Method for constructing a transgenic anglo-norwegian ferret model

Abstract

The application discloses a method for constructing a transgenic Anglia mink model. According to an embodiment of the application, the method comprises: introducing sgRNA into an Anglia mink fertilized egg, so as to obtain a transgenic mink model, wherein the sgRNA is suitable for targeting a pre-intervention gene. According to the method of the embodiment of the application, a transgenic Anglia mink model can be efficiently constructed, including a gene knock-in, a gene knock-out and a humanized mink model.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for constructing a transgenic Angora ferret model. Further, this invention relates to a transgenic Angora ferret model and sgRNA. Background Technology

[0002] In the field of biomedical research, ferrets, as higher mammals, have gradually become important experimental animal models due to their anatomical structure, metabolic pathways, and physiological characteristics similar to human organs, as well as their sensitivity to various human pathogens. In recent years, ferret models have demonstrated their unique value in multiple research areas, including brain development, neurological function, spinal cord injury, epilepsy, heart disease, immune system function, obesity, oncology, and research on various lung diseases, including chronic obstructive pulmonary disease, pulmonary cysts, pulmonary fibrosis, and lung cancer. Furthermore, ferret models have also played a crucial role in infectious disease research.

[0003] With the rapid development of gene editing technology, especially the CRISPR / Cas9 system, the efficiency and accuracy of genome editing have been significantly improved, providing new advantages for the application of ferret models. However, existing methods for gene knock-in ferret models are complex and inefficient.

[0004] Therefore, there is an urgent need to develop a new, efficient, and precise method for preparing transgenic knock-in ferret models to improve the efficiency and accuracy of gene knock-in. Summary of the Invention

[0005] This invention aims to at least partially address one of the technical problems existing in the prior art. To this end, this invention provides a method for constructing a transgenic Angolan ferret model.

[0006] This invention is based on the following discoveries of the inventors:

[0007] Existing technologies primarily rely on non-homologous recombination based on CRISPR / Cas9 to obtain transgenic Angora ferret models. This technique is complex, inefficient, and difficult to precisely knock in. To overcome these issues, the inventors have developed a highly efficient and precise method for preparing transgenic knock-in Angora ferret models, and have successfully prepared multiple strains of transgenic knock-in Angora ferrets.

[0008] In a first aspect, the present invention provides a method for constructing a transgenic Angora ferret model. According to an embodiment of the invention, the method includes: introducing sgRNA into Angora ferret zygotes to obtain a transgenic ferret model, wherein the sgRNA is suitable for targeting a pre-intervention gene. The method according to an embodiment of the invention can efficiently construct transgenic Angora ferret models, including gene knock-in, gene knockout, and humanized ferret models.

[0009] According to an embodiment of the present invention, prior to the importation, the process further includes: centrifuging the ferret fertilized eggs.

[0010] According to an embodiment of the present invention, the centrifugation speed is 7800g to 8000g.

[0011] According to an embodiment of the present invention, the centrifugation time is 6 to 8 minutes.

[0012] According to an embodiment of the present invention, the centrifugation speed is 7850g to 7950g.

[0013] According to an embodiment of the present invention, the centrifugation time is 6.5 minutes to 7.5 minutes.

[0014] According to an embodiment of the present invention, the introduction of sgRNA into Angora ferret zygotes is performed by at least one of the following methods: nuclear microinjection and cytoplasmic microinjection.

[0015] According to an embodiment of the present invention, after centrifugation, the fertilized egg displaying the nucleus region is subjected to nuclear microinjection.

[0016] According to an embodiment of the present invention, after centrifugation, the fertilized egg that does not show a nucleus region is subjected to cytoplasmic microinjection.

[0017] According to an embodiment of the present invention, the cell nucleus microinjection pressure is 200 Pa to 240 Pa.

[0018] According to an embodiment of the present invention, the cell nucleus microinjection time is 0.35 seconds to 0.45 seconds.

[0019] According to an embodiment of the present invention, the cytoplasmic microinjection pressure is 190 Pa to 210 Pa.

[0020] According to an embodiment of the present invention, the time for cytoplasmic microinjection is 0.25 seconds to 0.35 seconds.

[0021] According to an embodiment of the present invention, the ferret fertilized eggs are obtained in the following manner:

[0022] HCG is injected into the female ferret after normal mating; and the fertilized eggs are retrieved after a predetermined time following the HCG injection in order to obtain the ferret fertilized eggs; wherein the HCG is injected into the female ferret within 30 minutes to 1 hour after normal mating.

[0023] According to an embodiment of the present invention, the injection volume of HCG is 250 units to 350 units.

[0024] According to an embodiment of the present invention, the fertilized egg is retrieved 42 to 44 hours after HCG injection.

[0025] According to embodiments of the present invention, the sgRNA is adapted to target at least one of Emx1, Nkx2.1, hAce2, and Chd8.

[0026] According to embodiments of the present invention, the CrRNA of the sgRNA has at least one of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:44.

[0027] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:1.

[0028] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:2.

[0029] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:3.

[0030] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:44.

[0031] In a second aspect, the present invention provides a transgenic Angolan ferret model. According to an embodiment of the invention, the model is prepared using the method described in the first aspect of the invention. The ferret model according to the embodiments of the present invention can be widely used in research on cerebral cortex development and function, autism mechanisms, and the pathogenic mechanisms of SARS-CoV-2 infection and vaccine / drug development.

[0032] According to embodiments of the present invention, the transgenic Angora ferret model includes at least one of Emx1-CreERT2 transgenic Angora ferret, Nkx2.1-CreERT2 transgenic Angora ferret, humanized Ace2 replacement ferret model, and Chd8 knockout transgenic Angora ferret.

