Application of ZmGRF6 in regulating corn plant height

Abstract

The application relates to the field of biotechnology, and particularly discloses application of ZmGRF6 in regulating corn plant height. The ZmGRF6 is derived from corn, and the nucleotide sequence is shown as SEQ ID NO. 1. rZmGRF6 is obtained by performing a synonymous mutation on a site combined with miR396 on a ZmGRF6 CDS sequence, mismatch of the two avoids ZmGRF6 transcript from being cut, and improves the expression level of the ZmGRF6 gene. The transgenic corn overexpressing rZmGRF6-GFP has a plant height which is about one third lower than that of a wild type plant. The application provides a gene for reducing the corn plant height, and has important application value for creating and cultivating a corn variety with moderate dwarf.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ZmGRF6 in regulating maize plant height. Background Technology

[0002] Maize is the most widely planted and highest-yielding cereal crop globally. Compared to other major crops, maize plants are generally taller and exhibit excessively vigorous vegetative growth, leading to production problems such as a lower harvest index, excessive nutrient consumption, and susceptibility to lodging. Therefore, a thorough understanding of the molecular mechanisms controlling maize plant height and the development of appropriately dwarf varieties is of great significance.

[0003] Growth regulating factors (GRFs) are a highly conserved family of transcription factors in plants, playing a crucial role in regulating plant growth and development. GRF family members participate in the regulation of biological processes such as leaf development, stem elongation, flowering and blooming time, root growth, and seed formation, and have important regulatory functions in plant growth and development, signal transduction, stress response, and regeneration efficiency.

[0004] MicroRNAs (miRs) are a highly conserved class of non-coding RNAs in eukaryotes. They pair with target gene transcripts through base complementation and guide the nuclease AGONAUTE to cleave the target or repress translation, thereby regulating target gene expression at the post-transcriptional level. Numerous studies have shown that miRs participate in multiple pathways of plant growth, development, and abiotic stress responses, serving as crucial regulatory elements for plant growth and environmental adaptation. The expression of genetic radiofrequency activating enzymes (GRFs) from different plant sources is post-transcriptionally regulated by miR396. miR396 recognizes complementary sequences in the coding regions of GRF transcripts, guiding AGONAUTE to cleave target RNA, thus regulating the expression level of target genes. Using constitutive promoters to drive target gene expression is an important method for gene overexpression; however, this approach often alters the spatiotemporal expression patterns and causes ectopic expression due to promoter variations, resulting in some negative phenotypes. Synonymous mutations at the miR binding site in the target gene, coupled with expression driven by its own promoter, can disrupt the repressive effect of miRs on gene expression. This significantly increases the expression level of the target gene and improves plant phenotype without altering the expression pattern. A natural mutation at the miR396 binding site in rice OsGRF4 significantly increased yield per plant. Therefore, altering the binding of miRs to target genes through base mutations holds significant potential for application in molecular breeding of crops. Summary of the Invention

[0005] The technical problem to be solved by this invention is to reduce the height of corn plants and create dwarf plants.

[0006] In order to solve the problems existing in the prior art, the purpose of this invention is to provide a method for reducing the height of maize plants.

[0007] To achieve the objective of this invention, the following technical solutions can be used:

[0008] The application of the ZmGRF6 gene in regulating plant height, wherein the ZmGRF6 gene is derived from maize, and its encoded nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2.

[0009] As a preferred embodiment of the present invention, rZmGRF6 is obtained by synonymously mutating the site on the ZmGRF6 CDS sequence that binds to miR396, thereby causing a mismatch between the two, preserving the endogenous promoter and terminator, increasing the expression level of the ZmGRF6 gene, and reducing plant height.

[0010] As a further preferred embodiment of the present invention, the rZmGRF6 nucleotide sequence is shown in SEQ ID NO.3.

[0011] An rZmGRF6 gene, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0012] A recombinant expression vector containing the rZmGRF6 gene described above.

[0013] As a preferred embodiment of the present invention, the promoter and terminator in the overexpression vector construction use the ZmGRF6 self-promoter and terminator.

