Marker, reagent, application for diagnosing cervical cancer and medicine for inhibiting tumor cell

Abstract

To overcome the lack of clarity regarding the mechanism of action of the DSG2 gene in DHA treatment of cervical cancer in existing technologies, this invention provides a biomarker, reagent, application, and drug for diagnosing cervical cancer. The biomarker for cervical cancer diagnosis is the DSG2 gene, which includes a sense strand and an antisense strand corresponding to the sense strand. The sense strand is selected from "Sequence 1," and the antisense strand is selected from "Sequence 2." This invention provides a biomarker for cervical cancer, using the DSG2 gene as a diagnostic marker for cervical cancer, for prognostic assessment, and for drug preparation. Through a series of experimental verifications, the inventors discovered that the DSG2 gene is closely related to the occurrence and development of cervical cancer, possessing diagnostic and therapeutic value. This clarifies the important role of the DSG2 gene in DHA-induced tumor cell damage, making the DSG2 gene an auxiliary target for cervical cancer drug therapy, and providing a new approach to cervical cancer treatment by prolonging drug efficacy.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a biomarker, reagent, application, and drug for diagnosing cervical cancer and inhibiting tumor cells. Background Technology

[0002] Tumor biomarkers are a series of substances that reflect the occurrence, development, and prognosis of a disease, and are widely used in clinical practice for early diagnosis, treatment monitoring, and prognostic assessment. Developing biomarkers for diagnosing tumors and monitoring the effectiveness of treatment in cancer patients is crucial for improving patient survival rates. In addition, researching key gene targets in tumors is a common method for improving the effectiveness of cancer treatment.

[0003] The DSG2 gene is a transmembrane desmosome cadherin, a major protein in the desmosome structure responsible for cell adhesion. Its loss of function weakens cell adhesion and is closely related to epithelial-mesenchymal transition (EMT), invasion, and migration of tumor cells. As a transmembrane glycoprotein on the cell surface, the DSG2 gene can receive intracellular and extracellular signals and exert different effects on tumor cells through various signaling pathways. It has different functions in different cancers, acting as both an oncogene and a tumor suppressor. The loss of function of the DSG2 gene, a major protein in the desmosome structure responsible for cell adhesion, weakens cell adhesion and is closely related to EMT, invasion, and migration of tumor cells. Dihydroartemisinin (DHA), a derivative of artemisinin, has strong pharmacological activity in the human body and its application in cancer treatment is currently a research hotspot. DHA acts on tumor cells, causing cell cycle arrest in the G0 / G1 or G2 / M phase and activating apoptosis factors to promote apoptosis. Compared with traditional anti-tumor drugs, DHA has a significant effect on tumors while having less toxicity to normal cells. However, the mechanism of action of the DSG2 gene in DHA treatment of cervical cancer remains unclear. Summary of the Invention

[0004] To address the unclear mechanism of action of the DSG2 gene in DHA treatment of cervical cancer in existing technologies, this paper provides a biomarker, reagent, application, and drug for diagnosing cervical cancer, as well as a method to inhibit tumor cells.

[0005] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: On one hand, the present invention provides a biomarker for diagnosing cervical cancer, the biomarker being the DSG2 gene, the DSG2 gene comprising a sense strand and an antisense strand corresponding to the sense strand, the sense strand being selected from "Sequence 1" and the antisense strand being selected from "Sequence 2".

[0006] Optionally, it also includes cloning primers for the DSG2 gene and specific primers, wherein the cloning primers include "Sequence 3", "Sequence 4", "Sequence 5" and "Sequence 6", and the specific primers include "Sequence 7" and "Sequence 8".

[0007] On the other hand, the present invention provides a reagent comprising the aforementioned reagent for diagnosing cervical cancer marker levels.

[0008] Optionally, the reagents include cloning primers for the DSG2 gene and specific primers, wherein the cloning primers include "Sequence 3", "Sequence 4", "Sequence 5" and "Sequence 6", and the specific primers include "Sequence 7" and "Sequence 8".

[0009] Optionally, the reagent may also include one or more of the following: buffers, protectants, preservatives, solubilizers, osmotic pressure adjusters, and pH adjusters.

[0010] Optionally, the kit may include one or more antibodies and probes.

[0011] On the other hand, the reagents provided by this invention are used in the preparation of diagnostic or auxiliary diagnostic products for cervical cancer.

[0012] On the other hand, the present invention provides a drug for inhibiting tumor cells, including a CRISPR gene editing therapeutic drug or an antisense nucleic acid drug that blocks normal transcription or post-transcriptional translation of the DSG2 gene.

[0013] Optional, dihydroartemisinin is also included.

[0014] Optionally, methods for blocking normal transcription or post-transcriptional translation of the DSG2 gene include one or more of CRISPR / Cas9 gene editing and RNA interference.

[0015] Optionally, the tumor cells include cervical cancer cells.

[0016] The beneficial effects of this invention are as follows: This invention provides a biomarker for cervical cancer, and uses the DSG2 gene as a biomarker for cervical cancer diagnosis, prognostic assessment, and drug preparation. Through a series of experiments, the inventors discovered that when DHA is used as a cervical cancer cell damage inducer, ectopic expression of the DSG2 gene alters the expression of many genes involved in cell cycle regulation and cancer development, and participates in regulating tumor cell proliferation and tumorigenesis. Furthermore, it was found that overexpression of the DSG2 gene can resist the damaging effects of DHA on cervical cancer cells. Therefore, the DSG2 gene is closely related to the occurrence and development of cervical cancer and has diagnostic and therapeutic value. This clarifies the important role of the DSG2 gene in DHA-induced tumor cell damage, making it an adjunct target for cervical cancer drug therapy and providing a new approach to cervical cancer treatment by prolonging drug efficacy. Attached Figure Description