[0033] In a third aspect, the present invention provides an sgRNA. According to embodiments of the present invention, the CrRNA of the sgRNA has at least one of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:44. According to embodiments of the present invention, the CrRNA of the sgRNA has the nucleotide sequence shown in SEQ ID NO:1. According to embodiments of the present invention, the CrRNA of the sgRNA has the nucleotide sequence shown in SEQ ID NO:2. According to embodiments of the present invention, the CrRNA of the sgRNA has the nucleotide sequence shown in SEQ ID NO:3. According to embodiments of the present invention, the CrRNA of the sgRNA has the nucleotide sequence shown in SEQ ID NO:44. According to embodiments of the present invention, the trRNA of the sgRNA is suitable for targeting the Cas9 protein. The sgRNA of the present invention can precisely and efficiently target pre-intervention genes.

[0034] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0035] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, wherein:

[0036] Figure 1 This is a schematic diagram of the Emx1-CreERT2 ferret model designed according to an embodiment of this application.

[0037] Figure 2 This is a schematic diagram of the sequence before and after the sgRNA targeting site of the Emx1 gene designed according to an embodiment of this application.

[0038] Figure 3 The in vitro cleavage efficiency of sgRNA in the Emx1-CreERT2 model according to the embodiments of this application.

[0039] Figure 4 The image shows the donor plasmid of the Emx1-CreERT2 model according to an embodiment of this application.

[0040] Figure 5 The results of primer design and gene identification for the Emx1-CreERT2 model according to the embodiments of this application are presented.

[0041] Figure 6 This is a diagram showing the result of gaining and losing positions at both ends of a segment when the Emx1-CreERT2 model is knocked in according to an embodiment of this application.

[0042] Figure 7 This is a diagram showing the specificity analysis of CreER cell expression in the Emx1-CreERT2 model according to an embodiment of this application.

[0043] Figure 8 This is a schematic diagram of the design of the Nkx2.1-CreERT2 ferret model according to an embodiment of this application.

[0044] Figure 9 This is a schematic diagram of the sequence before and after the sgRNA targeting site of the Nkx2.1 gene designed according to an embodiment of this application.

[0045] Figure 10 The in vitro cleavage efficiency of sgRNA in the Nkx2.1-CreERT2 model according to the embodiments of this application.

[0046] Figure 11 The image shows the donor plasmid of the Nkx2.1-CreERT2 model according to an embodiment of this application.

[0047] Figure 12 The results of primer design and gene identification for the Nkx2.1-CreERT2 model according to the embodiments of this application are presented.

[0048] Figure 13 This is a diagram showing the results of gaining and losing positions at both ends of a segment in the Nkx2.1-CreERT2 model according to an embodiment of this application.

[0049] Figure 14 This is a diagram showing the verification results of the Nkx2.1-CreERT2 model immunoblotting experiment according to an embodiment of this application.

[0050] Figure 15 This is a schematic diagram of the hAce2-tdTomato ferret model designed according to an embodiment of this application.

[0051] Figure 16 This is a schematic diagram of the sequence before and after the sgRNA targeting site of the hAce2 gene designed according to an embodiment of this application.

[0052] Figure 17 The in vitro cleavage efficiency of sgRNA in the hAce2-tdTomato model according to the embodiments of this application.

[0053] Figure 18 This is a donor plasmid map of the hAce2-tdTomato model according to an embodiment of this application.

[0054] Figure 19 The results of primer design and gene identification for the hAce2-tdTomato model according to the embodiments of this application are presented.

[0055] Figure 20 This is a diagram showing the results of gaining and losing positions at both ends of the knock-in segment using the hAce2-tdTomato model according to an embodiment of this application.

[0056] Figure 21 This is a diagram showing the verification results of the hAce2-tdTomato model immunoblotting experiment according to an embodiment of this application.

[0057] Figure 22 This figure shows the sgRNA efficiency verification results of the Chd8 gene knockout ferret model according to the embodiments of this application.

[0058] Figure 23 This is a diagram showing the gene identification results of the Chd8 knockout ferret model according to an embodiment of this application.

[0059] Figure 24 This is a diagram showing the verification results of an immunoblotting experiment using a Chd8 knockout ferret model according to an embodiment of this application. Detailed Implementation

[0060] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0061] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0062] In this document, the terms “containing,” “comprising,” or “including” are open-ended expressions, meaning they include the contents specified in this invention but do not exclude other aspects.

[0063] In this document, the terms “optionally,” “optionally,” or “optionally” generally refer to an event or condition that may, but may not, occur, and the description includes both cases in which the event or condition occurs and cases in which the event or condition does not occur.

[0064] In this article, the term "gain / loss" refers to a term in genetics commonly used to describe small insertions or deletions (InDels) in a DNA sequence. An insertion refers to the addition of one or more nucleotides to a DNA sequence; a deletion refers to the loss of one or more nucleotides. When these insertions or deletions occur, they can alter the reading frame of the DNA, leading to changes in the sequence of the encoded protein. This can affect protein function or even cause the protein to lose its function entirely. This phenomenon is called a "frameshift mutation" in genetics.

[0065] In this article, the term "non-homologous end joining (NHEJ)" refers to a major mechanism by which cells repair DNA breaks when double-strand breaks (DSBs) occur. Unlike homology-directed repair (HDR), which requires homologous sequences, NHEJ repairs broken DNA ends without relying on homologous DNA templates.

[0066] This invention proposes a method for constructing a transgenic Angora ferret model, the transgenic ferret model, and sgRNA, which will be described in detail below.

[0067] Construction method of Anguru ferret model

[0068] In a first aspect, the present invention provides a method for constructing a transgenic Angora ferret model. According to an embodiment of the invention, the method includes: introducing sgRNA into Angora ferret zygotes to obtain a transgenic ferret model, wherein the sgRNA is suitable for targeting a pre-intervention gene. The method according to an embodiment of the invention can efficiently construct transgenic Angora ferret models, including gene knock-in, gene knockout, and humanized ferret models.

[0069] According to an embodiment of the present invention, prior to the importation, the process further includes: centrifuging the ferret fertilized eggs.

