpression cassette has been integrated into the maize genome.

[0206] Example 4: Preparation and Genotyping of Gene Knockout Homozygous Lines

[0207] The constructed CRISPR-ZmRIN4 vector was handed over to the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd. for genetic transformation to obtain T0 generation knockout lines. The recipient line was maize inbred line C01. The preparation method of gene knockout homozygous lines was the same as in Example 3, except that the overexpression plasmid was replaced with a knockout plasmid and the recipient maize was replaced with maize inbred line C01. CRISPR / Cas9 gene-edited lines were self-crossed to screen for homozygous lines, and sequencing was used to determine the editing site and type. T0 generation knockout lines were self-crossed to obtain T1 generation, and continuous self-crossing was used to obtain T3 generation gene knockout homozygous lines. Sequencing identified a total of 5 homozygous mutants: KO-1, KO-2, KO-3, KO-21, and KO+1.

[0208] 4.1 Methods

[0209] PCR primers RIN4-Crispr-F / RIN4-Crispr-R were designed based on the gene sequence, with an expected amplification fragment size of 663 bp.

[0210] The nucleotide sequences of primers RIN4-Crispr-F / RIN4-Crispr-R are as follows (5'-3'):

[0211] RIN4-Crispr-F: ATCTGCTTGCAGAAGCCTGT

[0212] RIN4-Crispr-R:GCTGGCTGTCACACAACAAA

[0213] Genomic DNA was extracted and amplified according to the following PCR parameters:

[0214] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primer, 1.5 U Taq enzyme.

[0215] The reaction procedure is as follows:

[0216] Denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 45 sec, for a total of 35 cycles; extension at 72℃ for 5 min.

[0217] 4.2 Results

[0218] Sanger sequencing identified homozygous gene knockout lines, yielding five homozygous mutants: KO-1, KO-2, KO-3, KO-21, and KO+1. Sequencing results of the homozygous knockout lines are shown below. Figure 4 The mutations in the homozygous mutants KO-1, KO-2, KO-3, KO-21, and KO+1 are as follows:

[0219] Homozygous mutant KO-1: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-1 undergoes the following changes: nucleotide A at position 2773 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0220] Homozygous mutant KO-2: Compared with wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-2 has the following changes: nucleotide AA is deleted at positions 2773-2774 of SEQ ID No.3, resulting in a frameshift mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0221] Homozygous mutant KO-3: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-3 undergoes the following changes: nucleotide A at positions 2772-2774 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0222] Homozygous mutant KO-21: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-21 undergoes the following changes: nucleotides AAGTTGGTGAATGGGATGTC at positions 2776-2796 of SEQ ID No.3 are deleted, resulting in a mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0223] Homozygous mutant KO+1: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO+1 undergoes the following changes: nucleotide A is inserted after position 2773, 2774, or 2775 of SEQ ID No. 3, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0224] Example 5: ZmRIN4 regulation of maize ear biomass and yield

[0225] Wild-type maize inbred line KN5585, overexpression homozygous transgenic T3 generation (OE-1, OE-2, OE-3, OE-4, OE-6) prepared in Example 3, wild-type maize inbred line C01, and T3 generation gene knockout homozygous lines (KO-1, KO-2, KO-3, KO-21, and KO+1) prepared in Example 4 were used to determine maize ear biomass and yield.

[0226] Measurement method:

[0227] Female ear biomass: The weight of maize female ears collected when the silks emerged from the husks (on the day of silking), after removing the husks and drying to constant weight. The female ear biomass of the middle 5-8 plants in each row was measured, recorded, and statistically analyzed. Statistical analysis of conventional phenotypic data was performed using the Student's t-test method in Excel (Excel 2013, Microsoft) (P<0.05).

