Use of wild soybean receptor kinase protein encoding gene gsfer

Abstract

The application discloses application of a soybean receptor kinase protein coding gene GsFER. The soybean receptor kinase protein coding gene GsFER has a nucleotide sequence as shown in SEQ ID NO. 1. Under normal phosphorus conditions, the phosphorus content of a soybean root transformed by an RNA interference vector of GsFER is significantly lower than that of a control root. Under low phosphorus conditions, the aboveground and underground phosphorus contents of a GsFER overexpression plant are significantly higher than those of a control plant, indicating that GsFER can promote phosphorus absorption of a plant under low phosphorus conditions. It can be seen that the soybean receptor kinase protein coding gene GsFER disclosed by the application can be applied to regulation of low phosphorus stress tolerance of a transgenic plant through genetic engineering.

Description

Technical Field

[0001] This invention relates to the application of the wild soybean receptor kinase protein encoding gene GsFER, belonging to the field of genetic engineering. Specifically, it relates to the application of the receptor kinase protein GsFER derived from wild soybean in regulating soybean tolerance to low phosphorus stress. Background Technology

[0002] Soybean [Glycine max(L)Merr.] is an important dual-purpose crop for both food and oil, and one of the most important sources of plant protein for humans. In recent years, soil phosphorus deficiency has gradually become a limiting factor for soybean yield. Understanding the phosphorus acquisition mechanism of soybean and improving its phosphorus uptake and utilization efficiency will help enhance its ability to cope with low phosphorus stress. Wild soybean (Glycine soja Sieb. et Zucc.) has strong stress tolerance; introducing the dominant haplotype of low phosphorus tolerance-related genes into cultivated soybean can improve its adaptability to low phosphorus stress.

[0003] Previous studies located a low-phosphorus-related locus in soybean on chromosome 8 of wild soybean. Within this candidate region, there are four candidate genes, one of which encodes receptor-like protein kinase FERONIA (FER). Previous research has shown that FER participates in the regulation of plant growth and development, responding to abiotic stresses such as salt stress, low-temperature stress, high-temperature stress, low-nitrogen stress, drought stress, and heavy metal ion stress, and also regulates plant immunity and hormone signal transduction pathways. The Arabidopsis homolog AT3G51550 shares 46.59% amino acid similarity with GsFER. The loss-of-function mutant AT3G51550, fer, exhibits stunted growth and severely impaired root hair development. This gene also affects endoplasmic reticulum formation and glucosinolate synthesis. In rice, the homolog Os03g21540 shares 58.10% amino acid similarity with GsFER. Os03g21540 can inhibit cell death and affect sugar utilization during reproductive development. Reports on the function of FER family genes in soybean are scarce; currently, only one study reports that mutations in the FER family gene GmLMM1 enhance resistance to root-knot nematodes. Therefore, no studies have been found on FER regulation of soybean tolerance to low phosphorus stress. Summary of the Invention

[0004] The purpose of this invention is to disclose the genetic engineering application of a soybean receptor kinase protein encoding gene, GsFER, in soybean tolerance to low phosphorus stress.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The application of the soybean receptor kinase protein encoding gene GsFER in improving the tolerance of soybean to low phosphorus stress through genetic engineering, wherein the coding region sequence of the soybean receptor kinase protein encoding gene GsFER is: SEQ ID NO.1.

[0007] The amino acid sequence of soybean GsFER protein is: SEQ ID NO.2.

[0008] A recombinant expression vector containing the soybean receptor kinase protein encoding gene GsFER as described in this invention.

[0009] When constructing plant expression vectors using GsFER, any type of enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified, such as by adding selective marker genes (GUS gene, luciferase gene, etc.) to the plant.

[0010] The plant expression vector carrying the GsFER of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants.

[0011] In soybeans, overexpression of GsFER can increase the phosphorus content of soybeans under low phosphorus stress.