[0070] According to embodiments of the present invention, the centrifugation speed is 7800g to 8000g, for example, 7800g, 7810g, 7820g, 7830g, 7840g, 7850g, 7870g, 7900g, 7930g, 7950g, 7960g, 7970g, 7980g, 7990g, 8000g, and the range between these values ​​being 7800-7990g, 7800-7980g, 7800-7970g, 7800-7960g, and 7800-7950g. According to the method of the present invention, a moderate centrifugation speed improves the quality and viability of fertilized eggs, with over 70% of the fertilized eggs displaying pronuclei, thereby efficiently constructing a transgenic Angora ferret model.

[0071] According to embodiments of the present invention, the centrifugation time is 6 to 8 minutes, for example, 6 minutes, 6.1 minutes, 6.2 minutes, 6.3 minutes, 6.4 minutes, 6.5 minutes, 6.6 minutes, 6.7 minutes, 6.8 minutes, 6.9 minutes, 7 minutes, 7.1 minutes, 7.2 minutes, 7.3 minutes, 7.4 minutes, 7.5 minutes, 7.6 minutes, 7.7 minutes, 7.8 minutes, 7.9 minutes, 8 minutes, and ranges between these values, such as 6 to 7.9 minutes, 6 to 7.8 minutes, 6 to 7.7 minutes, 6 to 7.6 minutes, and 6 to 7.5 minutes. According to the method of the present invention, a suitable centrifugation time improves the quality and viability of fertilized eggs, with over 70% of fertilized eggs displaying pronuclei, thereby efficiently constructing a transgenic Angora ferret model.

[0072] According to embodiments of the present invention, the centrifugation speed is 7850g to 7950g, for example, 7850g, 7860g, 7870g, 7880g, 7890g, 7900g, 7910g, 7920g, 7930g, 7940g, 7950g, and the range between these values, 7850-7940g, 7850-7930g, 7850-7920g, 7850-7910g, and 7850-7900g. According to the method of the present invention, a moderate centrifugation speed further improves the quality and viability of fertilized eggs, with over 70% of the fertilized eggs displaying pronuclei, thereby further efficiently constructing a transgenic Angora ferret model.

[0073] According to embodiments of the present invention, the centrifugation time is 6.5 to 7.5 minutes, for example, 6.5 minutes, 6.6 minutes, 6.7 minutes, 6.8 minutes, 6.9 minutes, 7.0 minutes, 7.1 minutes, 7.2 minutes, 7.3 minutes, 7.4 minutes, 7.5 minutes, and ranges between these values, such as 6.5 to 7.4 minutes, 6.5 to 7.3 minutes, 6.5 to 7.2 minutes, 6.5 to 7.1 minutes, and 6.5 to 7.0 minutes. According to the method of the present invention, a suitable centrifugation time further improves the quality and viability of fertilized eggs, with over 70% of the fertilized eggs displaying pronuclei, thereby further efficiently constructing a transgenic Angora ferret model.

[0074] According to an embodiment of the present invention, the centrifugation speed is 7900g and the centrifugation time is 7 minutes. The method according to this embodiment of the present invention, with its appropriate centrifugation speed and time, further improves the quality and survival rate of fertilized eggs, with over 70% of the fertilized eggs displaying pronuclei, thereby enabling more efficient construction of a transgenic Angora ferret model.

[0075] According to an embodiment of the present invention, the introduction of sgRNA into Angora ferret zygotes is performed by at least one of the following methods: nuclear microinjection and cytoplasmic microinjection.

[0076] According to an embodiment of the present invention, after centrifugation, the fertilized egg displaying the nucleus region is subjected to nuclear microinjection.

[0077] According to an embodiment of the present invention, after centrifugation, the fertilized egg that does not show a nucleus region is subjected to cytoplasmic microinjection.

[0078] According to embodiments of the present invention, the nuclear microinjection pressure is 200 Pa to 240 Pa, for example, it can be 200 Pa, 205 Pa, 210 Pa, 215 Pa, 220 Pa, 225 Pa, 230 Pa, 231 Pa, 232 Pa, 233 Pa, 234 Pa, 235 Pa, 236 Pa, 237 Pa, 238 Pa, 239 Pa, 240 Pa, and the range between these values, 200 Pa to 240 Pa, 200 Pa to 239 Pa, 200 Pa to 238 Pa, 200 Pa to 237 Pa, 200 Pa to 236 Pa, and 200 Pa to 235 Pa. The method according to embodiments of the present invention can further efficiently construct transgenic Angora ferret models.

[0079] According to embodiments of the present invention, the nuclear microinjection time is 0.35 seconds to 0.45 seconds, for example, 0.35 seconds, 0.36 seconds, 0.37 seconds, 0.38 seconds, 0.39 seconds, 0.40 seconds, 0.41 seconds, 0.42 seconds, 0.43 seconds, 0.44 seconds, 0.45 seconds, and ranges between these values, such as 0.35–0.44 seconds, 0.35–0.43 seconds, 0.35–0.42 seconds, 0.35–0.41 seconds, and 0.35–0.40 seconds. The method according to embodiments of the present invention can further efficiently construct transgenic Angora ferret models.

[0080] According to embodiments of the present invention, the cytoplasmic microinjection pressure is 190 Pa to 210 Pa, for example, it can be 190 Pa, 191 Pa, 192 Pa, 193 Pa, 194 Pa, 195 Pa, 196 Pa, 197 Pa, 198 Pa, 199 Pa, 200 Pa, 201 Pa, 202 Pa, 203 Pa, 204 Pa, 205 Pa, 206 Pa, 207 Pa, 208 Pa, 209 Pa, 210 Pa, and the range between these values, 190–209 Pa, 190–208 Pa, 190–207 Pa, 190–206 Pa, 190–205 Pa, and 190–204 Pa. The method according to embodiments of the present invention can further efficiently construct transgenic Angora ferret models.