[0017] Figure 1 This is the detection result of the DSG2 gene PCR product of HeLa cells provided in the embodiments of the present invention; Figure 2 The results of pLentiCRISPRv2-DSG2-sgRNA plasmid extraction and detection provided in this embodiment of the invention; Figure 3 This is the enzyme digestion verification result of the pLentiCRISPRv2-DSG2-sgRNA plasmid provided in the embodiments of the present invention; Figure 4 This is the verification result of the DSG2 gene knockout polyclonal cell line T7EI provided in the embodiments of the present invention; Figure 5 This is the result of DSG2 target gene amplification provided in the embodiments of the present invention; Figure 6 This is the verification result of the second round PCR product of the DSG2 gene and the linearized product of pLentiCRISPRv2 provided in the embodiments of the present invention; Figure 7 This refers to the pLentiCRISPRv2-DSG2 screening results provided in this embodiment of the invention; Figure 8 This invention relates to the determination of DSG2 gene expression levels in three cell lines: empty vector, overexpression, and knockout, as provided in the embodiments of the present invention. Figure 9 The CCK-8 assay was used to detect the effect of different concentrations of DHA on the proliferation inhibition rate of three groups of HeLa cells. (A: 24 h; B: 48 h; C: 72 h) Figure 10 This invention provides a method for detecting the inhibitory activity of DHA on HeLa cell proliferation. (A: Effect of HeLa-EV; B: HeLa-DSG2; C: Effect of HeLa-KO on the proliferation activity of three cell groups; D: Crystal violet absorbance curves of the three cell groups; *) P <0.05,** P <0.01, *** P <0.001, x40) Figure 11 These are the results of the detection of the effect of DHA on HeLa cell migration rate at different time periods provided in the embodiments of the present invention; (*) P <0.05,** P <0.01, *** P <0.001, ns is meaningless; x40) Figure 12 This invention provides a Transwell assay to detect the number of invasive cells after 48 hours. (**) P <0.01, x100) Figure 13 This invention provides a method for detecting the differential expression of DSG2 in HeLa cells during cell cycle analysis. (*) P <0.05,** P <0.01) Figure 14 This is the KEGG functional enrichment analysis provided in the embodiments of the present invention; (A: HeLa-EV vs. HeLa-EV-DHA; B: HeLa-EV-DHA vs. HeLa-DSG2-DHA; C: HeLa-EV-DHA vs. HeLa-KO-DHA) Figure 15 This invention provides the detection of DHA expression levels of PI3K, AKT, p53, ATM, and H2AX mRNA in three groups of HeLa cells. (#, *P<0.05; ##, **P<0.01; ###, ***P<0.001; *: within-group comparison, #: between-group comparison) Figure 16 This invention provides the detection of the relative expression levels of PI3K, AKT, p53, ATM, and H2AX mRNA in three groups of HeLa cells using DHA. (*P<0.05; **P<0.01; ***P<0.001) Figure 17 This invention relates to the detection of DSG2 protein expression in cervical cancer and adjacent normal tissue microarrays (IHC, X10, X200). Detailed Implementation To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0018] One embodiment of the present invention provides a biomarker for diagnosing cervical cancer, the biomarker being the DSG2 gene, the DSG2 gene comprising a sense strand and an antisense strand corresponding to the sense strand, the sense strand being selected from "Sequence 1" and the antisense strand being selected from "Sequence 2".

[0019] Specifically, the present invention provides a biomarker for cervical cancer, and uses the DSG2 gene as a biomarker for cervical cancer diagnosis, prognostic assessment, and drug preparation. Through a series of experiments, the inventors discovered that when DHA is used as a cervical cancer cell damage inducer, ectopic expression of the DSG2 gene alters the expression of many genes involved in cell cycle regulation and cancer development, and participates in regulating tumor cell proliferation and tumorigenesis. Furthermore, they found that overexpressed DSG2 gene can resist the damaging effects of DHA on cervical cancer cells. Therefore, the DSG2 gene is closely related to the occurrence and development of cervical cancer and has diagnostic and therapeutic value. This clarifies the important role of the DSG2 gene in DHA-induced tumor cell damage, making the DSG2 gene an auxiliary target for cervical cancer drug therapy, and providing a new approach to cervical cancer treatment by prolonging drug efficacy.

[0020] Specifically, the sense strand (sequence 1) of the DSG2 gene is: CGCCTGGATCACCGCCCCCG; The antisense strand (sequence 2) of the DSG2 gene is: CTCCCTCCCGAAGAGCCACG; Specifically, the DSG2 gene sequence information was found to be NM_001943.5 in the National Center for Biotechnology Information (NCBI), and the gene name and sequence information were entered into the GPP Web Portal 1 website to design the sense and antisense strands of the DSG2 gene.

[0021] Another embodiment of the present invention provides a reagent comprising a reagent for the determination of marker levels for the diagnosis of cervical cancer.

[0022] Specifically, a series of experimental verifications in this invention have demonstrated that DSG2 participates in regulating tumor cell proliferation and tumorigenesis, and that overexpressed DSG2 can resist DHA-induced cell damage. Based on these findings, when the reagent provided by this invention includes the aforementioned biomarkers for cervical cancer diagnosis, the expression level of the DSG2 gene in the corresponding sample can be efficiently detected and quantified using relevant molecular identification techniques. In other words, the use of this reagent not only helps improve the sensitivity and specificity of cervical cancer detection, but also provides important clinical application value for the early diagnosis and prognostic assessment of cervical cancer by periodically detecting changes in DSG2 gene expression.

[0023] In some embodiments, the reagent includes cloning primers for the DSG2 gene and specific primers, wherein the cloning primers include "Sequence 3", "Sequence 4", "Sequence 5" and "Sequence 6", and the specific primers include "Sequence 7" and "Sequence 8".

