Application of soybean COX VIB family gene GmCOX6b

Abstract

The application discloses application of a soybean COX VIB family gene GmCOX6b. A soybean GmCOX6b protein coding gene GmCOX6b has a nucleotide sequence as shown in SEQ ID NO. 1. A constructed plant overexpression vector pBA002-GmCOX6b is expressed in a soybean receptor Jack, it is found that transgenic plants have changes in plant type and yield traits, and the plant height is obviously reduced and the hundred-grain weight is obviously increased. It is shown that the gene can be introduced into plants as a target gene, and through expression of the GmCOX6b gene, the transgenic plants can affect plant type and regulate yield. It can be seen that the soybean GmCOX6b protein coding gene GmCOX6b can be applied to improving plant type traits and increasing the hundred-grain weight and yield.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and relates to the application of the soybean COXVIB family gene GmCOX6b. Specifically, it relates to the application of the COXVIB family gene GmCOX6b, which is expressed in various tissues of soybean, highly expressed in pods 7 days after flowering, and is related to plant height and pod development, in regulating plant type traits, number of pods per plant, 100-seed weight, and other yield traits. Background Technology

[0002] Soybean (Glycine Max (L.) Merr.) is an important food and oilseed crop. Developing high-yielding soybean varieties and increasing soybean yield per unit area has become a major challenge for breeders. Cytochrome c oxidase (COX), also known as mitochondrial complex IV, is the last electron acceptor in the respiratory chain, participating in the reduction of O2 to H2O. COX is a multimeric complex composed of multiple structural subunits encoding both the mitochondrial and nuclear genomes, and is a typical protein involved in the transcription, translation, and regulatory interactions between the two genomes. COX VIB members belong to the subunit proteins of mitochondrial respiratory chain complex IV. Because COX is a multi-subunit respiratory chain complex enzyme, subunit deletions and assembly errors caused by DNA mutations can lead to COX structural disorders, functional loss, and the development of mitochondrial dysfunction, growth inhibition, and mitochondrial myopathy (Kumar et al., 2024). In the model plant Arabidopsis thaliana, a total of 72 genes encoding Arabidopsis-specific COX-related proteins have been identified, 10 of which are previously reported plant-specific COX subunits (Senkler et al., 2017). Several genes that directly or indirectly affect plant COX activity have also been discovered, which may help us further understand the role of COX in plant growth and development. For example, AtCOX17 / AtCOX17-2 (Garcia et al., 2016), COX11 (Radin et al., 2015), AtHCC1 (Steinebrunner et al., 2014), AtCOX10 (Mansilla et al., 2015), PpPPR_78 (Uchida et al., 2011), COD1 (Dahan et al., 2014), DEK10 (Qi et al., 2017), and SmK11 (Ren et al., 2023) all directly or indirectly affect the normal assembly of COX, thereby affecting mitochondrial activity and normal function, ultimately limiting growth and development. Mutations in these key genes leading to changes in COX activity have multiple impacts on plant embryo formation, germination, vegetative growth and development, and senescence (Mansilla et al., 2018). For example, the absence of COX subunits AtCOX10 and AtHCC1 leads to embryonic lethality at different developmental stages, primarily in the heart and torpedo stages (Mansilla et al. 2015). Furthermore, these gene mutants also exhibit severe embryonic lethality in different COX editing and RNA processing factors, or in proteins associated with the stability of the IV complex (Takenaka et al., 2012, Welchen et al., 2012, Francs-Small et al., 2012).cod1-1 and cod1-2 are mutants of RNA editing factors lacking COX activity, and their embryos can only germinate when immature seeds are cultured in special media (Dahan et al., 2014). Disruption of the map-based clone Smk11 (Small kernel 11) in maize severely affects COX assembly and activity, leading to defects in plant growth and seed development (Ren et al., 2023). The Arabidopsis heterozygous AtCOX10 mutant exhibits respiratory defects with low levels of COX activity, showing early onset and accelerated progression of both natural and dark-induced senescence (Mansilla et al., 2015). These findings demonstrate the crucial role of COX in plant growth and development; however, compared to yeast and mammals, little is known about COX biosynthesis in plants. Further work is needed to elucidate the role and significance of plant-specific subunits, identify putative plant-specific COX assembly factors, clarify the interactions between different proteins involved in COX biosynthesis, and clarify whether the stress-related functions of several accessory proteins are related to COX activity or more broadly related to retrograde signaling and other mitochondrial regulatory pathways. Summary of the Invention

[0003] The purpose of this invention is to disclose a soybean COX VIB family gene, GmCOX6b.

