Chimeric antigen receptor T cell with long-term tumor suppression effect and preparation method and use thereof

Abstract

The present invention relates to the field of biotechnology, and specifically to a chimeric antigen receptor T cell with a long-term tumor suppression effect, a preparation method and a use thereof, wherein the chimeric antigen receptor T cell with a long-term tumor suppression effect is a chimeric antigen receptor T cell with the gene ARID1A knocked out; the Gene ID of the gene ARID1A is 8289; the chimeric antigen receptor T cell is a chimeric antigen receptor T cell targeting CD133. The present invention knocks out the ARID1A gene of a specific chimeric antigen receptor T cell, CD133 CAR-T cell, so that it has a lower expression of exhaustion indicators (PD-1, TIM-3), obtains a more lasting tumor suppression effect, reduces tumor volume, and prolongs the survival rate after suffering from a tumor, and has practical promotion and application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a chimeric antigen receptor T cell with long-lasting tumor-suppressing effect, and a preparation method and use thereof. Background Art

[0002] CAR-T therapy, or Chimeric Antigen Receptor T-Cell Immunotherapy, is a new immunotherapy method that uses genetic engineering technology to modify the patient's own T cells so that they can accurately identify and kill cancer cells. Its basic principle is to use genetic engineering to embed a certain tumor antigen receptor gene on the cell membrane of T cells to form modified T cells, which can specifically recognize and bind to antigens on the surface of tumor cells, thereby achieving specific killing of tumor cells. At present, the efficacy of CAR-T therapy in solid tumor cancers is still not ideal. About 30-50% of patients relapse rapidly after receiving CAR-T treatment. One of the key reasons is its poor persistence in the body. After CAR-T continues to stay in the tumor microenvironment of solid tumors and is exposed to antigens and immunosuppressive signals, it will be quickly exhausted, affecting its ability to exert a sustained tumor killing effect. The proliferation ability of T cells is also related to the cells' persistent tumor suppression.

[0003] Inhibiting or delaying the exhaustion of adoptive immune cells, enhancing their long-term proliferation activity, and prolonging their anti-tumor efficacy are key directions to solve the current bottleneck of cell immunotherapy for solid tumors. However, T cell exhaustion involves multiple signaling pathways and molecular mechanisms. Different signaling pathways and molecular interactions form a network, making it complex and challenging to intervene in T cell exhaustion by perturbing gene regulation. In recent years, hundreds of genes have been reported to be related to the regulation of T cell exhaustion. Some of these genes have obvious differences in their roles in T cell exhaustion due to the influence of different T cells and tumor model factors, thus showing completely different tumor killing abilities. For example, the role of transcription factor BATF in CAR-T cell exhaustion is complex and dual. Some studies have shown that its overexpression in CD8 CAR T cells can reduce the expression of exhaustion-related transcription factors, thereby enhancing the tumor killing ability of CAR-T cells. Some studies have shown that knocking out BATF can improve the anti-tumor activity of CAR-T cells. Some genes are limited by epigenetic background and the complexity of signal transduction pathways. At the gene level, they show the effect of improving the expression of T cell exhaustion indicators, but these changes cannot be converted into effective immune responses in cell animal models, and cannot actually improve the anti-tumor activity of CAR-T cells. These problems make it difficult to further edit human T cells based on CAR and improve the efficacy of CAR-T cell immunotherapy.

[0004] Therefore, it is necessary to find specific chimeric antigen receptor T cells that can achieve more lasting tumor suppression effects and improve anti-tumor, especially breast tumor, for use in actual clinical practice. Summary of the invention

[0005] To solve the above problems, the present invention aims to provide a chimeric antigen receptor T cell with a long-term tumor suppression effect, which is a chimeric antigen receptor T cell with the ARID1A gene knocked out;

[0006] The Gene ID of the gene ARID1A is 8289.

[0007] Further, the chimeric antigen receptor T cell is a chimeric antigen receptor T cell targeting CD133;

[0008] Furthermore, the chimeric antigen receptor T cells targeting CD133 are T cells into which CD133 CAR gene fragments are introduced;

[0009] The nucleotide sequence of the CD133 CAR gene fragment is shown in SEQ ID NO.4.

[0010] Further, the gene ARID1A was knocked out from chimeric antigen receptor T cells using the CRISPR / Cas9 gene editing system;

[0011] The sgRNA in the CRISPR / Cas9 gene editing system is a 2'-O-methylthiophosphorylation-modified sgRNA, and its nucleotide sequence is shown in SEQ ID NO.1~2.

[0012] The present invention also provides a method for preparing the aforementioned chimeric antigen receptor T cell, comprising the following steps:

[0013] Take T cells, introduce CD133 CAR gene fragments, and obtain CD133 CAR-T cells; take CD133 CAR-T cells, electroporate 2'-O-methylthiophosphorylated modified sgRNA and Cas9 nuclease, and culture.