[0012] Under low phosphorus conditions, the phosphorus content in the aboveground leaves and underground roots of GsFER-overexpressing plants was significantly higher than that in control plants, indicating that GsFER may promote phosphorus uptake in plants under low phosphorus conditions.

[0013] As a preferred embodiment of the present invention, the recombinant expression vector containing the soybean receptor kinase protein encoding gene GsFER is an overexpression vector of GsFER.

[0014] As a preferred embodiment of the present invention, the overexpression vector of GsFER is used to improve the tolerance of soybean to low phosphorus stress through genetic engineering.

[0015] Beneficial effects

[0016] GsFER belongs to the soybean receptor protein kinase family and encodes the FER protein, which is involved in regulating soybean tolerance to low phosphorus stress. Significant differences in phosphorus-related traits were observed among different haplotypes of GsFER. Tissue expression analysis showed that the gene was highly expressed mainly in flowers and seeds; subcellular localization showed that the gene was located in the cytoplasmic membrane; inducible expression analysis showed that phosphorus-efficient and phosphorus-inefficient materials exhibited opposite expression patterns of GsFER under low phosphorus conditions; under low phosphorus conditions, the phosphorus content in both the aboveground and underground parts of GsFER-overexpressing plants was significantly higher than that of control plants. Therefore, GsFER can serve as a target for increasing soybean phosphorus content under low phosphorus conditions, and can be used for quality improvement of soybean varieties tolerant to low phosphorus stress. Attached Figure Description

[0017] Figure 1 Agarose gel electrophoresis image after PCR cloning of GsFER. Target fragment size: 1215 bp. M: MarkerDL2000.

[0018] Figure 2 GsFER tissue expression pattern. N=3, error bars represent ± standard deviation.

[0019] Figure 3 Subcellular localization of GsFER. GFP: Green fluorescent protein; mCherry: Nuclear and membrane control marker; BrightField: Bright field; Merge: Fluorescence and bright field fusion; 35S: GFP: Empty vector control; 35S::GsFER::GFP: GsFER protein tagged with GFP.

[0020] Figure 4 GsFER can respond to low phosphorus stress induction. Changes in GsFER expression levels after 1 h, 12 h, 7 d, and 15 d of induction, N=3.

[0021] Figure 5 GsFER overexpressing Arabidopsis thaliana and its mutant fer positive identification. A. GsFER overexpressing Arabidopsis thaliana positive identification. Lanes 1-4 represent the positive identification results of infected Arabidopsis thaliana seedlings, with the positive target fragment size being 1215bp; B. Arabidopsis thaliana mutant fer positive identification. WT: Arabidopsis thaliana wild type; M: Marker, DL2000.

[0022] Figure 6Phenotypic characteristics of transgenic Arabidopsis plants under different phosphorus conditions. WT: wild type, fer: Arabidopsis fer mutant, OE-GsFER: GsFER overexpressing plants. A: Phenotypic characteristics of plants cultured in normal phosphorus MS medium, scale bar: 1 cm. B: Phenotypic characteristics of plants cultured in low phosphorus MS medium, scale bar: 1 cm. C: Taproot length. D: Number of lateral roots. N = 15, *: P < 0.05, **: P < 0.01, ***: P < 0.001. Two-tailed assay, error bars represent ± standard deviation.

[0023] Figure 7 Phenotypic characteristics of transgenic Arabidopsis roots under low phosphorus conditions. A: Wild-type Arabidopsis plant (WT), B: Arabidopsis fer mutant, C: Arabidopsis GsFER overexpressing plant. Scale bar: 1 cm.