[0024] The cloning primers for the DSG2 gene are specifically "Sequence 3" to "Sequence 6": Sequence 3 is: CACCGCGCCTGGATCACCGCCCCCG; Sequence 4 is: AAACCGGGGGCGGTGATCCAGGCGC; Sequence 5 is: CACCGCTCCCTCCCGAAGAGCCACG; Sequence 6 is: AAACCGTGGCTCTTCGGGAGGGAGC; The specific primers for the DSG2 gene are "Sequence 7" - "Sequence 8"; Sequence 7 is: GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA; Sequence 8 is: GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA; The primers designed above can specifically amplify the sense and antisense strands of the DSG2 gene in PCR reactions, thereby helping to accurately quantify the expression level of the DSG2 gene, so as to more effectively monitor the expression changes of the DSG2 gene in cervical cancer cells and thus assess its role in disease development.

[0025] In some embodiments, the reagent further includes one or more of buffers, protectants, preservatives, solubilizers, osmotic pressure adjusters, and pH adjusters.

[0026] The reagents not only include DSG2 gene-related reagents for diagnosing cervical cancer, but also contain a series of auxiliary additives to ensure the stability and reliability of the detection process of the kit. Specifically, the buffer is used to maintain the pH stability of the reaction system, ensuring that PCR amplification and other chemical reactions are carried out under optimal conditions; the protectant is used to protect the active ingredients in the reagents and prevent them from degrading during storage or transportation; the preservative prevents microbial contamination and extends the shelf life of the kit; the solubilizer helps dissolve difficult-to-dissolve reagent components and improves reaction efficiency; the osmotic pressure adjuster adjusts the osmotic pressure of the reaction system to meet the processing requirements of cell or tissue samples; and the pH adjuster precisely adjusts the pH value of the reaction system to meet the pH requirements of specific experimental steps.

[0027] In some embodiments, the reagent includes one or more of antibodies and probes.

[0028] The reagent contains a probe that hybridizes with the nucleotide sequence of the DSG2 gene, or an antibody or antibody fragment that specifically binds to DSG2, or specific primers that amplify the DSG2 gene.

[0029] In some embodiments, the reagent is used in the preparation of diagnostic or adjunctive diagnostic products for cervical cancer.

[0030] Specifically, the reagents can be used to detect messenger RNA transcribed from the DSG2 gene or the protein encoded by the DSG2 gene via RT-PCR, real-time quantitative PCR, digital PCR, fluorescent dye method, resonance light scattering method, sequencing or biomolecular mass spectrometry, in situ hybridization, Northern blotting, microarray, high-throughput sequencing platform, immunohistochemistry or enzyme-linked immunosorbent assay (ELISA). By providing the above reagents, not only is the popularization and application of cervical cancer diagnostic technology promoted, but it also helps to improve the accuracy and repeatability of diagnosis.

[0031] Specifically, the test sample of the reagent can be serum, plasma, cells, cell culture supernatant, cervical exfoliated cells, epithelial cells, urine, tissue, or tissue lysate; further, when the test sample of the reagent is selected from cells, it can be obtained by culturing cells in a culture medium and then knocking out the DSG2 gene in the cells, or by using CRISPR / Cas9 technology to knock out the DSG2 gene in the cells.

[0032] In other embodiments, the present invention provides a drug for inhibiting tumor cells, including a CRISPR gene-editing therapeutic drug or an antisense nucleic acid drug that blocks normal transcription or post-transcriptional translation of the DSG2 gene.

[0033] Specifically, the drug for inhibiting the growth of cervical cancer cells provided by this invention targets the diagnostic marker of the DSG2 gene and blocks the normal transcription or post-transcriptional translation of the DSG2 gene through a specific molecular mechanism, thereby achieving the effect of treating cervical cancer.

[0034] In some embodiments, methods for blocking normal transcription or post-transcriptional translation of the DSG2 gene include one or more of CRISPR / Cas9 gene editing and RNA interference.

[0035] Specifically, the construction of a stable cell line using the CRISPR / Cas9 knockout / overexpression of the DSG2 gene includes the following steps: S1: Screening concentration of resistant cells; S2: Design the sense and antisense strands of the DSG2 gene; S3: Amplification and verification of the DSG2 gene; S4: Primers for synthesizing sgRNA cloning; S5: Constructing vectors and extracting plasmids; S6: Screening of transfected cells and positive cells; S7: Western blot analysis of DSG2 overexpression and knockout status.

[0036] Specifically, Western blot analysis of HeLa cell lines with knockout and overexpression of the DSG2 gene revealed that, compared to the empty vector group, DSG2 gene expression was significantly increased in HeLa cells overexpressing the DSG2 gene, while DSG2 gene expression was significantly decreased in HeLa cells with knockout of the DSG2 gene. This indicates that stable cell lines with knockout and overexpression of the DSG2 gene were successfully constructed using the CRISPR / Cas9 method.

[0037] The CRISPR gene-editing therapeutics utilize the CRISPR-Cas9 system or other gene-editing technologies to precisely target and cleave the DSG2 gene, thereby disrupting its coding sequence and preventing normal gene expression. This method can operate directly at the genome level, exhibiting high specificity and efficiency. Antisense nucleic acid drugs, through the design of specific antisense oligonucleotides, bind complementaryly to the DSG2 gene mRNA, inducing RNase H cleavage to degrade the mRNA or inhibiting ribosome binding, thereby blocking the mRNA translation process and reducing the production of DSG2 protein.

[0038] Although the two drugs have different mechanisms of action, they both aim to inhibit the growth and spread of cervical cancer cells by downregulating the expression of the DSG2 gene. Since the DSG2 gene plays a key role in the occurrence and development of cervical cancer, the development of this DSG2 gene-based drug not only provides a new approach to the treatment of cervical cancer, but may also have potential therapeutic value for other cancer types related to the DSG2 gene.

[0039] In some embodiments, the tumor cells include cervical cancer cells.

[0040] Specifically, research has found that ectopic expression of the DSG2 gene alters the expression of related genes involved in cell cycle regulation and cancer development, and participates in regulating tumor cell proliferation and tumorigenesis. When the expression level of the DSG2 gene is downregulated, the proliferation and survival of cervical cancer cells can be indirectly inhibited. Therefore, the drug for inhibiting tumor cells provided by this invention targeting the DSG2 gene may also have potential application and therapeutic value for other types of cancer.