[0014] Furthermore, the steps are specifically as follows:

[0015] 1) Take T cells, add anti-CD3 / CD28 magnetic beads, activate T cells and transfer them to a plate coated with RetroNectin, add HIV-type CD133 CAR lentiviral concentrate and induction reagent, mix well, culture for 12-36 hours, add T cell complete medium and continue to culture for 12-36 hours, then transfer to a plate without RetroNectin coating, add T cell complete medium and culture, perform T cell passage every 2 days, and harvest the 6th-7th generation CD133 CAR-T cells;

[0016] 2) Take the solution of 2'-O-methylphosphorothioate-modified sgRNA, mix it with Duplex Buffer and Cas9 nuclease, and incubate it to obtain a mixed reaction solution;

[0017] 3) Place the CD133 CAR-T cells obtained in step 1) in a nuclear electroporator, resuspend them in Opti-MEM, and then add the mixed reaction solution obtained in step 2) to mix well. After electroporation, take the CD133 CAR-T cells and add T cell complete medium to culture for 4 to 7 days. Sequence the cells and perform flow cytometry to collect the CD133 CAR-T cells with ARID1A gene knockout.

[0018] Furthermore, in step 1), the ratio of the number of T cells to anti-CD3 / CD28 magnetic beads is 1:3; each well of the well plate has 1×10 6 cells, add lentiviral concentrate to a multiplicity of infection of 20, add induction reagent to a total volume of 1 ml per well, and add T cell complete medium to a total volume of 2 ml per well;

[0019] The sensitizing agent is HitransGA, which is diluted with T cell complete culture medium at a volume ratio of 1:25 when used;

[0020] The culture temperature is 37°C;

[0021] The T cells are human T cells.

[0022] Furthermore, in step 2), the volume mass ratio of the sgRNA solution to the Duplex Buffer and the Cas9 nuclease is 5 μL: 2.5 μL: 2.5 μg;

[0023] The sgRNA solution is a solution prepared by diluting two 2'-O-methylthiophosphorylated sgRNAs into 90-110 μM by adding 1×TE buffer respectively and then mixing them in equal volumes;

[0024] The nucleotide sequences of the two 2'-O-methylthiophosphorylation-modified sgRNAs are shown in SEQ ID NO. 1-2;

[0025] The incubation is carried out at room temperature for 25 to 35 minutes.

[0026] and / or:

[0027] Step 3) The CD133 CAR-T cells were resuspended in Opti-MEM to a cell concentration of 10 6~8 / ml;

[0028] The volume ratio of the Opti-MEM to the blended reaction solution is 92-93:7-8;

[0029] The culture temperature was 35-38° C., and the complete T cell culture medium was replaced every 2 days during the culture period.

[0030] and / or:

[0031] The complete T cell culture medium is ImmunoCult™-XF TCell Expansion Medium containing 10 ng / ml IL-2.

[0032] Furthermore, the preparation method of the HIV-type CD133 CAR lentiviral concentrate comprises the following steps:

[0033] a. Take 293T cells in the logarithmic growth phase, add DMEM high-glucose medium containing FBS and culture until the cell density reaches 70-90%, and obtain the cell solution to be transfected; take physiological saline containing shuttle plasmid pHBLV-EF1A-CD133 CAR, auxiliary plasmid pSPAX2 and auxiliary plasmid pMD2.G, add physiological saline containing PEI, mix well, and let stand to obtain a mixed solution;

[0034] b. Take the cell solution to be transfected obtained in step a, discard the liquid and resuspend it with an equal volume of new DMEM high-glucose medium containing FBS, then add the mixed solution obtained in step a to transfect for 6 to 12 hours, discard the liquid and add DMEM high-glucose medium containing FBS to culture for 48 to 72 hours, collect the cell culture supernatant to obtain a lentiviral vector solution;

[0035] c. Centrifuge the lentiviral vector solution obtained in step b, take the supernatant and mix it with Lenti-X concentrate, incubate it, collect the precipitate by centrifugation, and finally resuspend it with PBS buffer solution to obtain the result;

[0036] Furthermore, the DMEM high-glucose medium containing FBS in step a was added to a cell concentration of 5 × 10 6 pcs / 10 mL;

[0037] The volume ratio of the physiological saline containing the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G to the physiological saline containing PEI is 1:1;

[0038] The physiological saline containing the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G contains 24 µg of plasmid per 500 µl;

[0039] The mass ratio of the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G is 4:3:1;

[0040] The PEI-containing physiological saline contains 60 µg PEI per 500 µl;

[0041] The step of standing for 10 to 30 minutes;

[0042] And / or: during the transfection in step b, the volume ratio of the DMEM high-glucose medium containing FBS to the mixed solution is 6-10 ml:1 ml; during the culture, the amount of the DMEM high-glucose medium containing FBS added is 1-2 times the volume of the cell solution to be transfected;

[0043] And / or: the volume ratio of the supernatant in step c to the Lenti-X concentrate is 3:1; the amount of the PBS buffer solution is 1 / 10 to 1 / 100 of the volume of the mixed solution before incubation;

[0044] The incubation conditions are 2-8°C for 6-12 hours; the centrifugation conditions for collecting the precipitate are 2-8°C, 1000-1500 xg for 40-60 minutes; the centrifugation conditions for collecting the supernatant are 100-800 xg for 5-15 minutes;

[0045] and / or:

[0046] The concentration of FBS in the DMEM high-glucose medium containing FBS is 10%;

[0047] The shuttle plasmid pHBLV-EF1A-CD133 CAR is a recombinant vector prepared by connecting the CD133 CAR gene fragment with a nucleotide sequence as shown in SEQ ID NO.4 to the pHBLV-EF1A-MCS lentiviral vector;

[0048] The culture conditions are a temperature of 35-38°C and a CO2 concentration of 4-6%.