[0014] DNA was chemically synthesized based on the sequences of the rZmGRF6 coding region (SEQ ID NO.3), promoter (SEQ ID NO.4), and terminator (SEQ ID NO.5), and ligated to the two BsaI restriction sites of the GreenGate system intermediate vectors pGGC000, pGGA000, and pGGE000, respectively, to construct plasmids pGGC-rZmGRF6, pGGA-ZmGRF6pro, and pGGE-ZmGRF6ter. These plasmids were then ligated in equal proportions to other GreenGate system intermediate vectors pGGB003 (N-dummy), pGGD001 (C-GFP), pGGF002 (Basta resistance cassette), and the final vector pGGZ005, followed by transformation to obtain the pGGZ005-rZmGRF6-GFP vector. The nucleotide sequence of rZmGRF6 is shown in SEQ ID NO.3, and the amino acid sequences of ZmGRF6 and rZmGRF6 are shown in SEQ ID NO.2.

[0015] The application of the ZmGRF6 gene and the rZmGRF6 gene described in this invention in the construction of new transgenic plant varieties.

[0016] The application of the ZmGRF6 gene and the rZmGRF6 gene described in this invention in the cultivation of dwarf plants.

[0017] The pGGZ005-rZmGRF6-GFP vector was transformed into the immature embryos of the maize inbred line KN5585 using a Pseudomonas aeruginosa-mediated method. Stable transformed plants of rZmGRF6-GFP were obtained through tissue culture, and the results showed that the height of the transformed plants was significantly shorter. Overexpression of the rZmGRF6 encoding gene, which is not regulated by miR396, in maize increased RNA stability, leading to high expression of the rZmGRF6 encoding gene and reducing maize plant height.

[0018] As a preferred embodiment of the present invention, the application of the ZmGRF6 gene and rZmGRF6 gene in the improvement of plant germplasm resources is described.

[0019] As a further preferred embodiment of the present invention, the plant is corn.

[0020] The beneficial effects of this invention are as follows:

[0021] The constructed pGGZ005-rZmGRF6-GFP vector retains the promoter and terminator elements of the endogenous maize gene ZmGRF6, ensuring that the tissue specificity of ZmGRF6 expression in transgenic plants remains unchanged, thus avoiding the negative phenotypes caused by ectopic expression. The amino acid sequence encoded by rZmGRF6 is consistent with that encoded by the endogenous ZmGRF6, and no changes in protein sequence or activity are produced. However, the transcript is no longer regulated by miR396, resulting in increased expression levels. The resulting rZmGRF6-GFP transgenic maize plant height is reduced to a certain extent (about one-third), but there are no adverse effects on other agronomic traits. Therefore, this gene has important application value in moderate dwarfing breeding. Attached Figure Description

[0022] Figure 1 The construction and structural diagram of the pGGZ005-rZmGRF6-GFP vector. (A) Schematic diagram and sequence of synonymous mutations at the binding sites of miR396 and ZmGRF6; (B) Schematic diagram of the structure of the pGGZ005-rZmGRF6-GFP vector.

[0023] Figure 2 The results of PCR identification of rZmGRF6-GFP transgenic plants (A), and the results of Western blot detection (B) and qRT-PCR detection of ZmGRF6 protein expression level in transgenic plants (C).

[0024] Figure 3 The phenotype of shorter plants after ZmGRF6 overexpression was observed in transgenic plants (A, B) and backcross F1 plants (C). Detailed Implementation

[0025] The present invention will be further explained and illustrated below with reference to embodiments. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the spirit and essence of the invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0027] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0028] Example 1: Construction of pGGZ005-rZmGRF6-GFP vector

[0029] This invention provides primers for constructing the pGGZ005-rZmGRF6-GFP vector, including primers for amplifying the ZmGRF6 promoter nucleotide sequence:

[0030] GRF6-Pro-F: AACAGGTCTCAACCTAGTCTCAGGGTTTCTTTGGATTC

[0031] GRF6-Pro-R:AACAGGTCTCATGTTCAGATACCTGCAGGCTGCA

[0032] Primers used to amplify the ZmGRF6 CDS nucleotide sequence:

[0033] GRF6-CDS-F:AACAGGTCTCAGGCTATGCCGCGAGCTTTGCCTT

[0034] GRF6-CDS-R:AACAGGTCTCACTGACCTTGACGGTATTCCATTCG

[0035] Primers used to amplify the ZmGRF6terminator nucleotide sequence:

[0036] GRF6-Ter-F1:AACAGGTCTCACTGCAGCCGTCGATCCGTAGGC

[0037] GRF6-Ter-R2:AACAGGTCTCATAGTGCTACGACATCATTTCACCAGA

[0038] 1. Cloning and modification of the target fragment

[0039] 1.1 Amplification of ZmGRF6 promoter, CDS, and terminator sequences

[0040] Using the above primers, PCR amplification was performed using the chemically synthesized ZmGRF6 / rZmGRF6 promoter (SEQ ID NO.4) and terminator (SEQ ID NO.5), ZmGRF6 coding region (SEQ ID NO.1), and rZmGRF6 coding region (SEQ ID NO.3) sequences as templates.