[0041] The present invention will be further illustrated by the following examples.

[0042] 1. Constructing stable cell lines by knocking out the DSG2 gene using CRISPR / Cas9 technology. 1) Puromycin resistance cell screening concentration experiment: Screening for eukaryotic or prokaryotic polyclonal or monoclonal cells that can express the pac gene (puror) through plasmid transfection / transformation, viral infection, etc. 2) Design of sgRNA: sgRNA1 (5´→3´): CGCCTGGATCACCGCCCCCG (Sequence 1); sgRNA2 (5´→3´): CTCCCTCCCGAAGAGCCACG (Sequence 2); 3) Verification of DSG2 gene amplification: agarose gel electrophoresis 4) Synthesis of sgRNA cloning primers: Design lentiCRISPRv2-sgRNA cloning primers based on sgRNA: Table 1 5) Vector and primer ligation: This experiment was conducted according to the NEB T4 polynucleotide kinase kit (T4 PNK), following the instructions in the kit's manual. 6) Plasmid extraction and virus packaging: Follow the instructions for the endotoxin-free plasmid medium-quantity extraction kit. 7) Transfected cells and positive cell screening: Take cells in the logarithmic growth phase (70-80%) of the complete medium containing 10µg / ml Polybrene (polybrene, which improves the infection efficiency of lentivirus and adenovirus on cells), add 500µl of virus solution, and immediately add HeLa cell suspension to mix thoroughly. After 2 days of transfection, add complete medium containing 1.5μg / ml puromycin and continue culturing. After 3 days of screening, the control cells die, and the positive cells in the screening experimental group are expanded and cultured.

[0043] 1.2 Construction of stable cell lines for DSG2 gene overexpression using CRISPR / Cas9 technology 1) Target design is the same as in step 1.1 above. 2) Amplification of the DSG2 gene: sequence (5`→3`) Upstream primer (sequence 7): GAACACAGGACCGGTTCTAGAGCGCTGCCACCATGGCCGGGAGCCCGGGA Downstream primer (Sequence 8): TCTTTATAATCACCGTCATGGTCTTTGTAGTCGCCGGATCCGGAGTAAGAATGCTGTACAGTGC 3) Add tags and homologous sequences: Using the first round PCR product of DSG2 as a template, add a FLAG tag to the gene sequence at the C-terminus of the DSG2 protein.

[0044] C-terminal primer (5'→3'): gaagtttgttgcgccggagcccttgtcatcgtcatccttgtaatcgatgtcatgatctttataatcaccgtcatgg.

[0045] 4) Double-digestion plasmid recombination: Verify the presence of the DSG2 target gene using XbaI and BamHI enzymes: Follow the instructions of NEB's XbaI and BamHI enzyme digestion kit.

[0046] 5) Gel excision, purification, and recovery of positive fragments 6) Ligation of the DSG2 gene with the linearized vector: Follow the instructions for the ClonExpress II one-step cloning kit for subsequent experiments.

[0047] 7) Extraction and packaging of endotoxin-free plasmids from LentiCRISPRv2-sgRNA and LentiCRISPRv2-DSG2: Follow the instructions of the endotoxin-free plasmid medium-volume extraction kit.

[0048] 8) Transfected cells and positive cell screening: Take cells in the logarithmic growth phase (70-80%) of the complete medium containing 10µg / ml Polybrene, add 500µl of virus solution, and immediately add HeLa cell suspension to mix thoroughly. After 2 days of transfection, add complete medium containing 1.5μg / ml puromycin and continue culturing. After 3 days of screening, the control cells die, and the positive cells in the screening experimental group are expanded and cultured.

[0049] The results showed that: 1. Agarose gel electrophoresis after Taq enzyme amplification of the DSG2 gene showed no non-specific products, and good amplification was observed at around 50℃, with clear electrophoretic bands. Figure 1 ); 2. Plasmid extraction gel analysis of cell colonies transformed with SgRNA1 and SgRNA2 showed that the target product was approximately 13 kb. Figure 2 ); 3. Three cloning sites were taken from each of the pLentiCRISPRv2-DSG2-sgRNA plasmids. BsmBI restriction enzyme digestion assay showed that the original plasmid pLentiCRISPRv2 (EDV0005) was not digested, but the other six vector bands showed significant differences. Two samples each from pLentiCRISPRv2-DSG2-sgRNA1 and pLentiCRISPRv2-DSG2-sgRNA2 were selected. Figure 3 ); 4. Validation of gene knockout positive clones—T7E1 experiment: The HeLa T7E1 enzyme group and the HeLa undigested group were compared. It was found that the control group (WT wild-type) in the HeLa digestion group was not digested, while the gene knockout positive clones all showed two distinct bands, indicating a mutation at the SgRNA position and the existence of a mutant. The SgRNA1 digestion product was 220+326bp, and the SgRNA2 digestion product was 226+320bp. Figure 4 ); 5. DSG2 target gene amplification ( Figure 5 ); 6. Second-round PCR product of DSG2 gene double-enzyme excision and pLentiCRISPRv2 vector: The linearized product of pLentiCRISPRv2 can be digested with XbaI and BamHI. The PCR product size is approximately 3482 bp, and the digestion product size is approximately 8819 bp. Figure 6 ); 7. Agarose gel electrophoresis after screening and amplification of bacterial colonies: Colonies 1, 2, 7, 9, 14, and 15 were selected to be compared with pLentiCRISPRv2 (EDV00114). The gel electrophoresis results showed that colonies 7, 9, 14, and 15 were approximately identical to the target fragment of pLentiCRISPRv2 (EDV00114). Therefore, colonies 7, 9, 14, and 15 were selected for enzyme digestion verification. Figure 7 ).