[0049] The present invention also provides a use of the chimeric antigen receptor T cell in preparing a drug for treating tumors, wherein the tumor includes breast cancer.

[0050] Finally, the present invention provides a drug for treating tumors, which is a preparation prepared by adding the aforementioned chimeric antigen receptor T cells and pharmaceutically acceptable excipients.

[0051] The present invention achieves a more lasting tumor suppression effect, reduces tumor volume, and prolongs the survival rate after tumor development by knocking out the ARID1A gene of a specific chimeric antigen receptor T cell, CD133 CAR-T, so that it has lower expression of exhaustion indicators (PD-1, TIM-3), and has practical value for promotion and application.

[0052] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0053] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 It is the flow result of the exhaustion index after stimulation;

[0055] Figure 2 It is the signaling pathway with the top ranking of sgRNA-enriched genes in sequencing analysis;

[0056] Figure 3 The CAR+ ratio and cell proliferation of CD133 CAR-T;

[0057] Figure 4 This is the flow cytometry result of the exhaustion index of ARID1A knockout CD133 CAR-T after stimulation;

[0058] Figure 5 The expression of in vivo tumor suppression, survival, and exhaustion indexes of tumor-infiltrating CAR-T by CD133 CAR-T with ARID1A knockout;

[0059] Figure 6 The flow cytometry results of the in vitro validation of the exhaustion index of ARID1A knockout DLL3 CAR-T;

[0060] Figure 7 Comparison of the long-term tumor suppression effect of ARID1A knockout DLL3 CAR-T in vivo;

[0061] Figure 8 PHBLV-EF1A-CD133 CAR plasmid map. DETAILED DESCRIPTION

[0062] The raw materials and equipment used in the specific embodiments of the present invention are all known products, which are obtained by purchasing commercial products. Among them, two 2'-O-methylthiophosphorylation-modified sgRNAs targeting the ARID1A gene were synthesized by Suzhou Genewise Biotechnology Co., Ltd. The nucleotide sequences of the two sgRNAs are

[0063] SEQ ID NO.1: UCUCGGGGAGCUCAGCGCGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCUUUU;

[0064] The nucleotide sequence after 2'-O-methylphosphorothioate modification is

[0065] mU*mC*mU*CGGGGAGCUCAGCGCGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU*mU*mU*mU;

[0066] Note: "mU*mC*mU*" means that uracil, cytosine and uracil at the 5' end are modified by 2'-O-methylphosphorothioate, and *mU*mU*mU means that the three uracils at the 3' end are modified by 2'-O-methylphosphorothioate.

[0067] SEQ ID NO.2:

[0068] CAGCAGAACUCUCACGACCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0069] The nucleotide sequence after 2'-O-methylphosphorothioate modification is

[0070] mC*mA*mG*CAGAACUCUCACGACCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU*mU*mU*mU

[0071] Note: “mC*mA*mG*” refers to the cytosine, adenine and guanine at the 5' end being modified by 2'-O-methylphosphorothioate, *mU*mU*mU refers to the three uracils at the 3' end being modified by 2'-O-methylphosphorothioate;

[0072] CD133 CDS was synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and its nucleotide sequence is SEQ ID NO.3:

[0073]

[0074] The CD133 CAR gene fragment was synthesized by Jiangsu Jinweizhi Biotechnology Co., Ltd., and its nucleotide sequence is SEQ ID NO.4:

[0075]

[0076] The shuttle plasmid pHBLV-EF1A-CD133 CAR is a recombinant vector made by connecting the CD133 CAR gene fragment to the pHBLV-EF1A-MCS lentiviral vector. The plasmid map is shown in Figure 8 shown.

[0077] Complete T cell culture medium was prepared by adding 10 ng / ml IL-2 (STEMCELL, Catalog No. 78036) to ImmunoCult™-XF T Cell Expansion Medium (STEMCELL, Catalog No. 10981).

[0078] Example 1 Preparation of long-acting tumor-suppressing chimeric antigen receptor T cells

[0079] 1) Preparation of CD133 CAR-T cells

[0080] Primary human T cells were inoculated in a 24-well cell culture plate at a concentration of 1×10 6 Anti-CD3 / CD28 magnetic beads were added at a cell:magnetic bead ratio of 1:3. After 24 hours, T cells were plated at 1×10 6 Transfer the cells / well to the RetroNectin-coated plate, add HIV CD133 CAR lentiviral concentrate to make the infection multiplicity 20, add the induction reagent HitransGA to make the total volume of each well 1ml, mix well, place in a 37℃ incubator for 24h, add T cell complete medium to make the total volume of each well 2ml, take T cells at 1×10 after 24h of culture, and add 1×10 6 Transfer cells / well to a new well plate without RetroNectin coating, add 2 ml / well of T cell complete medium and continue culturing. Perform T cell passage every 2 days and harvest the 6th-7th generation CD133 CAR-T cells;