[0024] Figure 8 Phenotypic characteristics of soybean GsFER transgenic hairy root hydroponic plants under different phosphorus conditions. A, B, C, D: Phenotypic characteristics of soybean GsFER transgenic and control hairy root hydroponic plants under low phosphorus conditions. E, F, G, H: Phenotypic characteristics of soybean GsFER transgenic and control hairy root hydroponic plants under normal phosphorus conditions. RI: RNA interference, EV: empty vector, OE: overexpression. I: Fresh weight of aboveground parts. J: Dry weight of aboveground parts. K: Fresh weight of roots. L: Dry weight of roots. M: Plant height. N: Root length. O: Phosphorus content. N=6, **: P<0.01, ***: P<0.001. Two-tailed assay, error bars represent ± standard deviation. Scale bar: 10 cm.

[0025] Figure 9 Positive identification of GsFER overexpressing soybean transgenic plants. Marker: DL2000.

[0026] Figure 10 Relative expression level of GsFER, phosphorus content, and root phenotypic traits in wild-type and GsFER-overexpressing soybean plants under different phosphorus levels. A: Phenotype of hydroponically grown plants under normal phosphorus conditions; B: Phenotype of hydroponically grown plants under low phosphorus conditions. C, D: Detection of GsFER expression levels in the aboveground (C) and underground (D) parts of hydroponically grown plants; E, F: Phosphorus content in the aboveground (E) and underground (F) parts. Scale bar: 10 cm. N = 3, *: P < 0.05, **: P < 0.01. Two-tailed assay, error bars represent ± standard deviation. Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] Unless otherwise specified, the methods used in the following embodiments are conventional methods.

[0029] Example 1: Cloning and Expression Characterization of Soybean GsFER

[0030] 1) Cloning of the soybean receptor kinase protein encoding gene GsFER

[0031] The CDS sequence of GsFER was obtained online from the soybean genome database (https: / / www.wildsoydb.org / Gsoja_W05 / gene-details / single-gene / ). Cloning primers FER-C were designed at the 5' UTR and 3' UTR using Prime Premier 5 software (Table 1). The leaves of the wild soybean variety HAAS_011, a high-phosphorus material, were collected, ground in a mortar, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to another 1.5 mL EP tube, and total RNA was extracted using an RNA extraction kit (Shanghai Pudi). The quality of the total RNA was assessed by gel electrophoresis, and the RNA content was determined by spectrophotometry. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the Novizan HiScript III 1st Strand cDNA Synthesis Kit (Nanjing). After obtaining the first strand of cDNA, PCR amplification was performed using the PCR program set as shown in Table 2. The mixture was then kept at 4°C to obtain the cDNA of HAAS_011.

[0032] Table 1. GsFER-related primers

[0033]

[0034] Table 2. PCR reaction procedure for cloning GsFER

[0035]

[0036] PCR products were detected using 1% agarose gel electrophoresis, and... The target product was purified and recovered using the Gel DNA Extraction Mini Kit, and the purified product was sent to the company for sequencing. The target fragment was ligated into the TA / Blunt-Zero Cloning Kit vector (T vector) for 5 min. Subsequently, it was transformed into E. coli DH5α. After the bacterial culture was positive by PCR, it was sent to the biotechnology company for sequencing verification. After successful verification, a 1215 bp fragment was obtained. Figure 1 The T-vector of the target gene CDS was prepared. The GsFER sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The gene sequence shown in SEQ ID NO.1 was synthesized by Qingke Biotechnology Co., Ltd., and the synthesized gene fragment was used to construct T-GsFER (T vector).

[0037] 2) Tissue expression analysis of GsFER

[0038] NJAU_W076 was selected as the experimental variety. After seed sterilization, the seeds were planted in a glass greenhouse at Nanjing Agricultural University. Roots, stems, and leaves were collected at the V3 stage of soybean seedlings; flowers were collected at full bloom; and pods and seeds were collected 50 days after flowering. All tissue samples were flash-frozen in liquid nitrogen and stored at -80℃. Total RNA extraction was performed as in Example 1(1). Using the total RNA from each tissue as a template, cDNA was reverse transcribed. The GsFER quantitative PCR primer sequence was FER-Q (Table 1). The relative expression levels of genes in each tissue were detected by real-time quantitative PCR (Real-time RT-PCR). The reagent used for RT-PCR was Novizan's ChamQ UniversalSYBR qPCR Master Mix (Q711). Soybean Tubulin (GenBank: AY907703.1) was used as an internal reference gene, with the primer sequence Tublin-Q (Table 1). The expression level of the target gene was measured using 2... -ΔΔCT The method was used for calculation, and the results showed that GsFER was mainly expressed in soybean flowers and seeds. Figure 2 ).