[0004] Another objective of this invention is to provide genetic engineering applications of this gene in plant type traits, regulation of pod number, and 100-seed weight.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The soybean COX VIB family gene GmCOX6b has the nucleotide sequence SEQ ID NO.1.

[0007] The protein encoded by the soybean COX VIB family gene GmCOX6b described in this invention has the amino acid sequence SEQ ID NO.2.

[0008] An expression vector containing the soybean COX VIB family gene GmCOX6b described in this invention.

[0009] The application of the soybean GmCOX6b protein encoding gene described in this invention in reducing soybean plant height and increasing 100-seed weight.

[0010] The recombinant expression vector described in this invention is used to reduce soybean plant height and increase 100-seed weight.

[0011] When constructing plant expression vectors using GmCOX6b, any enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding selective marker genes (GUS gene, GFP gene, etc.) or antibiotic resistance genes (gentamicin markers, kanamycin markers, hygromycin markers, etc.). From a safety perspective, no selective marker genes may be added, and transformed plants can be screened directly based on phenotypic traits.

[0012] The plant expression vector carrying the GmCOX6b of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant hosts to be transformed can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis thaliana, soybean, rapeseed, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0013] Beneficial effects:

[0014] In this invention, GmCOX6b belongs to the MLP subfamily of the COX VIB family and contains the COX VIB domain. Tissue expression analysis revealed that GmCOX6b is mainly expressed in pods, and subcellular localization showed that the protein was located in the cytoplasm, nucleus, and cell membrane. Overexpression of GmCOX6b in Arabidopsis thaliana resulted in a significant increase in the number of siliques and altered plant morphology compared to the control. Statistical analysis of the thousand-seed weight of transgenic Arabidopsis thaliana showed that GmCOX6b transgenic lines significantly increased the thousand-seed weight compared to the control. This invention discloses the effect of this gene in regulating pod development and its changes in yield traits. By directionally modifying the number of pods in crops, crop yields can be increased.

[0015] Using the plant overexpression vector pBA002-GmCOX6b, the GmCOX6b of this invention was introduced into plants to obtain transgenic plants, which can regulate the pod-setting behavior of the plants. Attached Figure Description

[0016] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0017] Figure 1 Cloning of the GmCOX6b gene

[0018] Primers were designed based on the GmCOX6b sequence information predicted by the Phytozome website. PCR amplification was performed using cDNA from Nanjing Agricultural University 1138-2 as a template, yielding a 234 bp DNA fragment. Sequencing analysis confirmed that the sequence information of this fragment matched the predicted sequence from the Phytozome website, indicating that this 234 bp fragment represents the GmCOX6b gene. The marker was 2kbp, with lengths of 100, 250, 500, 750, and 2000 bp from bottom to top.

[0019] Figure 2 Tissue expression analysis of the GmCOX6b gene.

[0020] The expression of GmCOX6b in different tissues of Nanjing Agricultural University 1138-2 was studied using real-time quantitative PCR. The different tissues were root, stem, leaf, flower, 7d pod, 14d pod, 21d pod, 35d pod, and 35d seed.

[0021] Figure 3 Subcellular localization of GmCOX6b

[0022] Figure 4 PCR identification and relative expression level analysis of transgenic soybeans.

[0023] (A) Identification results of T2 generation transgenic soybean gene sequence-specific primers. 1 represents the recipient Jack, negative control. 2 represents H2O, blank control. 3 represents the plasmid, positive control. 4-5 represent transgenic line OE-7. 6-7 represent transgenic line OE-17. M represents the 2000bp Marker, with band composition (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp. (B) Identification results of T2 generation transgenic soybean vector sequence-specific primers. Lanes 1-8 represent transgenic line OE-7. Lanes 9-15 represent transgenic line OE-17. Lane 15 represents H2O, blank control. Lane 17 represents the recipient Jack, negative control. Lane 18 represents the plasmid, positive control. M represents the 2000bp marker, with band composition (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp. (C) Detection of GmCOX6b gene expression levels in different lines (n=3). OE-7 and OE-17 represent two GmCOX6b gene overexpression lines, respectively. *: Significant difference at the p<0.05 level. ***: Significant difference at the p<0.001 level.

[0024] Figure 5Statistical analysis of agronomic traits of T2 generation transgenic soybean. N≥10. OE-7 and OE-17 represent two overexpression lines of the GmCOX6b gene, respectively, with Jack recipient as the control. (A) Number of main stem nodes. (B) Plant height, in cm. (C) Number of branches. (D) Number of pods per plant. (E) Number of seeds per plant. (F) Yield per plant, in g. (G) 100-seed weight, in g. * indicates significant difference at the p<0.05 level; ** indicates extremely significant difference at the p<0.01 level; *** indicates significant difference at the p<0.001 level. Detailed Implementation

[0025] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, and to the data. These embodiments are merely illustrative and are not intended to limit the scope of the invention in any way. In the following embodiments, various processes and methods not described in detail are conventional methods known in the art. Primers used are indicated upon their first appearance, and subsequent use of the same primers will use primers with the same initial indication.