[0081] Among them, HitransGA was diluted with T cell complete medium when used, and the volume ratio of HitransGA to T cell complete medium was 1:25;

[0082] The preparation method of HIV type CD133 CAR lentiviral concentrate is as follows:

[0083] a. Take 293T cells in the logarithmic growth phase and add DMEM high-glucose medium containing 10% fetal bovine serum (FBS) to 5 × 10 610 mL, culture at 37 °C, 5% CO2 until the cell density reaches 80%, and obtain the cell solution to be transfected; take 500 µl of saline containing 24 µg of shuttle plasmid pHBLV-EF1A-CD133 CAR, auxiliary plasmid pSPAX2 and auxiliary plasmid pMD2.G in a mass ratio of 4:3:1, add 500 µl of saline containing 60 µg of PEI, mix well, and let stand for 20 min to obtain a mixed solution;

[0084] b. Take 8 mL of the cell solution to be transfected obtained in step a, discard the liquid and resuspend it with an equal volume of new DMEM high-glucose medium containing 10% FBS, then add the mixed solution obtained in step a to transfect for 6-12 hours, discard the liquid and add 10 mL of DMEM high-glucose medium containing 10% FBS, culture at 37°C, 5% CO2 for 48-72 hours, collect the cell culture supernatant, and obtain a lentiviral vector solution;

[0085] c. Centrifuge the lentiviral vector solution obtained in step b at 500 xg for 10 min, mix the supernatant with Lenti-X concentrate at a volume ratio of 3:1, incubate at 4°C for 6-12 h, centrifuge at 4°C, 1,500 xg for 45 min to collect the precipitate, and finally resuspend it in PBS to 1 / 10 to 1 / 100 of the volume of the mixed solution before incubation.

[0086] 2) CD133 CAR-T cells with ARID1A knockout

[0087] ① Take 2'-O-methylthiophosphorothioate-modified sgRNA (SEQ ID NO.1~2) respectively, add 1×TE buffer to mix to make 100μM sgRNA master solution, and mix the master solutions of the two sgRNAs in equal volumes to obtain sgRNA solution;

[0088] ② Take 5 μL of the sgRNA solution obtained in step ① and incubate with 2.5 μL Duplex Buffer and 2.5 μg Cas9 nuclease at room temperature for 30 min to obtain a mixed reaction solution;

[0089] ③ Take the CD133 CAR-T cells obtained in step 1) and place them in a nuclear electroporator. Add 92.5 μl of Opti-MEM and resuspend them to a cell concentration of 10 7 / ml, then add 7.5μL of the mixed reaction solution obtained in step ② and mix well. After electroporation, culture with complete T cell culture medium at 37°C. During this period, the complete T cell culture medium was changed every 2 days. After 4-7 days of culture, the cells were sequenced and detected by flow cytometry to obtain CD133 CAR-T cells with ARID1A gene knockout.

[0090] The beneficial effects of the present invention are further illustrated by test examples below.

[0091] Experimental Example 1 Study on long-acting anti-tumor chimeric antigen receptor T cells

[0092] In the early stage, the human primary T cell CRISPR KO library was screened and then induced by non-specific activation model, and it was determined that some sgRNA-positive T cells and CAR-T cells showed significant expression of exhaustion indicators ( Figure 1 Based on the screened CAR-T cells, high-throughput sequencing was performed on the integrated sgRNA sequences to determine the enriched signal pathways. By analyzing the signal pathways with the top enriched genes ( Figure 2 ), and found that different genes affect the expression of exhaustion indicators of different targeted CAR-T cells; genes in the chromatin remodeling signaling pathway related to epigenetic regulation are closely related to genes in the cell exhaustion regulation signaling pathway and TCF1, a key gene related to T cell stemness; gene ARID1A (Gene ID: 8289) belongs to the gene in the chromatin remodeling signaling pathway.

[0093] We are now further knocking out the specific gene ARID1A in the chromatin remodeling signaling pathway in different targeted CAR-T cells, hoping to improve CAR-T cell exhaustion by regulating chromatin remodeling, thereby improving the tumor suppression effect, and ultimately obtaining long-acting tumor suppression CAR-T cells that are expected to be used in clinical practice.

[0094] 1. Effect of knocking out the ARID1A gene in CD133 CAR-T on long-term tumor suppression

[0095] (1) Construction of CD133 CAR-T.