[0050] 2. RT-PCR and Western blot analysis were used to detect the expression levels of DSG2 in DSG2-overexpressing cells, DSG2 knockdown cells, and DSG2 empty vector cells. Table 2 shows the primer sequences for DSG2 and the internal reference gene. Table 2 To investigate the effect of the DSG2 gene on cell function, two parallel experimental groups were set up: HeLa cells with no DSG2 vector: HeLA-EV; DSG2 knockdown cells: HeLa-KO; and DSG2 overexpression cells: HeLa-DSG2. Different concentrations of dihydroartemisinin were prepared: 0 μg / ml was the control group, and 10, 25, 50, 100, 150, 200, and 300 μg / ml were the experimental groups.

[0051] The results showed that Western blot analysis of HeLa cell lines with DSG2 gene overexpression (OE) and knockout (KO) revealed that, compared with the empty vector (CV) group, DSG2 gene expression was significantly increased in the DSG2-OE group and significantly decreased in the DSG2-KO group. Figure 8 ); 3. Confirm the role of the DSG2 gene in HeLa cells at the cellular level. 3.1 CCK-8 assay for cell proliferation (1) Add 100 μL of PBS to each well around the perimeter of the 96-well plate to prevent the liquid in the well from evaporating.

[0052] (2) Prepare cell suspension by adding only 100 μL of culture medium per well to each plate blank well Ab; take the logarithmic growth phase cells for plating: KO: 5000 cells / well, OE and CV: 2000 cells / well, 100 μL per well, repeat each sample 3 times, observe the cell status, and appropriately extend or shorten the cell culture time until the cells adhere to the wall and grow to about 70%, and wash with PBS 3 times.

[0053] (3) Add different concentrations of drugs. For each cell line, set up control well Ac (drug concentration of 0 μg / mL) and experimental well As, and set drug concentrations of 10 μg / mL, 15 μg / mL, 25 μg / mL, 30 μg / mL, 50 μg / mL, 75 μg / mL, 100 μg / mL, 150 μg / mL, and 200 μg / mL.

[0054] (4) After adding the drug, continue culturing for 4 h, 48 h, and 72 h. Add 10 μl of CCK-8 working solution to each well and continue incubating at 37℃ for 2 h. Measure the 450 nm OD value in the dark.

[0055] (5) Calculation formula: Cell inhibition rate = [(Ac-As) / (Ac-Ab)] x 100% The results showed that the proliferation inhibition rate gradually increased with increasing DHA concentration and treatment time. At 24 h, there was no significant difference in the inhibition rate of DHA on the three HeLa cell groups; the inhibition rate differed significantly after 48 h, and the difference in proliferation inhibition rate among all groups was even more significant after 72 h. Furthermore, compared with HeLA-EV, HeLA-DSG2 showed significantly lower proliferation inhibition rates at 48 h and 72 h, while HeLa-KO showed significantly higher proliferation inhibition rates. Figure 9 ).

[0056] 3.2 Crystal violet staining assay for detecting cell proliferation activity (1) The cells were seeded in 6-well plates with a cell count of 1 x 10⁻⁶. 5 Count per well, 2 mL per well for plate preparation.

[0057] (2) After culturing cells in 6-well plates for 24 h, different concentrations of DHA (0 μg / mL, 25 μg / mL, 50 μg / mL, 75 μg / mL, 150 μg / mL, 200 μg / mL) were added.

[0058] (3) After 48 h of routine culture, the dead cells were washed with PBS and the waste liquid was removed.

[0059] (4) After fixing the cells with 0.5 mL of 4% paraformaldehyde for 30 min along the well wall, wash the cells three times with PBS.

[0060] (5) Slowly add 0.5% crystal violet solution along the well wall to stain the bottom of the well and let it stand at room temperature for 10 min.

[0061] (6) Wash with PBS until no purple residue remains, and take pictures under an inverted microscope.

[0062] (7) Place the 6-well plate in the dark until it is completely dry (or dry at 37°C), add 2 mL of 35% acetic acid solution per well, and dissolve the crystal violet at room temperature for 1 h.

[0063] (8) Transfer the crystal violet solution to a 96-well plate; measure the absorbance at 550 nm using an ELISA reader.

[0064] The results showed that DHA inhibited the proliferation activity of HeLa cells, and the cell density decreased significantly with increasing drug concentration. Crystal violet staining followed by dissolution in acetic acid and subsequent absorbance measurements of each well revealed that differentially expressed DSG2 affected cell proliferation activity; the cell density of HeLa-DSG2 cells was significantly higher than that of HeLa-EV and HeLa-KO cells. Figure 10 ).

[0065] 3.3 Scratch assay for cell migration (1) Take cells with good morphology in the logarithmic growth phase from each group and place them in a 6-well plate.

[0066] (2) After the cells adhere to the well wall and reach 90% confluence, use a sterilized 200 μl pipette tip to scratch the cells in each well. Make sure the pipette tip is perpendicular to the bottom plane of the well and make three parallel and even scratches in each well to ensure that the scratches are of consistent width.

[0067] (3) Wash away floating and dead cells with PBS and add different concentrations of drugs (0 μg / mL, 50 μg / mL).

[0068] (4) After culturing for 0h, 24h, 48h and 72h, observe and record the width of the scratches by taking pictures.

[0069] (5) Record 5 microscopic views for each hole, and record the width value 3 times for each microscopic view, so as to obtain the average width of the scratch.

[0070] The results showed that DHA significantly inhibited the migration ability of HeLa cells in all three groups, with the inhibitory effect becoming more pronounced over time. At 24 h, compared with HeLa-EV-DHA, the migration rate of HeLa-KO-DHA was significantly reduced, while there was no significant difference in the migration rate of HeLa-DSG2-DHA. However, at 48 h, the difference between HeLa-EV-DHA and HeLa-DSG2-DHA was significantly increased. Figure 11 ).

[0071] 3.4 Transwell assay to detect cell invasion ability (1) Place Matrigel stored at -20℃ in a 4℃ refrigerator overnight to slowly melt it into a liquid state.