[0041] (1) PCR reaction system

[0042]

[0043] (2) Reaction Procedure

[0044] Preheat at 98℃ for 3 min; denature at 98℃ for 10 s, anneal at 58℃ for 30 s, extend at 72℃ for 2 min (30-60 s / kb), 35 cycles; final extend at 72℃ for 5 min; store at 4℃.

[0045] 1.2 Enzyme digestion and recovery of PCR products

[0046] The PCR products and pGGC000, pGGA000 and pGGE000 vectors were digested with BsaI enzyme, and the PCR products were recovered using an agarose gel extraction kit (Gel Mini Purification Kit, purchased from Zomanbio).

[0047] 1.3 Construction of pGGC-rZmGRF6, pGGA-ZmGRF6pro, and pGGE-ZmGRF6ter vectors

[0048] The PCR products obtained from the enzyme digestion and recovery were ligated with the linearized vector using T4-DNA ligase and then transformed. Sequencing was used to confirm the correct clone for preservation.

[0049] 2. Construction of the pGGZ005-rZmGRF6-GFP vector

[0050] The seven module plasmids required for the Greengate reaction system—pGGA-ZmGRF6pro, pGGC-rZmGRF6, pGGE-ZmGRF6ter, pGGB003 (N-dummy), pGGD001 (Linker-GFP), pGGF002 (Basta resistance cassette)—and the final vector pGGZ005 were added and reacted according to the following system:

[0051] (1) PCR reaction system

[0052]

[0053] (2) Reaction Procedure

[0054]

[0055] After overnight ligation in a PCR instrument, the cells were transformed, and colony PCR was performed for verification. Plasmids were extracted from bacterial cultures with appropriate band sizes and sent for sequencing detection, ultimately yielding the pGGZ005-rZmGRF6-GFP vector (e.g., ...). Figure 1 (as shown in B).

[0056] Example 2: Obtaining transgenic maize plants

[0057] The vector was transferred into Agrobacterium EHA105 via electroporation and identified by PCR. Freshly peeled embryos (approximately 1 mm in size) of the maize inbred line KN5585 were placed in centrifuge tubes containing 1.8 mL of suspension. After 30 min, the suspension was removed, and 1.0 mL of Agrobacterium suspension was added to the tubes. After 5 min, the embryos were resuspended and transferred to co-culture medium. Excess Agrobacterium suspension was removed from the surface using a pipette, and the embryos were co-cultured in the dark at 23°C for 3 days. The embryos were then transferred to resting medium and cultured in the dark at 28°C for 6 days. Afterward, they were transferred to selection medium containing 5 mg / L Bialaphos and cultured for 2 weeks. Finally, they were transferred to selection medium containing 8 mg / L Bialaphos and cultured for another 2 weeks. Resistant callus was transferred to differentiation medium 1 and cultured at 25°C, 5000 lx, under light for 1 week. The callus was then transferred to differentiation medium 2 and cultured under light for 2 weeks. The differentiated seedlings were then transferred to rooting medium and cultured at 25°C, 5000 lx, under light until roots formed. The seedlings were then transferred to small pots for growth. After a certain growth stage, they were transplanted to a greenhouse and the offspring seeds were harvested 3-4 months later.

[0058] Example 3: Identification of transgenic positive lines

[0059] The maize seeds obtained in Example 2 and the seeds of the wild-type maize variety KN5585 were disinfected by soaking in a 3% sodium hypochlorite solution for 8 minutes, followed by washing with distilled water 3 to 5 times. Then, the seeds were soaked in water for 12-16 hours to promote water absorption and germination. Throughout the germination process, the seeds were kept in the dark and maintained at a constant temperature of 25-28℃ to simulate a suitable growth environment. Three days later, when the maize embryo length reached 1-2 cm and the radicle length reached 3-4 cm, the maize seedlings were transferred into pots and grown under normal light and temperature conditions for 7 days. The above-ground parts were then harvested for identification of transgenic positive lines.