[0228] Drought stress during flowering was investigated at the Anningqu Experimental Station of the Xinjiang Academy of Agricultural Sciences. Drought treatment (drought-prone area) was based on accumulated temperature (GDD): soil water potential reached 150 cBar 7 days before flowering, and drought stress continued until 14 days after silking, during which time soil water potential was maintained at 150-180 cBar. The control area received normal irrigation, with soil water potential ranging from 30-80 cBar. Under both drought stress (WS) and normal irrigation (WW) conditions, agronomic traits such as plant height, silking date, and pollen shedding date were investigated. Non-transgenic lines were used as controls to compare differences in drought tolerance. Field drought tolerance assessments were conducted in Xinjiang (summer of 2021 and 2022), investigating female ear biomass and yield on the day of silking under normal irrigation and drought conditions during flowering. Yield-related traits under normal irrigation conditions were investigated in Hainan in the winter of 2022.

[0229] 5.1 Experimental Design and Results in Xinjiang, 2021

[0230] Two water conditions were set up: normal irrigation (WW) and flowering drought stress (WS). The female ear biomass and yield per plant were measured under the two water conditions. Wild-type maize inbred line KN5585, the overexpression homozygous transgenic T3 generation (OE-3 and OE-4) prepared in Example 3, wild-type maize inbred line C01, and the T3 generation gene knockout homozygous lines (KO-3 and KO-21) prepared in Example 4 were planted in three replicates, with 2 rows and 12 plants per row.

[0231] 5.1.1 Female ear biomass

[0232] The results showed that under normal conditions (WW), the female ear biomass of a single ZmRIN4 overexpressing plant (OE-3 and OE-4 prepared in Example 3) was 3.90 g-4.38 g, which was 6.6%-16.8% lower than that of the control KN5585 (4.69 g); the female ear biomass of a single gene-edited plant (KO-3 and KO-21 prepared in Example 4) was 6.78 g-7.48 g, which was 42.4%-57.1% higher than that of the control CO1 (4.76 g). Under drought stress during flowering (WS), the female ear biomass of ZmRIN4 overexpressing plants (OE-3 and OE-4 prepared in Example 3) was 2.09 g-2.29 g, which was 5.0%-13.3% lower than that of the control KN5585 (2.41 g); the female ear biomass of gene-edited plants (KO-3 and KO-21 prepared in Example 4) was 4.12 g-7.32 g, which was 35.8%-94.3% higher than that of the control CO1 (3.73 g). Figure 5 ).

[0233] 5.1.2 Yield per plant (Drought stress was severe in 2021, resulting in extremely low yields in drought-stricken areas and a large number of empty stalks)

[0234] Under normal conditions (WW), the yield of ZmRIN4 overexpressing plants (OE-3 and OE-4 prepared in Example 3) was 41.60g-58.33g, which was 18%-40% lower than the control KN5585 (70.77g); the yield of gene-edited plants (KO-3, KO-1, KO+1 prepared in Example 4) was 25.88g-30.06g, which was 57%-83% higher than the control CO1 (16.45g). Under severe drought stress (WS), the yield of ZmRIN4 overexpressing plants (OE-3 and OE-4 prepared in Example 3) was 14%-96% lower than the control KN5585, while the yield of gene-edited plants (KO-3, KO-1, KO+1 prepared in Example 4) was >100% higher than the control CO1. Figure 6 ).

[0235] 5.2 Field Experiment Design and Results in 2022

[0236] Based on the 2021 (Xinjiang) identification, outstanding events were selected, and the investigated traits were further refined and the planting scale was expanded. Two water conditions were set up: normal irrigation (WW) and flowering drought stress (WS). Wild-type maize inbred line KN5585, the overexpression homozygous transgenic T3 generation (OE-3 and OE-6) prepared in Example 3, wild-type maize inbred line C01, and the T3 generation gene knockout homozygous lines (KO-2 and KO-21) prepared in Example 4 were planted in three replicates, in four-row sections, with 15 plants per row.