[0072] (2) Coating the basement membrane: Prepare a pre-cooled 200 μL pipette tip in advance. After rinsing the inside of the chamber with culture medium, mix Matrigel gel and serum-free culture medium at a volume ratio of 1:4. Coat 50 μL of each well evenly on the upper chamber surface of the membrane at the bottom of the Transwell chamber. Be careful to keep it horizontal to avoid uneven thickness of the gel surface.

[0073] (3) During the experiment, first add the lower chamber liquid containing serum, which can be used as a chemotactic factor, and then gently place it into the transwell chamber, ensuring that the bottom of the chamber is clean and avoiding the formation of air bubbles between the liquid and the chamber.

[0074] (4) Place it in an incubator at 37°C overnight to allow Matrigel to polymerize into a gel.

[0075] (5) Conduct the experiment according to the following requirements: Upper room: Culture medium: serum-free DMEM medium Cell count 1 x 10³ cells / well Volume: 50 μl Lower room: Culture medium: DMEM medium containing 20% ​​fetal bovine serum Volume: 500 μl (6) Cells were starved for 12 h before the experiment to remove the influence of serum.

[0076] (7) Slowly add 50 μl of resuspended cells to each upper chamber and incubate in an incubator for 48 h.

[0077] (8) Remove the chamber, aspirate the excess liquid from the upper and lower chambers, and wash the upper chamber twice with PBS.

[0078] (9) Place the chamber in a new hole that has been filled with 4% paraformaldehyde and fix it for 30 minutes.

[0079] (10) Immerse the lower chamber of the small chamber completely in 0.5% crystal violet solution and stain for 15 min.

[0080] (11) Finally, wash the chamber three times with PBS, air dry in the dark, observe and photograph under an inverted microscope, record the images, and randomly select 5 fields of view in each well to count the cells and calculate the mean.

[0081] The results showed that DHA significantly inhibited the invasive ability of the three HeLa cell lines, overexpression of DSG2 enhanced the invasive ability of HeLa cells, and knockdown of DSG2 weakened the invasive ability of HeLa cells. Figure 12 ).

[0082] 4. Confirming the role of the DSG2 gene in synergistic action with dihydroartemisinin in HeLa cells at the molecular level. 4.1 Flow cytometry: Detecting the cell cycle (1) Take logarithmic growth phase cells and seed them in 6-well plates at 2 x 10⁵ cells / well, and culture until the cells adhere and the cell line is 80%.

[0083] (2) DHA concentration of 0 μg / mL was used as the control group and 50 μg / mL was used as the experimental group. The DHA was added to each well and cultured for 48 h.

[0084] (3) After culturing for 48 h, wash the cells three times with PBS, digest them with trypsin, collect them in a 15 mL centrifuge tube, centrifuge at 1000 rpm / 5 min, discard the supernatant, gently resuspend the cells in PBS pre-cooled at 4℃, and centrifuge at 500 rpm / 5 min.

[0085] (4) Discard the supernatant, leaving about 200 μL of PBS, blow away the cell pellet, and resuspend thoroughly.

[0086] (5) Prepare a 3 mL EP tube in advance, add 1 mL of 70% ice ethanol to each tube, and clearly label it.

[0087] (6) Transfer the fully dispersed cell suspension to an EP tube, gently blow it repeatedly to ensure it is in full contact with 70% ethanol, and fix it overnight at -20°C.

[0088] (7) Centrifuge and collect the cell pellet every other day. Wash the cells twice with PBS. Add 400 μL of PI working solution to each tube and stain in the dark for 30 min. PI working solution preparation ratio: 0.5 mL buffer + 25 μL PI staining solution + 10 μL RNaSA.

[0089] (8) Before the cell cycle was started, the cells were filtered with a cell sieve and the cell cycle was detected by flow cytometer. The subsequent data were analyzed using ModFit LT (version 5.0.9).

[0090] The results showed that after treatment with 50 μg / mL DHA for 48 h, the proportion of cells in the G0 / G1 phase in HeLa-EV-DHA was lower than that in HeLa-EV; compared with the untreated group, the cell cycle of HeLa-EV-DHA, HeLa-KO-DHA, and HeLa-DSG2-DHA all arrested in the G2 / M phase; compared with HeLa-EV-DHA, the proportion of cells arrested in the G2 / M phase in HeLa-DSG2-DHA was not significantly different, but the proportion of cells arrested in the G2 / M phase in HeLa-KO-DHA increased. Figure 13 ).

[0091] 4.2 RNA sequencing experiment: To analyze the effect of the DSG2 gene on human cervical cancer gene expression, KEGG and GO enrichment analyses were performed. (1) Cells were divided into control groups (DHA: 0 μg / mL): HeLa-KO, HeLa-EV, and HeLa-DSG2. Experimental group (DHA: 50μg / mL): HeLa-KO-DHA, HeLa-EV-DHA, HeLa-DSG2-DHA; When the cells become larger and their edges become blurred, collect the cells and extract RNA.

[0092] (2) Electrophoresis was used to analyze the integrity of RNA samples, and a nanometer spectrometer was used to detect the purity of RNA.

[0093] (3) After the concentration and purity of the RNA sample are detected, a library is constructed and the effective concentration of the library is accurately quantified to ensure the quality of the library.

[0094] (4) Transcriptome sequencing was performed using the Illumina high-throughput sequencing platform (HiSeq 4000).

[0095] (5) The Illumina HiSeq 4000 sequencing data was filtered to remove reads with incomplete base information and low-quality reads. Then, the sequencing error rate was checked to perform quality control on the data, providing a guarantee for subsequent data analysis. At the same time, the sequencing quality value of each base in the sequence information was saved in the fastq file.

[0096] (6) Use the ClusterProfiler package in R language to perform GO function annotation analysis and KEGG signaling pathway analysis on DEGs, and use the Enrichplot package to draw bubble plots to visualize the enrichment results. GO function enrichment analysis includes biological processes (BP), molecular functions (MF) and cellular components (CC).