[0081] According to embodiments of the present invention, the cytoplasmic microinjection time is 0.25 seconds to 0.35 seconds, for example, 0.25 seconds, 0.26 seconds, 0.27 seconds, 0.28 seconds, 0.29 seconds, 0.30 seconds, 0.31 seconds, 0.32 seconds, 0.33 seconds, 0.34 seconds, 0.35 seconds, and the range between these values, such as 0.25–0.34 seconds, 0.25–0.33 seconds, 0.25–0.32 seconds, 0.25–0.31 seconds, and 0.25–0.30 seconds. The method according to embodiments of the present invention can further efficiently construct transgenic Angora ferret models.

[0082] According to an embodiment of the present invention, the ferret fertilized eggs are obtained in the following manner:

[0083] HCG is injected into the female ferret after normal mating; and the fertilized eggs are retrieved after a predetermined time following the HCG injection in order to obtain the ferret fertilized eggs; wherein the HCG is injected into the female ferret within 30 minutes to 1 hour after normal mating.

[0084] According to an embodiment of the present invention, the injection volume of HCG is 250 units to 350 units.

[0085] According to an embodiment of the present invention, the fertilized egg is retrieved 42 to 44 hours after HCG injection.

[0086] According to embodiments of the present invention, the sgRNA is adapted to target at least one of Emx1, Nkx2.1, hAce2, and Chd8.

[0087] According to embodiments of the present invention, the CrRNA of the sgRNA has at least one of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:44.

[0088] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:1.

[0089] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:2.

[0090] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:3.

[0091] According to an embodiment of the present invention, the CrRNA of the sgRNA has a nucleotide sequence as shown in SEQ ID NO:44.

[0092] Genetically modified Angolan ferret model

[0093] In a second aspect, the present invention provides a transgenic Angolan ferret model. According to an embodiment of the invention, the model is prepared using the method described in the first aspect of the invention. The ferret model according to the embodiments of the present invention can be widely used in research on cerebral cortex development and function, autism mechanisms, and the pathogenic mechanisms of SARS-CoV-2 infection and vaccine / drug development.

[0094] According to embodiments of the present invention, the transgenic Angora ferret model includes at least one of Emx1-CreERT2 transgenic Angora ferret, Nkx2.1-CreERT2 transgenic Angora ferret, humanized Ace2 replacement ferret model, and Chd8 knockout transgenic Angora ferret.

[0095] sgRNA

[0096] In a third aspect, the present invention provides an sgRNA. According to embodiments of the present invention, the sgRNA's CrRNA has at least one of the nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:44. According to embodiments of the present invention, the sgRNA's CrRNA has the nucleotide sequence shown in SEQ ID NO:1. According to embodiments of the present invention, the sgRNA's CrRNA has the nucleotide sequence shown in SEQ ID NO:2. According to embodiments of the present invention, the sgRNA's CrRNA has the nucleotide sequence shown in SEQ ID NO:3. According to embodiments of the present invention, the sgRNA's CrRNA has the nucleotide sequence shown in SEQ ID NO:44. The sgRNA according to embodiments of the present invention can precisely and efficiently target pre-intervention genes.

[0097] It should be noted that the sgRNA in this application is a complex sequence formed by the linkage of crRNA and trRNA.

[0098] According to an optional embodiment of the present invention, the trRNA sequence is as follows: GGAACCATTCAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGC ACCGAGTCGGTGC (SEQ ID NO:45).

[0099] The sequence of the present invention is shown in the table below.

[0100] sequence list

[0101]

[0102]

[0103] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0104] Example 1:

[0105] In this embodiment, the Emx1-CreERT2 ferret model was constructed. The plasmid (Emx1-IRES-CreERT2) for the Emx1-CreERT2 ferret model was designed as follows: Figure 1As shown, in this embodiment, a foreign DNA fragment containing IRES-CreERT2 was inserted between the end of the fourth exon and the 3'UTR region of the Emx1 gene in ferrets, thereby achieving the expression of Cre recombinase (CreER protein) fused to the estrogen receptor in cells specifically expressing the Emx1 gene. Under the induction of tamoxifen (TM), CreER enters the cell nucleus and exerts its Cre recombinase function. The specific experimental procedure of this embodiment is as follows:

[0106] 1. Gene targeting design

[0107] The genome sequences of the corresponding genes in ferrets were downloaded from the NCBI and Ensembl websites, and the sequences were completed by cloning the genomes of wild-type ferrets. Target sites were then designed for different strains.

[0108] Choose appropriate sgRNA sites based on the requirements of different strains and the specific circumstances of different genes. For example, in strains with Emx1 gene knock-in, design a target site at the end of the fourth exon of the Emx1 gene.

[0109] 2. sgRNA site design

[0110] After identifying the target site, specific target sites and sgRNA sequences are selected from shared resource websites such as CRISPOR and CHOPCHOP. Taking CRISPOR as an example, in the website's sgRNA (composed of CrRNA and TrRNA) design software, the species is selected as ferret, and the design is based on sequences approximately 100 bp upstream and downstream of the selected knock-in site. The website will calculate and provide all possible CrRNA information for the current sequence, including the specific location, off-target probability, and predicted in vitro and in vivo enzyme digestion efficiency. Then, the target site is confirmed to be unsuitable using BLAST software from the NCBI website. After comprehensive consideration, four CrRNA sequences that are close to the target site, have high sequence specificity, high in vitro and in vivo enzyme digestion efficiency, and appropriate GC content are selected as candidate CrRNAs, which are then synthesized for the next screening step. The designed CrRNA sequences of the Emx1 gene are: Emx1-CrRNA-1 (specific nucleotide sequence as shown in SEQ ID NO:4), Emx1-CrRNA-2 (specific nucleotide sequence as shown in SEQ ID NO:1), Emx1-CrRNA-3 (specific nucleotide sequence as shown in SEQ ID NO:5), and Emx1-CrRNA-4 (specific nucleotide sequence as shown in SEQ ID NO:6).