[0096] 1) CAR-T cell preparation

[0097] Primary human T cells were inoculated in a 24-well cell culture plate at a concentration of 1×10 6 1×10 cells / well, anti-CD3 / CD28 magnetic beads were added to activate T cells at a cell:magnetic beads ratio of 1:3. 24 hours after adding magnetic beads, T cells were plated at 1×10 6Transfer the cells / well to a RetroNectin-coated plate, add HIV-type CD133 CAR lentiviral concentrate to a multiplicity of infection of 20, and add the induction reagent HitransGA to make the final total volume reach 1 ml / well (when using the induction reagent, dilute it with T cell complete medium at a volume ratio of 1:25 to obtain a 1× working solution; HitransGA is provided by Shanghai Genechem Gene Medicine Technology Co., Ltd., catalog number genechem REVG004), mix well, place in a 37°C incubator for 24 hours, then add T cell complete medium to 2 ml / well, and after another 24 hours, dilute at a volume ratio of 1×10 6 The cells were passaged to new well plates without RetroNectin coating, and 2 ml of T cell complete medium was added to continue the culture. T cells were passaged every 2 days, and the expanded CD133 CAR-T cells of passage 6-7 were harvested.

[0098] Among them, HIV-type CD133 CAR lentiviral concentrate is prepared by the following method:

[0099] ① Preparation of HIV-type CD133 CAR lentiviral vector solution

[0100] Discard the culture medium of 293T cells (DMEM high glucose medium (Shanghai Yuanpei, L110KJ) plus 10% FBS), add 5 mL of sterile PBS solution, shake gently to wash the cell growth surface, and then discard the PBS solution. Use 2 mL of trypsin to digest the 293T cells in the logarithmic growth phase.

[0101] The cell density was adjusted to 5 × 10^ 6 10 mL, re-inoculated in a 10 cm cell culture dish, and continued to culture in a 37 ℃, 5% CO2 incubator. The cell density before transfection was about 80%. 1~2h before transfection, the 293T cells were replaced with fresh DMEM high glucose medium containing 10% FBS, 8mL / 10cm dish. Take 2 EP tubes, add 500 µl of normal saline, respectively, and mark them as A and B; add 60µg PEI (polyethyleneimine, molecular weight 25kDa) to tube A and vortex thoroughly to mix, add shuttle plasmid pHBLV-EF1A-CD133 CAR and two auxiliary plasmids pSPAX2 (Addgene, catalog number 12260), pMD2.G (Addgene, catalog number 12259) to tube B, the ratio of the three plasmids is 4:3:1, a total of 24µg; add PEI from tube A to tube B, mix gently, and let stand for 20min; add the mixture to the cells and culture overnight.

[0102] After transfection overnight, carefully aspirate the cell culture medium and discard it in a waste cup containing disinfectant, then add 10 mL of fresh DMEM high-glucose medium containing 10% FBS and continue culturing.

[0103] 48 hours after the medium change, collect the cell supernatant in a 50mL centrifuge tube and store at 4°C. Add fresh cell culture medium (DMEM containing 2%-5% FBS) according to the cell growth status. 24 hours later, collect the cell supernatant again in the same 50mL centrifuge tube. Centrifuge at 4°C, 4500g for 20 minutes, filter the supernatant with a 0.45μm filter and transfer to a new centrifuge tube to obtain the lentiviral vector solution.

[0104] ② Preparation of HIV-type CD133 CAR lentiviral vector concentrate

[0105] Take the lentiviral vector solution and centrifuge it gently (500 xg, 10 minutes) to collect the supernatant containing the lentivirus. Transfer the clarified supernatant to a sterile container and combine 1 volume of Lenti-X Concentrator (Takara, Cat. No. 631232) with 3 volumes of clarified supernatant. Gently invert to mix. Incubate the mixture at 4°C overnight. Centrifuge the sample at 1,500 xg at 4°C for 45 minutes to collect the precipitate. Gently resuspend the precipitate in 1 / 10 to 1 / 100 of the original volume with PBS to obtain the lentiviral concentrate.

[0106] 2) Preparation of Cas9 RNP system

[0107] The two 2'-O-methylphosphorothioate modified sgRNAs targeting the ARID1A gene with the best screening efficiency (SEQ ID NO.1 and SEQ ID NO.2) were dissolved in 1×TE buffer to prepare a 100μM master solution. 2.5 μL of each of the above two sgRNA master solutions was mixed into 5 μL sgRNA solution and incubated with 2.5 μL Duplex Buffer and 2.5 μg Cas9 nuclease at room temperature for 30 min to prepare a mixed reaction solution. 10 CD133 CAR-T cells obtained in step 1) were resuspended in 92.5μl Opti-MEM. 7 / ml, add 7.5ul of the above mixed reaction solution to prepare a 100μl reaction system, and use a nuclear electroporator to electroporate the CAR-T cells. After electroporate, the CAR-T cells were immediately restored with 37°C T cell complete medium for 6 hours. The same T cell complete medium was used to continue culturing for 4-7 days, and the medium was changed every 2 days during this period. After that, sequencing and WB were performed to detect the gene knockout efficiency, and the CD133 CAR expression efficiency was detected by flow cytometry to obtain CD133CAR-T cells with ARID1A gene knockout.