[0237] The results showed that under normal conditions, the female ear biomass of ZmRIN4 overexpressing plants (OE-3 and OE-6 prepared in Example 3) was 2.52 g-2.61 g, which was 1.1%-4.6% lower than that of the control KN5585 (2.64 g); the female ear biomass of gene-edited plants (KO-2 and KO-21 prepared in Example 4) was 4.92 g-5.35 g, which was 64.0%-78.4% higher than that of the control CO1 (3.00 g). Under drought stress during the flowering period, the female ear biomass of ZmRIN4 overexpressing plants (OE-3 and OE-6 prepared in Example 3) was 2.25 g-2.27 g, which was 2.8%-3.9% lower than that of the control KN5585 (2.34 g). The female ear biomass of gene-edited plants (KO-2 and KO-21 prepared in Example 4) was 3.35 g-4.80 g, which was 35.8%-94.3% higher than that of the wild-type control CO1 (2.47 g). Figure 7 , Figure 7 The length of the ruler is 5cm.

[0238] 5.3 Design and Results of the 2022 Hainan Field Experiment

[0239] Under normal irrigation conditions, ear-related traits such as number of rows per ear, number of kernels per row, ear length, ear diameter, and tip barrenness length were measured after harvest, as well as yield-related traits such as kernel length, kernel width, and number of kernels per ear. Wild-type maize inbred line KN5585 (also known as NT) and the overexpression homozygous transgenic T3 generation (OE-3 and OE-6) prepared in Example 3 were planted in 4 rows, with 12 plants per row.

[0240] The results showed that under normal conditions, the number of panicle rows in ZmRIN4 overexpressing plants (OE-3 and OE-6 prepared in Example 3) was 13-14, a decrease of 17.3%-21.3% compared to the control (NT, 17); the number of grains per row was 8-12, a decrease of 12.8%-40.8% compared to the control (NT, 14); the panicle length was 10.9cm-11.5cm, a decrease of 4.1%-9.1% compared to the control (NT, 12.0cm); the panicle diameter was 4.6cm-4.9cm, a decrease of 9.0%-13.8% compared to the control (NT, 5.4cm); and the length of the barren tip was 3.5cm-5.0cm, an increase of 0.4%-43.0% compared to the control (NT, 3.5cm). Figure 8 ).

[0241] The total number of grains per spike in ZmRIN4 overexpressing plants (OE-3 and OE-6 prepared in Example 3) was 112-174, a decrease of 23.5%-50.8% compared to the control (NT, 228); grain length was 0.91cm-1.35cm, a decrease of 17.4%-44.4% compared to the control (NT, 1.64cm); and grain width was 0.81cm-1.05cm, a decrease of 16.8%-36.2% compared to the control (NT, 1.27cm). Figure 9 ).

[0242] Example 6: EMS mutant

[0243] To validate the function of candidate genes, we ordered an EMS mutant of the ZmRIN4 gene from an EMS mutant library (http: / / www.elabcaas.cn / memd / index.php) based on the maize B73 inbred line background, and repeatedly backcrossed B73 to purify the background. In the summer of 2021, we assessed the drought tolerance of the mutant rin4, setting up two water conditions: normal irrigation (WW) and flowering drought stress (WS), and measured the ear biomass and yield per plant under both conditions. The mutant rin4 and wild-type B73 were planted in three replicates, in two-row plots with 12 plants per row.

[0244] The results showed that the mutant rin4 yielded higher per plant than the wild-type control under both normal irrigation (WW) and flowering drought stress (WS) conditions. Under normal conditions, the yield per plant was 58.05 g, which was 45.9% higher than the control. Under severe drought stress, the yield per plant of mutant rin4 was 15.0% higher than the control. This result is consistent with the performance of CRISPR / Cas9 gene knockout plants. Figure 10 ).

[0245] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for increasing maize ear biomass and yield per plant, characterized in that: The recipient maize contains a gene encoding the ZmRIN4 protein. The method involves knocking out the gene encoding the ZmRIN4 protein in the recipient maize to increase the female ear biomass and yield per plant. The ZmRIN4 protein is a protein with the amino acid sequence shown in SEQ ID No.