[0026] Example 1: Cloning and Identification of Soybean GmCOX6b and its Encoding Gene

[0027] Using NANN 1138-2 as experimental material, it was planted in the plant light culture room of Nanjing Agricultural University in June 2021. The cDNA of DAF35 day pods after flowering was used as a template, and PCR amplification was performed using GmCOX6b-F and GmCOX6b-R as primers.

[0028] Upstream primer GmCOX6b-F: CGCAATTGTTGATCGAGTCTG;

[0029] Downstream primer GmCOX6b-R: AAAGACTTCTCATGCCTCGGA.

[0030] The GmCOX6b gene was amplified from total RNA in soybean pods using RT-PCR. Soybean pod tissue was collected, ground in a mortar and pestle, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to a glass homogenizer. The homogenized tissue was then transferred to another 1.5 mL EP tube, and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of the total RNA was assessed by formaldehyde denaturing gel electrophoresis, and the RNA content was measured using a spectrophotometer. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara to synthesize the first strand of cDNA. PCR amplification was then performed. The PCR reaction system consisted of: 2 μl cDNA (0.05 μg), 2 μl each of forward and reverse primers (10 μM), 25 μl 2×PhantaMax Buffer, 1 μl ldNTP (10 mM), and 1 U PhantaMax Super-Fidelity DNA polymerase (Vazyme), with the final volume made up to 50 μl of ultrapure water. The PCR program was performed on a Bio-RAD PTC200 PCR instrument. The program was: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 45 s, for a total of 30 cycles; then the reaction was terminated with a 72℃ extension for 5 min, and stored at 4℃. The PCR product was recovered and cloned into the pClone007 vector to obtain the T-GmCOX6b vector. Sequencing yielded the cDNA sequence SEQ ID NO.1 of the soybean gene GmCOX6b with a complete coding region, which is 234 bp in length and encodes the 77 amino acids shown in SEQ ID NO.2.

[0031] Example 2: Expression characteristics of GmCOX6b in different organs of soybean

[0032] RNA was extracted from roots, stems, leaves, flowers, 7-day pods, 15-day pods, 25-day pods, 35-day pods, 45-day pods, and 35-day seeds of the Nanjing Agricultural University 1138-2 material, and reversed into cDNA for RT-PCR analysis.

[0033] Total RNA extraction was performed as in Example 1. The soybean constitutive expression gene Tubulin was used as an internal reference gene, with amplification primers: Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG, Tubulin reverse primer sequence: CACTTACGCATCACATAGCA. Real-time quantitative PCR analysis was performed using cDNA from different soybean tissues or organs as templates. The amplification primers for GmCOX6b were: GmCOX6b-qPCR-F: GAGTTCATAGATGCTTGGCAGC, GmCOX6b-qPCR-R: CCCATTCTCCCTCTGTTCATTC. Results ( Figure 2 Analysis showed that GmCOX6b expression was relatively high in 7DAF pods, suggesting that GmCOX6b may be associated with soybean pod development.

[0034] Example 3: Subcellular localization of GmCOX6b

[0035] Subcellular localization was performed using transient expression of *Nicotiana benthamiana*. The vector used was P2, and the primers were GmCOX6b-P2-F: ACAAATCTATCTCTCTCGAGATGGCGGAGATTGAACT and GmCOX6b-P2-R: GCTCACCATGGATCCAAGAGGTCCTGGAAAAGTCCC. After PCR amplification and confirmation of the target band, the gel was excised and the recovered product was ligated into the vector via homologous recombination to construct the subcellular localization vector P2-GmCOX6b (gene at the N-terminus of GFP). After transient expression in *Nicotiana benthamiana*, the protein was incubated in the dark for 48 hours. Irradiation with a laser confocal microscope (Zeiss, LSM780) produced a green fluorescence signal, allowing for protein localization and photographic observation. Results are as follows: Figure 3-5 As shown, the empty vector plasmid was distributed throughout the cell, and the GmCOX6b:GFP fusion protein was distributed in the cell membrane and nucleus, indicating that GmCOX6b may function in the nucleus and membrane.

[0036] Example 4: Genetic Engineering of GmCOX6b

[0037] The vector was constructed using a double enzyme digestion method, which consisted of two steps: enzyme digestion and recombination. The primer sequences were: F: CGCGCCGGGCCCAGGCCTACGCGTATGGCGGAGATTGAACT, R: ATCGGGGAAATTCGAGCTCTCAAAGAGGTCCTGGAAAAGT.