[0060] 1. PCR detection

[0061] To identify transgenic positive plants, a fresh leaf was taken, DNA was extracted, and PCR testing was performed. Positive lines were initially confirmed using Basta testing, and then amplification was performed again using specific primers on the vector to ensure accurate results. Figure 2 A).

[0062] 2. Western blot detection

[0063] Total protein was extracted from PCR-positive strains and detected by Western blot.

[0064] The pGGZ005-rZmGRF6-GFP vector contains GFP protein. Positive plants were identified using a GFP antibody, and the results are as follows: Figure 2 As shown in Figure B, a specific band appears at around 72 kDa, consistent with the expected molecular weight of ZmGRF6 protein at 68 kDa. Moreover, compared to the control group maize inbred line KN5585, each transgenic line showed a higher protein expression level.

[0065] 3. qRT-PCR detection

[0066] Total RNA was extracted from the aerial parts of PCR-positive strains using the Trizol method and then analyzed using a full-gold reverse transcription kit. The All-in-One First-Strand cDNA Synthesis SuperMix for qPCR was used to reverse transcribe 1 μg of RNA into single-stranded cDNA. The transcription level of the ZmGRF6 gene in transgenic positive lines was detected using qRT-PCR. The qRT-PCR detection method followed the instructions for the ChamQ Universal SYBR qPCR Master Mix (Vazyme).

[0067] (1) PCR reaction system

[0068]

[0069]

[0070] (2) Reaction Procedure

[0071]

[0072] (3) Primers used

[0073] qRT-ZmUBQ-F:CTGGTGCCCTCTCCATATGG

[0074] qRT-ZmUBQ-R: CAACACTGACACGACTCATGACA

[0075] qRT-ZmGRF6-F:CCCATGTACCCATCCATCCTC

[0076] qRT-ZmGRF6-R:CGCCGAACAGAGGGTAGCT

[0077] Each reaction was performed in triplicate. ZmUBQ was used as an internal control gene. Results of real-time PCR experiments were processed in 2... -△△T The method calculates expression levels and plots them, such as... Figure 2 As shown in Figure C, all positive plants exhibited overexpression of ZmGRF6.

[0078] The above test results indicate that the PGGZ005-ubi:rZmGRF6 expression vector has achieved stable expression of the target gene ZmGRF6 in maize.

[0079] 4: Phenotypic identification of overexpressing plants

[0080] Seeds homozygous overexpressing the rZmGRF6 gene obtained in Example 3 and seeds of wild-type maize variety KN5585 were sown in spring in Anji, Zhejiang (119°21'24"E, 30°29'57"N). After the tassels fully emerged, the plant height was observed and counted. Ten plants from each line were used for the statistical analysis.

[0081] Through field phenotypic observation, the results are as follows: Figure 3 As shown in Figures A and B, the plant height of rZmGRF6-GFP showed a significant decreasing trend compared to the wild type. This indicates that in situ overexpression of ZmGRF6 leads to a decrease in plant height.

[0082] Example 4: rZmGRF6-GFP heterozygotes can reduce maize plant height

[0083] Seeds homozygous overexpressing the rZmGRF6-GFP gene obtained in Example 3 and seeds of the wild-type maize variety KN5585 were sown. When the pollen matured, the pollen from the male tassel of the rZmGRF6 line was transferred to the female ear of the KN5585 line for backcrossing. The F1 generation seeds harvested from the backcross were sown the following year. After the male tassels fully emerged, the plant height was observed.

[0084] Through field phenotypic observation, the results are as follows: Figure 3 As shown in Figure C, compared with the wild type, the plant height of the FI generation maize backcrossed from rZmGRF6 and KN5585 was significantly lower than that of the wild type. This indicates that the reduction in maize plant height due to overexpression of ZmGRF6 is a dominant phenotype.

[0085] The present invention has been described in detail above. Those skilled in the art will recognize that, without departing from the spirit and scope of the invention, the invention can be implemented within a wide range under equivalent parameters and conditions. However, further modifications can be made to the invention. In short, all such modifications or improvements made without departing from the spirit of the invention fall within the scope of protection claimed by the present invention.

Claims

1. Overexpression rZmGRF6 The application of genes in reducing maize plant height is characterized by, rZmGRF6 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

2. Overexpression of the substance described in claim 1 rZmGRF6 Application of genes in the breeding of dwarf maize plants.

Images