[0108] 3) In vitro model validation

[0109] ①Construction of CD133-overexpressing MDA-MB-231 stable cell line

[0110] Using lentivirus pMSCV-puro as a vector, the target gene CD133 CDS sequence (SEQ ID NO.3) was connected to pMSCV to construct pMSCV-CD133-puro. After successful colony PCR identification and restriction digestion identification, it was sent for sequencing identification. The successfully sequenced plasmid was transformed into the competent bacteria DH5α, and the endotoxin-free plasmid was extracted. The auxiliary plasmids pSPAX2 (Addgene, Catalog No. 12260) and pMD2.G (Addgene, Catalog No. 12259) were also transformed into the competent bacteria DH5α, and the endotoxin-free plasmid was extracted. The above pMSCV-CD133-puro and the auxiliary plasmids GAG and VSV were packaged with lentivirus, and the lentivirus supernatant was harvested. The lentivirus concentrate was prepared in the same way as in "1) CAR-T cell preparation". Human breast cancer cells (MDA-MB-231 cells) were inoculated in 24-well plates 24 hours in advance (1×10 6 / well), add 20ul virus concentrate and 5 μg / ml polybrene to each well, mix well and continue to culture in a 37 ℃ incubator. After 72h, add 2ug / ml puromycin for screening, change the medium and subculture every 2 days, add new puromycin, and select monoclonal cell lines to 96-well plates for further amplification and culture after 3 rounds of screening. After 7-10 days, flow cytometry is used to compare whether the cell lines infected with the virus vector overexpressing the target gene are significantly improved compared with the normal cell lines and the cell lines infected with the empty virus vector. When the stable cell line is subsequently cultured and subcultured, low concentrations of puromycin need to be added to the culture medium as a pressure screening condition, and the monoclonal amplification and flow cytometry monitoring of CD133 expression levels are repeated until the MDA-MB-231 stable cell line with stable overexpression of CD133 is obtained.

[0111] ② Verification of the killing effect of CD133 CAR-T cells with ARID1A gene knockout on the CD133-overexpressing MDA-MB-231 stable cell line

[0112] Under "2) Preparation of Cas9 RNP system", 4-7 days after editing, WB was used to detect CD133 CAR-T cells with ARID1A knockout efficiency of more than 40%. The CD133-overexpressing MDA-MB-231 stable cell line was used to perform a long-term killing experiment of CAR-T cells against tumor cells at a 1:1 effector-target ratio. On the 4th day, cells were collected for flow cytometry detection. The detection indicators were CD133CAR, PD-1, and TIM3 expression. Non-knockout CD133 CAR-T cells were used as controls, and the proliferation activity of CAR-T was monitored at the same time.

[0113] Figure 3~4 The results showed that the CAR expression of CD133 CAR-T was normal after ARID1A targeted knockout, the proliferation activity was not affected, and the CAR-T with ARID1A knockout showed lower expression of exhaustion indicators (PD-1, TIM-3) than the CAR-T cells without ARID1A knockout.

[0114] 4) In vivo model validation

[0115] Male NOD / ShiLtJGpt-Prkdcem26Cd52Il2rgem26Cd22 / Gpt (NCG) mice (deficient in T cells, B cells, and NK cells) aged 6-8 weeks were subcutaneously inoculated with CD133 positive MDA-MB-231 cells (1*10 6 / ), construct CD133 positive MDA-MB-231 breast cancer tumor model, and wait until the tumor volume grows to about 100mm 3 The in vivo tumor inhibitory effect of CD133 CAR-T edited by the optimal ARID1A sgRNA knockout was evaluated by tumor volume and survival rate of animal tumor models. Tumor-infiltrating CAR-Ts were obtained at different time points after treatment, and the proportion of exhausted T cells (TEX) of control CAR-Ts was detected by flow cytometry.

[0116] Figure 5 The results showed that ARID1A knockout CD133 CAR-T had better in vivo efficacy than non-knockout CAR-T (Ctrl CAR-T) and a lower proportion of exhausted tumor-infiltrating T cells.

[0117] Studies have shown that CD133 is not expressed in cells of normal breast tissue, but with the development of breast lesions, from common hyperplasia to atypical hyperplasia, and then to carcinoma in situ and invasive carcinoma, the expression rate of CD133 gradually increases. The ARID1A knockout CD133 CAR-T constructed by the present invention will not be rapidly exhausted when killing CD133-positive human breast cancer cells MDA-MB-231. Compared with CD133CAR-T without knockout ARID1A gene, it can more significantly inhibit breast cancer tumor volume, prolong the survival time of breast cancer individuals, and improve the survival rate.

[0118] 2. Effect of knocking out the ARID1A gene in DLL3 CAR-T on long-term tumor suppression

[0119] 1) Construction of DLL3 CAR-T

[0120] Primary human T cells were inoculated in a 24-well cell culture plate at a concentration of 1×10 6 Anti-CD3 / CD28 magnetic beads were added to activate T cells at a cell:magnetic bead ratio of 1:3. 24 hours after adding magnetic beads, T cells were transferred to the RetroNectin-coated plate (1×10 6 1× working solution (1× working solution, ...

[0121] 2) Knockout of the gene ARID1A in DLL3 CAR-T cells

[0122] The specific knockout method is the same as step 2 in "I. Effect of knocking out the ARID1A gene in CD133 CAR-T on long-term tumor suppression effect").