[0038] The pBA002 vector was double-digested with BamH1 and Kpnl, and the target fragment was amplified from the T-GmCOX6b vector using the aforementioned adapter primers. Recombination and ligation then occurred, yielding the expression vector pBA002-GmCOX6b. This vector was transformed into *E. coli* DH5α, and the transformation solution was plated on LB agar containing 50 mg / L Kana for screening positive clones. After sequencing verification, the plasmid was extracted to obtain the pBA002-GmCOX6b plant overexpression vector. pBA002-GmCOX6b was then transformed into *Agrobacterium tumefaciens* strain EHA105 using a freeze-thaw method. Soybean was transformed with pBA002-GmCOX6b via *Agrobacterium tumefaciens* strain EHA105. Jack seeds, the recipient material, were sterilized with chlorine in a fume hood for 6 hours, and then germinated overnight on SG4 agar. After germination overnight, the seed coat was removed, the seeds were divided in half, part of the hypocotyl was removed, and seven wounds were made at the leaf axils. Simultaneously, prepare the bacterial suspension for infection. Agrobacterium tumefaciens suspension containing the pBA002-GmCOX6b recombinant vector is centrifuged at 200 rpm at 28°C until the OD600 value is 0.8-0.9, then centrifuged at 4000 rpm for 10 min. The supernatant is discarded, and the explants are resuspended in CCM solution until the OD600 value is 0.5-0.6. The prepared explants are then placed in the bacterial suspension and incubated at 150 rpm at 28°C for 30 min. The explants are then removed and spread evenly on CCM solid medium, wound side down, and co-cultured at 25°C for 4-5 days. Next, the explants are washed with sterile ultrapure water and Wish-Liquid, and then inserted obliquely into SIM medium without glufosinate at 45°C. The explants are cultured under light at 26°C for 15 days to induce budding. After 15 days, large buds are removed, and the medium is replaced with SIM medium containing 6 mg / L glufosinate for further budding induction. Two weeks later, the cotyledons and yellow leaves were removed, and the plants were transferred to SEM medium supplemented with 4 mg / L glufosinate. Subculture was then performed every 15 days, gradually reducing the glufosinate dosage. When the explant shoots grew to approximately 6 cm, the clustered shoots were transferred to rooting medium and cultured for about 10 days, at which point induced roots became visible. Once the root system was well-developed, the plants were transplanted into sterilized mixed nutrient soil and placed in an artificial incubator (16 hours light / 8 hours darkness, 25°C) for further growth.

[0039] DNA-level positivity was assessed in the progeny of overexpression-positive seedlings using gene sequence-specific primers F: CTAACAGAACTCGCCGTAA; R: TCAAAGAGGTCCTGGAAA, and vector sequence-specific primers Bar-F: AAACCCACGTCATGCCAGTTC and Bar-R: CGAGACAAGCACGGTCAACTT. Real-time quantitative PCR results showed that, compared to the control, the expression level of the GmCOX6b gene in the transgenic materials was significantly increased, with the OE-17 line showing an approximately 140-fold increase in expression. Figure 4 The primer sequences for quantitative fluorescence and the primer sequences for the internal reference gene Tubulin are the same as in Example 2.

[0040] Phenotypic observations were conducted on T2 generation 35S::GmCOX6b transgenic soybeans. Under net-house growth conditions, compared to the control, the plant height of the two overexpression lines, OE-7 and OE-17, was significantly reduced, while the 100-seed weight was significantly increased. Furthermore, the OE-7 line showed a decrease in the number of main stem nodes, the number of pods per plant, and the number of seeds, although the overall 100-seed weight was significantly increased, resulting in a slight decrease in yield per plant. Conversely, the OE-17 line showed significant increases in the number of branches, the number of pods, and the yield per plant. Figure 5 It is speculated that the number of pods per plant may have a greater impact on yield per plant than the weight of 100 seeds, leading to a decrease in yield in the OE-7 line. However, the reduced plant height may be beneficial for increasing yield per unit area under dense planting conditions. This also provides a new research approach for improving soybean yield.

Claims

1. The application of a recombinant expression vector containing the soybean GmCOX6b protein encoding gene in reducing soybean plant height and increasing 100-seed weight, characterized in that, The soybean GmCOX6b protein encoding gene was obtained by PCR amplification using cDNA from Nanjing Agricultural University 1138-2 as a template and primers GmCOX6b-F and GmCOX6b-R. The sequence of GmCOX6b-F is: CGCAATTGTTGATCGAGTCTG; the sequence of GmCOX6b-R is: AAAGACTTCTCATGCCTCGGA.

Images