[0097] The results showed that GO enrichment was more pronounced in the positive regulation of cell migration, DNA packaging, transmembrane receptor activity, and binding of cell adhesion molecules. Further KEGG pathway enrichment analysis of DEGs revealed that DEGs obtained by RNA sequencing in the HeLa-EV vs. HeLa-EV-DHA group were enriched in ribosomes, the p53 signaling pathway, and other signaling pathways. Differentially identified genes matched the KEGG database, showing significant enrichment in the PI3K / AKT signaling pathway, cytokine interactions, axonal guidance, Rap1 signaling pathway, protein digestion and absorption pathway, and other KEGG pathways. Figure 14: (A) HeLa-EV vs. HeLa-EV-DHA (B) HeLa-EV-DHA vs. HeLa-DSG2-DHA (C) HeLa-EV-DHA vs. HeLa-KO-DHA).

[0098] 4.3 RT-PCR experiment: Detection of the expression of relevant genes (1) Experimental group cells (50 μg / mL): 4 mL of basal culture medium + 50 μg / mL drug concentration (containing 5 μL DMSO) (2) Control group cells (0 μg / mL): 4 mL basal culture medium + 5 μL DMSO (3) Pretreatment: After the adherent cells reached 70%, different concentrations of drugs (0 μg / mL, 50 μg / mL) were added, and then the cells were cultured until the edges of the drug-treated cells became blurred; (4) Cell collection: Add 1 mL of Trizol lysis buffer, repeatedly pipette until viscous, so that the Trizol lysis buffer completely contacts the surface of all culture flasks and is fully digested. Transfer the digested cells to RNase-free 3 mL centrifuge tubes, repeatedly pipette the cells with a 1000 mL pipette until no cell clumps are visible and the whole solution is clear and non-viscous. Vortex to fully lyse, let stand at room temperature for 5 min, and then at 4℃ for 2 h. (5) Add 0.2 mL of chloroform, shake vigorously for 30 s, mix thoroughly, and let stand at room temperature for 10 min; (6) Centrifuge at 12000 rpm / min, 4℃ for 15 min; (7) Transfer the supernatant to another RNase-free 3 mL centrifuge tube; (8) Add an equal volume of isopropanol to the supernatant, gently mix from top to bottom, and let stand at room temperature for 10 min. (9) Centrifuge at 12000 rpm / min, 4℃ for 30 min; (10) Retain the precipitate, discard the supernatant, add 1 mL of 75% anhydrous ethanol, splash and wash the RNA, and wash the precipitate. (11) Centrifuge at 12000 rpm / min, 4℃ for 15 min; (12) Discard the supernatant and dry at room temperature for 3 min; (13) Add 50 μL of DEPC water, gently pipette to mix, test the concentration, label the cells (time, name) and store them in a -80℃ freezer; (14) Calculate the reaction system for each cell type: Based on the measured RNA concentration, calculate the amount of each RNA sample and reagent used; (15) Remove the reverse transcription kit from -20℃, thaw it, and place it in an ice box for later use; (16) Prepare the reaction system. The reaction system for total RNA reverse transcription is as follows (taking a 20 μL RT-PCR reaction system as an example). Table 3 (17) Distribute the reaction system into eight-tube strips, centrifuge briefly, and place in a PCR instrument for reaction. The reaction conditions are: 25℃, 10 min; 42℃, 30 min; 85℃, 5 min; 12℃, forever. (18) Calculate the reaction amount for each type of cell, the reaction system, and the required distribution of detection wells; (19) Place the cDNA obtained in the previous step in an ice box, and prepare the Realtime PCR kit, the required primers, and RNase-free water; (20) Prepare the mixture for Realtime PCR reaction. The reaction system is 20 μL. The reaction system is shown in the table below. Table 4 (21) The reaction conditions are: Pre-denaturation: 95℃, 5 min; Amplification: 95℃, 30 s; 60℃, 30 s, repeated for 40 cycles; 72℃, 30 s; Melting curves were analyzed using the recommended procedures for quantitative real-time PCR. Expression levels were calculated as 2 − ΔCt. The results showed that DHA inhibited the relative expression levels of PI3K and AKT mRNA in HeLa-KO cells, but while there was an inhibitory trend in the other two groups, it was not significant. Simultaneously, DHA promoted the relative expression levels of p53 and H2AX mRNA. Overexpression of DSG2 inhibited the relative expression of these genes' mRNAs, while knockdown of DSG2 promoted the effect of DHA on the expression of these genes' mRNAs. DHA also promoted the relative expression level of ATM mRNA in HeLa-KO cells. Figure 15 ).

[0099] 4.4 Western blot experiments on three HeLa cell lines: detection of protein expression levels in related pathways and protein expression levels of differentially expressed genes by RNA sequencing Total protein extraction: (1) After DHA has been applied to cells for 48 h, cells in the logarithmic growth phase were collected. 4 ml of cell waste liquid + 2 ml of PBS + 1 ml of trypsin + 2 ml of termination culture medium were collected, totaling 9 ml. The mixture was then blown apart and counted.

[0100] (2) Centrifuge for 5 min at 1000 rpm, discard the supernatant, resuspend 1 ml in PBS and transfer to an EP tube.

[0101] (3) Centrifuge at 13000 rpm for 10 min at 4℃. (4) Discard the supernatant, disperse the cell clumps, and add RIPA: 97 μL, PMSF: 1 μL, and phosphatase inhibitor: 2 μL.

[0102] (5) After adding the lysis buffer, vortex fully lyse: vortex for 3 min, stand still for 10 min, vortex for 30 s, stand still for 10 min, vortex for 30 s, stand still for 10 min, and then place in an ice box.

[0103] (6) Centrifuge at 15000 rpm / min for 15 min at 4℃. Collect the supernatant after centrifugation and detect the protein concentration by BCA method. Transfer the remainder to a new 1.5 mL RNase-free EP tube and store at -80℃.