1.

2. The method according to claim 1, characterized in that: The step of knocking out the gene encoding the ZmRIN4 protein in the recipient maize includes introducing a gRNA gene targeting the gene encoding the ZmRIN4 protein and a gene encoding the Cas protein into the recipient maize to achieve the step of knocking out the gene encoding the ZmRIN4 protein in the recipient maize.

3. The method according to claim 2, characterized in that: The nucleotide sequence of the target sequence of the gRNA gene is positions 2759-2778 of SEQ ID No.

3.

4. The method according to claim 1, characterized in that: The gene encoding the ZmRIN4 protein in the recipient maize that is knocked out is any one of the following: M1-1) The DNA molecule with the nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize is deleted at position 2773, resulting in a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thereby achieving the knockout of the target gene; M1-2) The nucleotide AA at positions 2773-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No.3 in the two homologous chromosomes of the recipient maize is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-3) The CAA nucleotides at positions 2772-2774 of the DNA molecule with the nucleotide sequence SEQ ID No.3 in the two homologous chromosomes of the recipient maize are deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-4) The DNA molecule with nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize is deleted at positions 2774-2794, resulting in a mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-5) The nucleotide sequence of the DNA molecule of SEQ ID No. 3 in the two homologous chromosomes of the recipient maize is inserted after the 2773rd, 2774th or 2775th position, resulting in a frameshift mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene.

5. A method for preparing maize with increased yield per plant, characterized in that: The recipient maize contains the gene encoding the ZmRIN4 protein as described in claim 1. The method is to obtain a target maize with increased yield per plant by knocking out the gene encoding the ZmRIN4 protein in the recipient maize. The yield per plant of the target maize is higher than that of the recipient maize.

6. The method according to claim 5, characterized in that: The step of knocking out the gene encoding the ZmRIN4 protein in the recipient maize includes introducing a gRNA gene targeting the gene encoding the ZmRIN4 protein and a gene encoding the Cas protein into the recipient maize to achieve the step of knocking out the gene encoding the ZmRIN4 protein in the recipient maize.

7. The method according to claim 6, characterized in that: The nucleotide sequence of the target sequence of the gRNA gene is positions 2759-2778 of SEQ ID No.

3.

8. The method according to claim 5, characterized in that: The gene encoding the ZmRIN4 protein in the recipient maize that is knocked out is any one of the following: M1-1) The DNA molecule with the nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize is deleted at position 2773, resulting in a frameshift mutation in the target gene, which in turn prevents the target protein from being expressed normally, thereby achieving the knockout of the target gene; M1-2) The nucleotide AA at positions 2773-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No.3 in the two homologous chromosomes of the recipient maize is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-3) The CAA nucleotides at positions 2772-2774 of the DNA molecule with the nucleotide sequence SEQ ID No.3 in the two homologous chromosomes of the recipient maize are deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-4) The DNA molecule with nucleotide sequence SEQ ID No. 3 in two homologous chromosomes of the recipient maize is deleted at positions 2774-2794, resulting in a mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene; M1-5) The nucleotide sequence of the DNA molecule of SEQ ID No. 3 in the two homologous chromosomes of the recipient maize is inserted after the 2773rd, 2774th or 2775th position, resulting in a frameshift mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thereby achieving the knockout of the target gene.

9. Use of biological material containing the gene encoding the ZmRIN4 protein of claim 1, which has been knocked out from the recipient maize, in any of the following: A1) Application in increasing the yield per maize plant; A2) Its application in the preparation of products that increase the yield per maize plant; A3) Application in breeding programs to increase yield per maize plant; in, The biomaterial is any one of the following: B1) Nucleic acid molecules that transcribe the gRNA of the gene encoding the ZmRIN4 protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

Images