[0111] 3. In vitro test of sgRNA cleavage efficiency

[0112] After designing the sgRNA, order the corresponding CrRNA and TrRNA from IDT, and then dissolve the RNA powder at the specified concentration to obtain the corresponding solution. Taking the Emx1 gene locus as an example, the method is similar for other gene loci.

[0113] 1)Reference Figure 2 The sgRNA target site sequence was cloned from the genome of wild-type ferrets;

[0114] Design primers Ex11Fw1:5'-ATGCAATGGCTTTTTATACATTCGCCT-3' (SEQ ID NO:7)

[0115] Ex11Re1:5'-TAGAGCTGGAGTTCAGGATCAGGG-3'(SEQ ID NO:8)

[0116] Configure the PCR reaction system as shown in Table 1: 50 μL for each reaction, for a total of 8 reactions.

[0117] Table 1: PCR reaction system

[0118] <![CDATA[Water (H2O)]]> 19μL 10μM Ex11Fw1 2.5μL 10μM Ex11Re1 2.5μL Q5 Ultra Fidelity 2X Premix (Q5 2x Master Mix) 25μL Ferret genomic DNA 1.0μL Total reaction volume 50μL

[0119] 95℃2min, 35x (95℃30s, 50℃30s, 68℃40s), 68℃15min, 10℃hold

[0120] Gel recovery of target DNA fragments.

[0121] 2) Prepare the in vitro sgRNA reaction system as shown in Table 2;

[0122] Table 2: In vitro sgRNA reaction system

[0123]

[0124] After preparation, mix carefully, centrifuge briefly, and then place in a PCR instrument to react at 37°C for 2-4 hours.

[0125] 3) Perform gel electrophoresis and imaging to analyze the grayscale values ​​of the product fragments and the remaining template DNA fragments after cleavage, and obtain the optimal target sequence.

[0126] All four sgRNAs could cleave the 1173bp Emx1 DNA template into 598bp and 575bp fragments. With the same loading amount, from... Figure 3 As can be seen, Emx1-CrRNA-2 (corresponding to Figure 3 The third lane of the middle lane has the highest in vitro cleavage efficiency, therefore this application selects the genomic site targeted by Emx1-CrRNA-2 as the subsequent injection target.

[0127] 4. Donor plasmid construction

[0128] The exogenous fragment IRES-CreERT2 was inserted into the end of the Emx1 gene using homology-directed repair (HDR). When constructing the donor plasmid, refer to... Figure 4 Endogenous sequences from the Emx1 gene upstream and downstream of the target site were added to both ends of the inserted sequence. The plasmid was assembled and verified by Sanger sequencing.

[0129] 5. Embryo microinjection

[0130] After preparing the sgRNA and donor plasmid, a total of 9 microinjection experiments were conducted, and the specific data are shown in Table 3 below. To construct the Emx1-CreERT2 ferret model, 36 successfully mated donor female ferrets were used, yielding 308 fertilized eggs. Of these 308 fertilized eggs, 179 showed pronuclei under a microscope after centrifugation and were subsequently injected into the pronuclear region; the remaining 129 fertilized eggs did not show a nucleus under a microscope after centrifugation and were subsequently injected into the cytoplasm. A total of 153 fertilized eggs survived after injection, representing a survival rate of 49.7%. These 153 fertilized eggs were transplanted into the oviducts of 17 recipient female ferrets, resulting in 55 offspring. Six positive F0 individuals were obtained, representing a positive rate of 10.9% for the F0 offspring, with an overall success rate of 1.9%. Positive Emx1-CreERT2 ferret models show no significant differences from littermate negative individuals or wild-type individuals, and can be mated and bred with wild-type ferrets to obtain F1 offspring of this strain.

[0131] Table 3: Relevant data on the preparation of the Emx1-CreERT2 ferret strain

[0132]

[0133] 6. Genotyping and sequencing verification

[0134] For newborn pups, tail tissue was taken for genotyping. To detect random insertions and random cutting of inserted fragments, refer to... Figure 5This application designed three different primer pairs (LA, R, and IN) at the junction of the exogenous and endogenous genes, and within the exogenous gene: Emx1-LA-F1 (SEQ ID NO:18), Emx1-LA-R1 (SEQ ID NO:19), Emx1-R-F3 (SEQ ID NO:20), Emx1-R-R3 (SEQ ID NO:21), Emx1-IN-F2 (SEQ ID NO:22), and Emx1-IN-R2 (SEQ ID NO:23). The positive bands amplified by primers LA, R, and IN were 1294 bp, 946 bp, and 361 bp, respectively. Primers LA and R are used to detect random insertion, while primer IN is used to detect the integrity of the inserted fragment. In the five samples tested in this application, only samples 2 and 3 showed positive bands with all three primer pairs; therefore, samples 2 and 3 are positive animals of the Emx1-CreERT2 strain. Sample 1 only showed a positive band for the IN primer, while LA and R were both negative bands. This could be due to chimeric insertion or random insertion, so it was eliminated.

[0135] Following PCR identification, this application designed longLA and longR primers at both ends of the plasmid insertion site: Emx1-longLA-F2 (SEQ ID NO:24), Emx1-longLA-R2 (SEQ ID NO:25), Emx1-longR-F1 (SEQ ID NO:26), and Emx1-longR-R1 (SEQ ID NO:27). Genome sequencing was performed on positive individuals identified by PCR to further verify whether the exogenous gene was accurately inserted at the insertion site. This application exemplifies this with a positive ferret (number 2). See reference... Figure 6 Sequencing results showed that no additional insertions or deletions occurred at either end of the insertion site.