[0104] (7) Use relevant antibodies to detect the expression level of relevant proteins by Western blot.

[0105] The results showed that DSG2 overexpression increased the phosphorylation ratio of PI3K and AKT, activated the PI3K / AKT pathway, and decreased the expression levels of DNA damage-related ATM and H2AX, resulting in increased cell proliferation. Conversely, low DSG2 expression inhibited PI3K / AKT pathway activity, increased ATM and H2AX expression, cell arrest in the G2 / M phase, and decreased proliferation. This indicates that DSG2 not only affects the activity of the PI3K / AKT pathway but also weakens the DHA-induced DNA damage response. DSG2 overexpression, by activating PI3K / AKT, inhibited p53 pathway activity, reduced downstream Cleaved Caspase-3 expression, leading to increased cell proliferation and resistance to DHA-induced cell damage. DHA treatment induced a DNA damage response and increased the expression of H2AX and ATM in HeLa cells. Low DSG2 expression activated the p53 signaling pathway in HeLa cells, while H2AX expression significantly increased, further enhancing the inhibitory effect of DHA on HeLa cells. When DSG2 was overexpressed, p53 pathway activity was weakened, this positive feedback loop was inhibited, and DNA damage was partially resisted, resulting in significantly higher cell proliferation compared to the empty vector group and the low DSG2 expression group. Figure 16 ).

[0106] 4.5 Expression of DSG2 gene in cervical cancer tissues (1) Case Collection: We plan to collect cervical tissue from 31 patients who underwent biopsy and surgical resection at our hospital. The histopathological type of all patients was squamous cell carcinoma. The median age of the patients in the cervical cancer tissue microarray was 47 years (range 28-72 years). There were 12 patients under 47 years old and 19 patients ≥ 47 years old. Among them, 29 cases of cervical cancer were classified according to the FIGO clinical staging (2018): 16 cases of stage IB2, 6 cases of stage IB3, 4 cases of stage IIA1, 1 case of stage IIB, and 2 cases of stage IIIC1p.

[0107] (2) Preparation of paraffin sections: The paraffin-embedded cervical lesion specimens were fixed on the microtome. Two sections of each specimen were cut consecutively. The tissue sections were then immersed in xylene I and xylene II solutions for dewaxing. Finally, the sections were placed in a gradient of alcohols for hydration.

[0108] (3) Antigen retrieval: Place the slides in an antigen retrieval box containing citrate buffer (pH 6.0) and heat at 98°C for 10 min. Rinse three times with PBS (pH 7.4). Dilute 30% hydrogen peroxide solution with deionized water and add one drop of diluted hydrogen peroxide solution to each slide to block endogenous catalase activity.

[0109] (4) Antibody incubation: Add 50 μL of TBS solution containing 10% normal rabbit serum and 1% BSA to each slide, remove the liquid on the tissue, wipe the area around the slide with a paper towel, add diluted primary antibody to each slide, coat the slide with enzyme-conjugated secondary antibody (diluted with TBS solution containing 1% BSA), incubate at room temperature for 1 hour, and develop color at room temperature for 10 minutes.

[0110] (5) Dehydration, fixation and mounting: After rinsing the slides in water, place them in the following solutions in sequence: 70% alcohol, 80% alcohol, 90% alcohol, 95% alcohol, anhydrous ethanol I, anhydrous ethanol II, xylene I and xylene II for dehydration. Place them in each solution for 2 minutes. Finally, air dry the slides in a fume hood and mount them with neutral resin in a fume hood.

[0111] (6) Immunohistochemical result determination: DSG2 protein is located in the cell membrane of cervical lesions. Cells with brownish-yellow granules on the cell membrane are positive expression cells, while cells with no brown color or the same color as the background are negative cells. Ten high-power fields were randomly observed, and the number of positive tumor cells and the total number of tumor cells were counted. The positive cell ratio and staining intensity of each section were scored. Positive cell staining judgment: <5% is 0 points, 5%-25% is 1 point, 26%-50% is 2 points, and >50% is 3 points. Positive intensity: No brownish-yellow positive granules in the cell or uniform yellow color is 0 points, a small number of light yellow granules in the cytoplasm are significantly higher than the background is 1 point, a large number of dark brown granules in the cytoplasm is 2 points, and a large number of dark brown granules in the cytoplasm is 3 points. The two results of the same section were multiplied. >3 points indicates a positive immunohistochemical reaction, indicating high expression of DSG2 protein. Otherwise, it is low expression.

[0112] The results showed that the DSG2 gene mainly stained the cytoplasm of cervical cancer cells, with staining intensities of (3 points) in 3 cases, (2 points) in 16 cases, (1 point) in 11 cases, and (0 points) in 1 case. The positive staining rates were (0 points) in 1 case, (1 point) in 1 case, (2 points) in 1 case, (3 points) in 6 cases, and (4 points) in 22 cases. There were 19 cases in the antibody high expression group and 12 cases in the antibody low expression group. In addition, 9 cases showed staining not only in the cytoplasm but also in small amounts in the cell membrane. In adjacent normal cells, DSG2 mainly stained the cytoplasm, with staining intensities of (2 points) in 7 cases, (1 point) in 9 cases, and (0 points) in 15 cases. The positive staining rates were (0 points) in 14 cases, (1 point) in 11 cases, (2 points) in 5 cases, (3 points) in 1 case, and (4 points) in 0 cases. Except for 1 case in the antibody high expression group, all of them were in the low expression group. IHC results, comparing the high-expression and low-expression antibody groups on cervical cancer tissue microarrays, showed that DSG2 had stronger staining intensity in cervical cancer tissues. Figure 17 ).

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of sgRNA and dihydroartemisinin in the preparation of a drug for treating cervical cancer, characterized in that, The sgRNA is selected from "Sequence 1". sgRNA is selected from "Sequence 1". sg

Images