[0123] 3) In vitro anti-depletion function verification

[0124] ARID1A targeting sgRNA was used to prepare RNP, and the ARID1A gene was knocked out in DLL3 CAR-T. The knockout efficiency was over 70% by WB detection. Chronic and acute stimulation of IL-2 on gene-knockout DLL3 CAR-T cells can promote the proliferation and activation of T cells, thereby effectively verifying their anti-exhaustion function. Therefore, the anti-exhaustion effect of DLL3 CAR-T cells with ARID1A gene knockout in vitro was verified by non-specific activation model.

[0125] The specific method for constructing the nonspecific activation model is as follows:

[0126] The knockout cells were chronically stimulated in the presence of IL-2 using a plate coated with anti-CD3 antibodies, and acutely stimulated with IL-2 alone without CD3 antibody stimulation. The cells were passaged onto fresh coated plates every 2 days, and flow cytometry was performed to analyze the expression of PD-1, TIM3, and LAG3d on T cells on days 0 and 14, with non-knockout T cells as controls.

[0127] Figure 6 The results showed that compared with the non-knockout control CAR-T (Ctrl CAR-T), ARID1A knockout DLL3 CAR-T cells had higher PD-1 expression levels and lower TIM-3 and LAG3d expression levels over time; the cell viability was comparable; the cell proliferation rate was higher, and overall, the anti-exhaustion effect of ARID1A knockout DLL3 CAR-T in vitro was comparable.

[0128] 2) Verification of long-term functionality in vivo.

[0129] Male NOD / ShiLtJGpt-Prkdcem26Cd52Il2rgem26Cd22 / Gpt (NCG) mice aged 6-8 weeks (T cell, B cell, and NK cell deficient) were subcutaneously inoculated with human small cell lung cancer SHP77 (1*10 5 / ) to construct a SHP77 tumor cell-bearing model. When the tumor volume grew to about 100 mm 3 The in vivo efficacy of ARID1A knockout DLL3 CAR-T was evaluated by tumor volume.

[0130] Figure 7 The results showed that the tumor inhibition effect of ARID1A knockout DLL3 CAR-T was comparable to that of non-knockout control CAR-T, and did not show a superior long-term small cell lung cancer tumor inhibition effect.

[0131] Studies have shown that DLL3 is barely expressed in normal lung tissue, but highly expressed in small cell lung cancer (SCLC). When killing DLL3-positive small cell lung cancer cells SHP77, ARID1A-knocked DLL3 CAR-T does not significantly improve the rapid exhaustion of T cells compared to DLL3 CAR-T with the ARID1A gene not knocked out, and has no advantage in inhibiting the tumor volume of small cell lung cancer.

[0132] In summary, the two chimeric antigen receptor T cells CD133 CAR-T and DLL3 CAR-T constructed have completely different effects on improving the rapid exhaustion of T cells after knocking out the ARID1A gene, which proves that gene deletion has different effects on the functions of different T cell receptors, and the therapeutic effects on tumors are different after knocking out the same gene. The present invention knocks out the ARID1A gene of a specific chimeric antigen receptor T cell, CD133 CAR-T, so that it has lower exhaustion index (PD-1, TIM-3) expression, obtains a more lasting tumor suppression effect, reduces tumor volume, and prolongs the survival rate after tumors, which has practical promotion and application value.

Claims

1. A chimeric antigen receptor T cell with long-term tumor suppression effect, characterized in that: It is a chimeric antigen receptor T cell with the gene ARID1A knocked out; The chimeric antigen receptor T cell is a chimeric antigen receptor T cell targeting CD133; The chimeric antigen receptor T cells targeting CD133 are T cells into which CD133 CAR gene fragments are introduced; The nucleotide sequence of the CD133 CAR gene fragment is shown in SEQ ID NO.4; The gene ARID1A was knocked out from chimeric antigen receptor T cells using the CRISPR / Cas9 gene editing system; The sgRNA in the CRISPR / Cas9 gene editing system is a 2'-O-methylphosphorothioate-modified sgRNA, and its nucleotide sequence is shown in SEQ ID NO.1~2.

2. A method for preparing the chimeric antigen receptor T cell according to claim 1, characterized in that: The steps include: Take T cells, introduce CD133 CAR gene fragments, and obtain CD133 CAR-T cells; take CD133 CAR-T cells, electroporate 2'-O-methylthiophosphorylated modified sgRNA and Cas9 nuclease, and culture.

3. The preparation method according to claim 2, characterized in that: The steps are specifically as follows: 1) Take T cells, add anti-CD3 / CD28 magnetic beads, activate T cells and transfer them to a plate coated with RetroNectin, add HIV-type CD133 CAR lentiviral concentrate and induction reagent, mix well, culture for 12-36 hours, add T cell complete medium and continue to culture for 12-36 hours, then transfer to a plate without RetroNectin coating, add T cell complete medium and culture, perform T cell passage every 2 days, and harvest the 6th-7th generation CD133 CAR-T cells; 2) Take the solution of 2'-O-methylphosphorothioate-modified sgRNA, mix it with Duplex Buffer and Cas9 nuclease, and incubate it to obtain a mixed reaction solution; 3) Place the CD133 CAR-T cells obtained in step 1) in a nuclear electroporator, resuspend them in Opti-MEM, and then add the mixed reaction solution obtained in step 2) to mix well. After electroporation, take out the CD133 CAR-T cells, add T cell complete medium and culture them for 4-7 days. Sequence the cells and perform flow cytometry to collect the CD133 CAR-T cells with ARID1A gene knockout.