[0136] 7. Functional Verification

[0137] This embodiment co-stains cells expressing fluorescent proteins with cell-specific protein markers to analyze cell types. Eight-day-old Emx1-CreERT2-positive pups underwent stereotactic injection, receiving rAAV-hSyn-DIO-mCherry-WPRE virus (containing the Loxp-Stop-Loxp sequence) into the cerebral cortex. From generation P10 to P15, they received four consecutive injections of a high concentration of tamoxifen (TM) at 20 mg / kg. Figure 7Perfusion, tissue sampling, sectioning, and staining were performed at P39. The AAV virus promoter used in this embodiment is hSyn. hSyn is expressed only in neurons; therefore, only neurons express the red fluorescent protein mCherry, while astrocytes and oligodendrocytes do not express mCherry. Furthermore, mCherry-positive cells co-localize with the specific marker of cortical excitatory neurons, cleavage cassette 1 (CUX1), and a specific marker of neuronal nuclei (NEUN). mCherry-positive cells do not co-localize with parvalbumin (PV) inhibitory neurons, astrocyte marker glial fibrillary acidic protein (GFAP), oligodendrocyte marker OLIG2, or microglia / macrophage marker ionized calcium-binding adapter molecule 1 (IBA1). In mice, PV neurons account for approximately 40% of the total number of inhibitory neurons in the cerebral cortex, making them the most numerous type of inhibitory neuron. Therefore, this embodiment in vivo verified the specific expression of CreER protein and the function of recombinase in the Emx1-CreERT2 model. The scheme of this embodiment successfully constructed the Emx1-CreERT2 transgenic Angora ferret model.

[0138] Example 2

[0139] This embodiment is basically the same as the experimental procedure in Embodiment 1, except that the Nkx2.1-CreERT2 ferret strain was constructed in this embodiment to achieve specific labeling of inhibitory neurons originating from MGE and PoA in the ferret brain. The knock-in plasmid (Nkx2.1-IRES-CreERT2) of the Nkx2.1-CreERT2 ferret model was designed as follows: Figure 8 As shown, a knock-in site was designed between the end of the second exon of the Nkx2.1 gene and the 3'UTR to insert the IRES-CreERT2 gene fragment.

[0140] 1.Reference Figure 9 The sgRNA targeting site sequence of Nkx2.1 was cloned from the genome of wild-type ferrets;

[0141] Design primer NKX2-1 Fw1:5'-CAAGCAACAGAAGTACCTGTCGG-3' (SEQ ID NO:14)

[0142] NKX2-1 Re1:5'-TAGAGTCCAGAGCCGCGT-3'(SEQ ID NO:15)

[0143] In this embodiment, four sgRNAs meeting the requirements were designed at the end of the second exon of the Nkx2.1 gene: Nkx2.1-CrRNA-1 (specific nucleotide sequence as shown in SEQ ID NO:9), Nkx2.1-CrRNA-2 (specific nucleotide sequence as shown in SEQ ID NO:10), Nkx2.1-CrRNA-3 (specific nucleotide sequence as shown in SEQ ID NO:2), and Nkx2.1-CrRNA-4 (specific nucleotide sequence as shown in SEQ ID NO:11). The in vitro cleavage efficiency of the designed target was verified. (Results refer to...) Figure 10 The results showed that all four sgRNAs cleaved the 988bp template into different sizes. Furthermore, with the same loading amount, by comparing the gray values ​​of the bands, Nkx2.1-CrRNA-3 (corresponding to #3 sgRNA in lane 4 of the figure) showed the best cleavage effect. Therefore, the genomic site targeted by Nkx2.1-CrRNA-3 was selected as the target site for subsequent injection.

[0144] 2. During donor plasmid construction, the exogenous fragment IRES-CreERT2 was inserted into the end of the Nkx2.1 gene using the HDR method. This required designing upstream and downstream endogenous sequences as homologous arms at both ends of the exogenous insertion fragment. Combined with the selected sgRNA and knock-in design, the donor plasmid was assembled and finally verified by Sanger sequencing. The knock-in plasmid is shown below. Figure 11 As shown.

[0145] 3. After preparing the sgRNA and donor plasmid fragments, this example completed three microinjection experiments using the Nkx2.1-CreERT2 model. This example exemplifies the results of one microinjection experiment, with specific data shown in Table 4 below. This microinjection experiment used 8 donor female minks, yielding 83 fertilized eggs. After centrifugation, the pronuclei of all 83 fertilized eggs were observed under a microscope, and pronuclear injection was performed. 43 fertilized eggs survived after injection, a survival rate of 51.8%. These 43 fertilized eggs were transplanted into the oviducts of 4 recipient female minks, resulting in 22 offspring, including 2 positive F0 individuals. The F0 positivity rate was 9.1%, and the overall success rate was 2.4%. The surviving positive individuals showed no significant difference from wild-type individuals and could be mated with wild-type ferrets to reproduce the F1 offspring of this strain.

[0146] Table 4: Relevant data on the preparation of the Nkx2.1-CreERT2 ferret strain

[0147]

[0148] 4. To confirm the genotype of newborn ferrets of the Nkx2.1-CreERT2 strain, tail tissue was taken for gene identification. In this embodiment, two pairs of primers L and R were designed at the junction of the exogenous gene and the ferret's endogenous gene fragments in this strain: Nkx2.1-LF (SEQ ID NO:28), Nkx2.1-LR (SEQ ID NO:29), Nkx2.1-RF (SEQ ID NO:30), and Nkx2.1-RR (SEQ ID NO:31) for genotype identification. (Refer to...) Figure 12 The products amplified by the two primer pairs were 543bp and 665bp, respectively. Sample 1 served as a plasmid positive control. Samples 2 and 6, after amplification with both primer pairs, produced products of 543bp and 665bp, indicating that samples 2 and 6 were genotype-positive animals. Samples 3, 4, 5, and 7 showed no positive bands, indicating they were genotype-negative animals.