[0039] 3) Subcellular localization of GsFER

[0040] Specific primers were designed to amplify the CDS sequence of GsFER without a stop codon from the T-GsFER vector via PCR. This sequence was then inserted into the pFGC5941 expression vector containing a GFP tag (double digested with Xho I and BamHI). The PCR product and the digested linear vector were then used... A subcellular localization vector for GsFER was constructed using the Entry One Step Cloning Kit (C115). This vector possesses a 35S promoter, which strongly induces the expression of the target gene GsFER in the recipient. The vector (35S::GsFER::GFP) was transformed into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method. Simultaneously, the empty vector pFGC5941 was also transformed into EHA105 as an empty vector control (35S::GFP). The primer sequences for vector construction were FER-P2 (Table 1).

[0041] Bacterial suspensions containing 35S::GsFER::GFP and 35S::GFP vectors were co-injected with bacterial suspensions containing mCherry tag vectors into leaves of approximately 5-week-old *Nicotiana benthamiana*. After culturing for 36-48 hours, the localization of the reporter gene GFP was observed using a Leica TCS SP2 laser confocal microscope. GFP signal analysis showed that the GsFER::GFP fusion protein was localized on the cell membrane, while the empty vector was localized throughout the entire tobacco cell. Figure 3 ).

[0042] 4) Analysis of GsFER-induced expression under different phosphorus levels

[0043] Wild soybean seeds of uniform size, smooth surface, and free of disease spots were selected from extreme materials NJAU_W076 (high phosphorus efficiency) and HAAS_204 (low phosphorus efficiency). These seeds were sterilized with chlorine for 6 hours, and then evenly planted in flowerpots containing sterile soil. Normal phosphorus modified Hoagland solution (NP) and low phosphorus modified Hoagland solution (LP) were purchased from Coolaber Company; the reagent formulations are shown in Table 3. The experiment was conducted using a hydroponic method. Seedlings were transferred to plastic hydroponic boxes before the first pair of true leaves emerged. Two treatments were applied: normal phosphorus and low phosphorus. The nutrient solution was changed every three days. After 0 hours, 12 hours, 7 days, and 15 days of cultivation, roots of six seedlings of each variety were collected and immediately flash-frozen in liquid nitrogen at -80°C.

[0044] After 15 days of treatment, the low-phosphorus material HAAS_204 showed significantly higher GsFER expression levels under low-phosphorus conditions compared to normal phosphorus treatment; while after 7 days of treatment, the high-phosphorus material NJAU_W076 showed significantly lower GsFER expression levels under low-phosphorus conditions compared to normal phosphorus treatment. Figure 4 The results indicate that GsFER exhibits opposite expression patterns in phosphorus-inefficient and phosphorus-efficient materials, suggesting it may be involved in the regulation pathway of low phosphorus tolerance in soybeans.

[0045] Table 3. Formula for Modified Hoagland Nutrient Solution

[0046]

[0047] Example 2: Genetic Engineering Application of the Soybean Gene GsFER

[0048] 1) Construction of plant expression vector for soybean receptor kinase protein encoding gene GsFER

[0049] When constructing the GsFER overexpression vector for stable transformation in Arabidopsis and soybean, primers FER-PBA (Table 2) containing the full-length GsFER, MIUI, and Sac I restriction site adapters were designed. PCR amplification was performed using the preserved T-GsFER plasmid as a template. The Entry One Step Cloning Kit (C115) was used to recombine the PCR product with the linear vector pBA002 (double digestion with MIUI and SacI) to construct the overexpression vector pBA002-GsFER. After successful sequencing, the vector was transformed into Agrobacterium tumefaciens EHA105. The sequencing primers were 35S (Table 2).