4. The preparation method according to claim 3, characterized in that: Step 1) The ratio of the number of T cells to anti-CD3 / CD28 magnetic beads is 1:3; each well of the well plate has 1×10 6 cells, add lentiviral concentrate to a multiplicity of infection of 20, add induction reagent to a total volume of 1 ml per well, and add T cell complete medium to a total volume of 2 ml per well; The sensitizing agent is HitransGA, which is diluted with T cell complete culture medium at a volume ratio of 1:25 when used; The culture temperature is 37°C; The T cells are human T cells; and / or: Step 2) The volume mass ratio of the sgRNA solution to the Duplex Buffer and the Cas9 nuclease is 5 μL: 2.5 μL: 2.5 μg; The sgRNA solution is a solution prepared by diluting two 2'-O-methylthiophosphorylated sgRNAs into 90-110 μM by adding 1×TE buffer respectively and then mixing them in equal volumes; The nucleotide sequences of the two 2'-O-methylthiophosphorylation-modified sgRNAs are shown in SEQ ID NO. 1-2; The incubation is carried out at room temperature for 25 to 35 minutes; and / or: Step 3) The CD133 CAR-T cells were resuspended in Opti-MEM to a cell concentration of 10 6~8 / ml; The volume ratio of the Opti-MEM to the blended reaction solution is 92-93:7-8; The culture temperature is 35-38°C, and the complete T cell culture medium is replaced every 2 days during the culture period; and / or: The complete T cell culture medium is ImmunoCult™-XF T Cell Expansion Medium containing 10 ng / ml IL-2.

5. The preparation method according to claim 3 or 4, characterized in that: The preparation method of the HIV type CD133 CAR lentiviral concentrate comprises the following steps: a. Take 293T cells in the logarithmic growth phase, add DMEM high-glucose medium containing FBS and culture until the cell density reaches 70-90%, and obtain the cell solution to be transfected; take physiological saline containing shuttle plasmid pHBLV-EF1A-CD133 CAR, auxiliary plasmid pSPAX2 and auxiliary plasmid pMD2.G, add physiological saline containing PEI, mix well, and let stand to obtain a mixed solution; b. Take the cell solution to be transfected obtained in step a, discard the liquid and resuspend it with an equal volume of new DMEM high-glucose medium containing FBS, then add the mixed solution obtained in step a to transfect for 6 to 12 hours, discard the liquid and add DMEM high-glucose medium containing FBS to culture for 48 to 72 hours, collect the cell culture supernatant to obtain a lentiviral vector solution; c. Centrifuge the lentiviral vector solution obtained in step b, take the supernatant and mix it with Lenti-X concentrate, incubate it, collect the precipitate by centrifugation, and finally resuspend it with PBS buffer solution to obtain the product.

6. The preparation method according to claim 5, characterized in that: The DMEM high glucose medium containing FBS in step a was added to a cell concentration of 5 × 10 6 pcs / 10 mL; The volume ratio of the physiological saline containing the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G to the physiological saline containing PEI is 1:1; The physiological saline containing the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G contains 24 µg of plasmid per 500 µl; The mass ratio of the shuttle plasmid pHBLV-EF1A-CD133 CAR, the auxiliary plasmid pSPAX2 and the auxiliary plasmid pMD2.G is 4:3:1; The PEI-containing physiological saline contains 60 µg PEI per 500 µl; The step of standing for 10 to 30 minutes; And / or: during the transfection in step b, the volume ratio of the DMEM high-glucose medium containing FBS to the mixed solution is 6-10 ml:1 ml; during the culture, the amount of the DMEM high-glucose medium containing FBS added is 1-2 times the volume of the cell solution to be transfected; And / or: the volume ratio of the supernatant in step c to the Lenti-X concentrate is 3:1; the amount of the PBS buffer solution is 1 / 10 to 1 / 100 of the volume of the mixed solution before incubation; The incubation conditions are 2-8°C, 6-12h; the centrifugation conditions when collecting the precipitate are 2-8°C, 1000-1500 xg, 40-60min; when collecting the supernatant, the centrifugation conditions are 100-800 xg, 5-15min; and / or: The concentration of FBS in the DMEM high-glucose medium containing FBS is 10%; The shuttle plasmid pHBLV-EF1A-CD133 CAR is a recombinant vector prepared by connecting the CD133 CAR gene fragment with a nucleotide sequence as shown in SEQ ID NO.4 to the pHBLV-EF1A-MCS lentiviral vector; The culture conditions are a temperature of 35-38°C and a CO2 concentration of 4-6%.

7. Use of the chimeric antigen receptor T cell according to claim 1 in preparing a drug for treating tumors, characterized in that: The tumor includes breast cancer.

8. A drug for treating tumors, characterized in that: The preparation is prepared from the chimeric antigen receptor T cell according to claim 1 and pharmaceutically acceptable excipients.

Images