[0149] 5. After determining the genotype, to verify the accuracy of gene knock-in, this embodiment uses IN primers Nkx2.1-IN-F (SEQ ID NO:32) and Nkx2.1-IN-R (SEQ ID NO:33) to perform PCR amplification on the genomic fragment at the junction of the homologous arms upstream and downstream of the insertion site and the endogenous gene in positive individuals. The amplified fragments are then subjected to Sanger sequencing. Taking individual 6 as an example, refer to... Figure 13 Sequencing results revealed that no additional insertions or deletions occurred at the splice points between the exogenous and endogenous genes.

[0150] 6. In this embodiment, tissue samples were taken from the dorsal cortex, medial ganglion eminence (MGE), and kidney tissue of Nkx2.1-CreERT2 positive and negative animals at day 31 of gestation (E31) for Western blot analysis. At this time, a large number of neural progenitor cells and new neurons were present in both the dorsal and ventral regions of the telencephalon. Additionally, astrocytes from Aldh1l1-CreERT2 mice were isolated as a positive control for Cre protein. The results showed that, based on… Figure 14 Cre protein was expressed in both the dorsal and ventral mesoencephaloid processes (MGE) of the Nkx2.1-CreERT2 embryos, indicating that the Nkx2.1-CreERT2 transgenic Angora ferret model was successfully constructed using the method described in this embodiment. Other procedures were the same as in Example 1.

[0151] Example 3

[0152] This embodiment is basically the same as the experimental procedure in Embodiment 1. The difference is that in this embodiment, a humanized Ace2 gene will be precisely knocked into the endogenous Ace2 gene in the ferret to replace the expression of the endogenous Ace2 in the ferret, simulating the expression environment of humanized Ace2 in the ferret and enhancing the susceptibility of the ferret to the novel coronavirus. A schematic diagram of the design of the humanized Ace2 knock-in plasmid (fAce2-hAce2-IRES-tdTomato-WPRE-pA) is shown below. Figure 15 As shown.

[0153] 1.Reference Figure 16 The sgRNA targeting site sequence of Ace2 was cloned from the genome of wild-type ferrets;

[0154] Design primer Ace2 Fw1:5'-AAGTACCACTACTACCCCCGT-3' (SEQ ID NO:16)

[0155] Ace2 Re1:5'-ACCCCTACATAGCCACGGAA-3'(SEQ ID NO:17)

[0156] This embodiment targets a humanized Ace2 model. Three sgRNAs, hAce2-CrRNA-1 (SEQ ID NO:12), hAce2-CrRNA-2 (SEQ ID NO:3), and hAce2-CrRNA-3 (SEQ ID NO:13), were designed in the second exon of the ferret Ace2 gene. The cleavage efficiency was tested in vitro, and the results are as follows: Figure 17 As shown, with the same loading amount, the three sgRNAs cleaved the 595bp template into different sizes. Based on the grayscale analysis of the different bands, hAce2-CrRNA-2 (corresponding to...) Figure 17 The fourth lane from the left in the middle has the best cutting efficiency, therefore, this application selects the genomic site targeted by hAce2-CrRNA-2 as the target for subsequent injection.

[0157] 2. In constructing the humanized Ace2 model donor plasmid, this embodiment added endogenous gene fragments upstream and downstream of the target site as left and right homologous arms to both ends of the inserted sequence hAce2-IRES-tdTomato-WPRE-pA, obtaining the final humanized hAce2 model donor plasmid. After successful plasmid construction, Sanger sequencing was performed, and the final confirmed knock-in plasmid map is as follows. Figure 18 As shown.

[0158] 3. After obtaining the sgRNA and donor plasmid fragments, this example completed 11 microinjection experiments for the humanized Ace2 model. Specific data are shown in Table 5 below. A total of 39 donor female minks were used to construct the humanized Ace2 model, yielding 386 fertilized eggs. Pronuclei were observed under a microscope after centrifugation in 275 fertilized eggs, which underwent pronuclear injection; the nuclei were not observable after centrifugation in 111 eggs, which underwent cytoplasmic injection. A total of 212 fertilized eggs survived after injection, a survival rate of 54.9%. These 212 fertilized eggs were transplanted into the oviducts of 22 recipient female minks, resulting in 79 offspring. Ten positive F0 individuals were obtained, representing an F0 positivity rate of 12.7%, with an overall success rate of 2.6%. The positive individuals showed no significant difference from wild-type individuals and could be mated with wild-type ferrets to obtain the F1 offspring population of this strain.

[0159] Table 5: Relevant data on the preparation of humanized Ace2 ferret strains

[0160]

[0161] 4. To determine the genotype of newborn ferrets, tail tissue was taken for gene identification. In this embodiment, three pairs of primers L, R, IN were designed at the junction of the exogenous inserted gene fragment and the ferret's endogenous gene fragment, as well as inside the inserted fragment: Ace2-L1F (SEQ ID NO:34), Ace2-L1R (SEQ ID NO:35), Ace2-R-3F (SEQ ID NO:36), Ace2-R-3R (SEQ ID NO:37), Ace2-IN-3F (SEQ ID NO:38), and Ace2-IN-3R (SEQ ID NO:39). Identification was performed by PCR. The primer design and identification results are as follows: Figure 19 As shown. By comparing the PCR results, the positive bands amplified by the three primer pairs L, R, and IN were 994bp, 564bp, and 511bp, respectively. The positive control P was a donor plasmid fragment. Comparison revealed that the PCR results of individuals 5 and 6 showed bands of the same size as the positive control for all three primer pairs. Therefore, in this example, individuals 5 and 6 are considered positive samples, and the rest are considered negative samples.

[0162] 5. For positive results identified through genome sequencing, to further confirm the accuracy of the insertion, this embodiment designed primers LA and RA at both ends of the knock-in site: Ace2-LA-F3 (SEQ ID NO:40), Ace2-LA-R3 (SEQ ID NO:41), Ace2-RA-F2 (SEQ ID NO:42), and Ace2-RA-R2 (SEQ ID NO:43). Sanger sequencing was performed at the junction of the homologous arm of the inserted sequence and the endogenous gene fragment. Taking positive result number 6 as an example, refer to... Figure 20 Sequencing revealed no additional insertions or deletions at the knock-in sites, and the remaining positive individuals were also sequenced and verified using the same method.