[0050] When constructing the overexpression vector for soybean hairy root transformation, primers FER-pMDC83 (Table 2) containing double restriction enzyme sites (BamHI and KpnI) of the overexpression vector (pMDC83) were designed. The complete CDS sequence of GsFER with a linker was cloned from the T-GsFER vector synthesized by a biotechnology company. The pMDC83 vector sequence was digested with double enzymes (BamHI and KpnI), and the recombinant vector pMDC83-GsFER was constructed using ligase. The plant transformation vector pMDC83 contains a strong 2×35S promoter, which strongly induces the expression of the target gene GsFER in the recipient. Then, pMDC83-GsFER and the empty vector were transformed into Agrobacterium rhizogenes strain K599 using a freeze-thaw method.

[0051] When constructing the RNA interference vector, approximately 300 bp of the CDS sequence of the GsFER gene was selected and compared with that of Invitrogen. Technology with Clonase TM The pDONR221 vector in Kit II was subjected to a BP reaction and verified by bacterial culture PCR sequencing. The primer sequence was FER-Ri (Table 1). The specific PCR procedure was the same as step 1) in Case Implementation 1, obtaining the entry clone. Next, the obtained entry clone was recombinated with the target expression vector pB7GWIWG2(II) developed by Invitrogen to obtain the pB7GWIWG2(II)-GsFER plant interference vector. The constructed vector pB7GWIWG2(II)-GsFER and the empty vector pB7GWIWG2(II) were transformed into Agrobacterium rhizogenes strain K599.

[0052] 2) Phenotypic identification of Arabidopsis FER transgenic materials under different phosphorus conditions

[0053] I purchased Arabidopsis thaliana T-DNA insertion mutant fer from the Arashare website (https: / / www.arashare.cn / index / Product / index.html). According to the website information, I performed PCR to confirm fer-positive homozygosity. Figure 5 The mutant was detected using a three-primer method. The primers were: LP: TGGTAGGATTCCGTTAAAATGC; RP: CAGAGTATTTCAGACGGCAGC; LB: ATTTTGCCGATTTCGGAAC.

[0054] Arabidopsis thaliana was transformed using the flower-dipping method, in which wild-type Arabidopsis thaliana (Col-0) flower buds were immersed in OD... 600A solution of 5% sucrose and 0.03% surfactant containing the pBA002-GsFER vector (0.8-1.0 g) was used for infection for 30 seconds to 1 minute. Plants were wrapped in plastic wrap or plastic bags to maintain humidity and cultured in the dark for 24 hours before transplanting to normal light conditions. Multiple infections were performed during the flowering period, and seeds were harvested. The harvested seeds were sown in NP MS medium supplemented with glufosinate selection agent. Positive plants were screened, and DNA was extracted from Arabidopsis leaves for positive identification by PCR. Figure 5 The positive identification primers are 35S-F and FER-PBA-R listed in Table 1.

[0055] Seeds of *Arabidopsis thaliana* expressing Col-0, fer mutants, and GsFER were sown in LP / NP MS medium. Taproot length and lateral root number were measured 14 days later. Under LP conditions, both aboveground and belowground growth of *Arabidopsis thaliana* plants were inhibited. Figure 6 ).

[0056] Under NP conditions, the primary root length and lateral root number of the fer mutant were significantly higher than those of the WT and GsFER overexpressing plants. Under LP conditions, the primary root length of the GsFER overexpressing plants was significantly higher than that of the fer mutant, and the lateral root number of the fer mutant was significantly higher than that of the GsFER overexpressing plants. Figure 6 ).

[0057] Under LP conditions, all plants exhibited a decrease in taproot length and an increase in the number of lateral roots. Figure 6 This aligns with previous studies showing that Arabidopsis thaliana responds to low phosphorus stress by reducing taproot length and increasing lateral root length and density.