[0163] 6. In this embodiment, the expression of human Ace2 protein was verified at the protein expression level. After extracting protein samples from different organ tissues of positive and wild-type animals, such as lung, kidney, large intestine, and small intestine, Western blotting was performed. The hybridization results of the inserted sequence protein expression were characterized by tdTomato protein expression. The results are as follows: Figure 21 As shown, compared with the wild type, the humanized model expressed tdTomato in the small intestine, large intestine, and kidneys, indicating that the scheme of this embodiment successfully constructed the hAce2-tdTomato transgenic Angora ferret model. Other procedures were the same as in Example 1.

[0164] Example 4

[0165] Autism spectrum disorder (ASD) is a prevalent neurological disorder controlled by multiple genetic factors. Among the single-gene mutations leading to the disease, the Chd8 gene mutation has the highest frequency and risk. This embodiment is essentially the same as Example 1 in its experimental procedure, except that it utilizes the established transgenic preparation system to construct a Chd8 gene knockout model. Using the non-homologous end joining (NHEJ) method, sgRNA is targeted to a genomic site, causing the Cas9 protein to bind to a specific genomic sequence and cleave it. This results in a gain / loss position at the recognition site, causing a frameshift mutation that disrupts Chd8 protein expression, thus achieving knockout. This embodiment targets the second exon of the Chd8 gene, knocking out or inserting non-3N bases, altering the translation sequence of subsequent amino acids, thereby changing the original expression sequence and achieving knockout. The crRNA site selected was a conserved sequence CAATGGAAACACCTGGTCGAAGG (SEQ ID NO:44). Verification showed that at this sgRNA site, Cas9 could cleave the 371bp template DNA fragment into 254bp and 117bp bands, demonstrating high target cleavage efficiency. Therefore, this genomic site targeting this sgRNA was chosen as the target for subsequent knockout model preparation. Figure 22 .

[0166] After confirming the sgRNA, this example completed seven Chd8 gene injection experiments, with specific data shown in Table 6 below. A total of 18 donor female minks were used to construct the Chd8 knockout model, yielding 163 fertilized eggs. Pronuclei were observed under a microscope after centrifugation in 116 of these eggs, and pronuclear injection was performed. The nuclei were not observable after centrifugation in the remaining 47 eggs, and cytoplasmic injection was performed. A total of 98 fertilized eggs survived after injection, a survival rate of 56.4%. These 98 fertilized eggs were transplanted into the oviducts of 11 recipient female minks, resulting in 38 offspring. Thirteen effectively edited positive F0 individuals were obtained, representing an F0 positivity rate of 34.2%, with an overall success rate of 8%. The obtained positive animals showed no significant difference from wild-type animals, and the positive ferrets exhibited no differences in movement, weight, or diet compared to wild-type animals. They can be mated with wild-type animals to breed the F1 offspring population of this strain.

[0167] Table 6: Relevant data on the preparation of Chd8 knockout strains

[0168]

[0169] In this embodiment, to confirm the genotype of newborn ferrets, a portion of the tail tissue was excised from the ferret, genomic DNA was extracted, and a genomic DNA fragment of approximately 700 bp before and after the sgRNA target site was amplified. This fragment was then purified using a gel electrophoresis technique. The purified PCR results were then introduced into competent bacteria using a top-clone method. Single clones were subsequently selected for Sanger sequencing to analyze the gain / loss loci at the target site. Figure 23 The results showed that, compared with the wild-type genome sequence, the knockout results exhibited both 3N and non-3N gain / loss positions. In this embodiment, only ferrets with non-3N sequencing results were retained as positive knockout ferrets to establish a strain.

[0170] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0171] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for constructing a transgenic Angolan ferret model, characterized in that, include: sgRNA was introduced into Angora ferret zygotes to obtain a transgenic ferret model, wherein the sgRNA was suitable for targeting pre-intervention genes; The ferret eggs were obtained in the following manner: Injecting HCG into female mink after normal mating; and After the scheduled HCG injection, the fertilized eggs are retrieved. The HCG was injected into the female mink within 30 minutes to 1 hour after normal mating. The injection volume of HCG is 250 units to 350 units; The fertilized eggs were retrieved 42 to 44 hours after HCG injection in order to obtain the ferret fertilized eggs; Prior to the importation, the process further includes: centrifuging the ferret fertilized eggs; The centrifugation rate is 7800g~8000g; The centrifugation process takes 6 to 8 minutes. The sgRNA was introduced into Angora ferret zygotes by at least one of the following methods: nuclear microinjection and cytoplasmic microinjection; After centrifugation, the fertilized egg that displays the nucleus region is subjected to nuclear microinjection. After centrifugation, the fertilized eggs that did not show a nucleus region were subjected to cytoplasmic microinjection. The cell nucleus microinjection pressure is 200 Pa to 240 Pa. The cell nucleus microinjection time is 0.35 seconds to 0.45 seconds; The cytoplasmic microinjection pressure is 190 Pa to 210 Pa. The cytoplasmic microinjection time is 0.25 seconds to 0.35 seconds.

2. The method according to claim 1, characterized in that, The centrifugation rate is 7850g~7950g.

3. The method according to claim 1, characterized in that, The centrifugation time is 6.5 to 7.5 minutes.

4. The method according to claim 1, characterized in that, The sgRNA is adapted to target at least one of Emx1, Nkx2.1, hAce2, and Chd8.

5. The method according to claim 1, characterized in that, The CrRNA of the sgRNA consists of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:

2.

6. An sgRNA, characterized in that, The CrRNA of the sgRNA consists of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

Images