[0058] During the culture process, it was also found that the fer mutant plants grew a large number of obvious root hairs under low phosphorus conditions, while this phenomenon was not observed in WT plants and GsFER overexpression plants. Figure 7 ).

[0059] Phenotypic identification results of transgenic Arabidopsis thaliana indicate that the fer mutant may have certain advantages in root length growth under NP conditions and in lateral root development under LP conditions.

[0060] 3) GsFER affects phosphorus absorption in soybeans under normal phosphorus levels.

[0061] Soybean plants transferred to the empty vectors pMDC83 and pB7GWIWG2(II), the pMDC83-GsFER overexpression vector, and the RNA interference vector pB7GWIWG2(II)-GsFER (as described in Example 2, paragraph 1) were subjected to hydroponic experiments with normal and low phosphorus levels. Phenotypic data of the plants were measured after 14 days. The results showed that the plants cultured with normal phosphorus levels exhibited better growth than those under low phosphorus conditions. Specifically, the aboveground dry weight and fresh weight, as well as the underground fresh weight and dry weight, of the plants cultured with normal phosphorus levels were significantly higher than those cultured with low phosphorus levels. Figure 8 Under normal phosphorus conditions, the fresh weight of the underground parts of soybean plants overexpressing GsFER in their hairy roots was significantly higher than that of plants overexpressing the empty vector. Figure 8 Under normal phosphorus conditions, the phosphorus content of hairy roots transformed with the GsFER RNA interference vector was significantly lower than that of the control hairy roots. Figure 8 The result indicates that GsFER may affect phosphorus absorption.

[0062] 4) GsFER promotes phosphorus absorption in soybeans under low phosphorus conditions.

[0063] The Agrobacterium tumefaciens strain EHA105 containing the pBA002-GsFER vector obtained in step 1) was transformed into soybeans using the cotyledon node transformation method. Positive identification of the obtained soybean plants was then performed. Figure 9 Germinating positive overexpression soybean plants were transferred to LP / NP medium for culture, with the medium changed every three days. After 14 days, samples were taken for qRT-PCR experiments to detect the transcription level of GsFER in the aboveground leaves and underground roots of GsFER-overexpressing transgenic soybeans and control plants; at the same time, the phosphorus content in the aboveground and underground parts of the overexpressing and control plants was detected.

[0064] qRT-PCR results showed that the expression level of GsFER in the aboveground leaves was significantly increased under low phosphorus conditions. Figure 10 This indicates that overexpression of GsFER has a certain effect on increasing the expression level of GsFER.

[0065] Phosphorus content was measured in the aboveground and underground parts of Jack and GsFER-overexpressing soybean plants under normal and low phosphorus treatments. Under normal phosphorus conditions, there was no significant difference in phosphorus content between the aboveground leaves and underground roots. However, under low phosphorus conditions, the phosphorus content in both the aboveground leaves and underground roots of GsFER-overexpressing plants was significantly higher than that of Jack plants. Figure 10 The results suggest that GsFER may promote phosphorus uptake by plants under low phosphorus conditions.

Claims

1. Application of the wild soybean receptor protein kinase encoding gene GsFER in genetically engineered soybeans to tolerate low phosphorus stress, wherein the GsFER gene encodes the receptor protein kinase FERONIA, the coding region sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, Overexpression of the GsFER gene can increase the phosphorus content in the aboveground leaves and underground roots of plants under low phosphorus conditions.

3. The application of the recombinant expression vector overexpressing the wild soybean receptor protein kinase encoding gene GsFER as described in claim 1 in the genetic engineering modification of soybeans to tolerate low phosphorus stress.

4. The application according to claim 3, characterized in that, The recombinant expression vector described above can increase the phosphorus content in the aboveground leaves and underground roots of plants under low phosphorus conditions.

Images