A primer probe set and kit capable of simultaneously detecting mycoplasma genitalium, mycoplasma penetrans, mycoplasma fermentans and mycoplasma pirum

Abstract

The present application relates to the technical field of biology, and particularly relates to a primer probe set and kit capable of simultaneously detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans and Mycoplasma pirum. The present application provides a primer probe set and kit for detecting Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans and Mycoplasma pirum. The present application realizes accurate detection of Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma fermentans and Mycoplasma pirum in a same reaction system, and does not have the defect of mutual interference, reduces the operation time of an operator, and reduces the detection cost.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a primer and probe set and kit for the simultaneous detection of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis. Background Technology

[0002] Mycoplasma genitalium is one of the main mycoplasma species causing sexually transmitted diseases. It can lead to urethritis, cervicitis, and proctitis, and subsequently pelvic inflammatory disease, prostatitis, and epididymitis. It is also closely associated with premature birth. Other studies have shown that Mycoplasma genitalium can cause mucosal damage and trigger related inflammatory responses such as increased cytokine expression and polymorphonuclear leukocyte reactions, thereby promoting the transmission of human immunodeficiency virus (HIV). Furthermore, there is a link between HIV budding and Mycoplasma genitalium adhesion; adhesion of Mycoplasma genitalium to HIV-infected lymphocytes may activate HIV replication or release, thus accelerating disease progression.

[0003] Mycoplasma penetratingus is a new mycoplasma species isolated from the urine of AIDS patients in 1990. It was named Mycoplasma penetratingus (Mpe), also known as penetrating mycoplasma, because it can adsorb onto host cells and penetrate into the cells.

[0004] Fermentation mycoplasma can activate NF-κB through TLR1, TLR2 and Toll-like receptor 6 (TLR6) to promote HIV replication, enhance HIV infectivity and accelerate the progression of AIDS.

[0005] Mycoplasma pyriformis, along with Mycoplasma genitalium, Mycoplasma penetratingum, and Mycoplasma fermentans, have all been reported as cofactors of human immunodeficiency virus (HIV) infection and contributing factors to the development of AIDS, or Acquired Immunodeficiency Syndrome. Furthermore, treatment regimens differ for patients with HIV infection alone and those with concurrent urogenital mycoplasma infection. Accurate detection can guide doctors and patients in making rational drug selections for treatment.

[0006] Currently, there are three main categories of methods for detecting sexually transmitted disease microorganisms: culture methods, immunological methods, and molecular biological methods. Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentum, and Mycoplasma piraceae all grow slowly and are difficult to isolate and culture. Therefore, isolation and culture are not used as a routine detection method in clinical practice. Furthermore, serological detection of Mycoplasma genitalium often involves antigenic cross-reactivity with certain pathogens, resulting in low sensitivity and specificity. Currently, there are no mature serological detection technologies for Mycoplasma penetratingum, Mycoplasma fermentum, and Mycoplasma piraceae, both domestically and internationally. Therefore, the main method used in China for detecting these difficult-to-culture mycoplasma species is the polymerase chain reaction (PCR) method, which was reported earlier abroad. Taqman fluorescent PCR is a new technology developed in the 1990s. Taqman PCR introduces a specific fluorescent probe that is homologous to a sequence on the inside of the PCR primer pair. The probe is labeled with reporter fluorescence at its 5' end and quencher fluorescence at its 3' end. When the probe remains intact, the emission wavelength of the reporter fluorescence is absorbed by the excitation wavelength of the quencher fluorescence, making the reporter fluorescence signal undetectable. During PCR, the 5'-3' exonuclease activity of Taq DNA polymerase cleaves the fluorescent probe into single bases, eliminating the influence of quencher fluorescence on the reporter fluorescence, allowing the reporter fluorescence signal to be detected, which increases with the number of PCR cycles. Because the entire experiment is conducted in a completely closed system, cross-contamination is avoided, resulting in more objective and accurate results. Furthermore, the hybridization of specific probes during amplification further enhances the sensitivity and specificity of the experiment. Real-time fluorescence PCR has significant advantages in sensitivity, accuracy, and other aspects in sexually transmitted disease (STD) detection, and is currently a commonly used method for large-scale STD screening and detection, widely adopted. Therefore, providing a primer-probe combination and real-time fluorescence quantitative PCR kit for detecting Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentum, and Mycoplasma pyriformis would have significant practical implications. Summary of the Invention

[0007] In view of this, the present invention provides a primer and probe set and kit for detecting Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma pyriformis. Using this combination, it is possible to accurately detect Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma pyriformis individually or simultaneously in the same reaction system, without the defect of mutual interference, reducing the operation time of operators and lowering the detection cost.

[0008] Another objective of this invention is to provide at least one novel target gene for detecting Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0010] This invention provides a set of target nucleic acids for detecting Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma piraceae, wherein the sequences include at least one of the following:

[0011] (i) Mycoplasma genitalium rpmG gene, GenBank: L43967.2, positions 64400 to 64492;

[0012] (ii) rpoB gene of Mycoplasma penetratingus, GenBank: FJ765338.1, positions 334 to 519;

[0013] (iii) Unknown functional protein gene of Mycoplasma fermentation, GenBank: LR214966.1, positions 15460 to 15776;

[0014] (iv) 16S rRNA gene of Mycoplasma piriformis, GenBank: AY757364.1, positions 169 to 267.

[0015] This invention also provides the application of the sequences described in the above-mentioned target nucleic acids as targets in the design of primer probe sets or the preparation of detection kits.

[0016] In some specific embodiments of the present invention, the above-mentioned applications include at least one of the following:

[0017] The application of i as a target in the design of primer probe sets for detecting Mycoplasma genitalium or in the preparation of Mycoplasma genitalium detection kits;

[0018] The application of ii as a target in the design of primer probe sets for detecting penetrating mycoplasma or in the preparation of mycoplasma detection kits;

[0019] The application of ii as a target in the design of primer and probe sets for detecting fermentation mycoplasma or in the preparation of fermentation mycoplasma detection kits;

[0020] The application of iv as a target in designing primer and probe sets for detecting Mycoplasma pyriformis or in preparing Mycoplasma pyriformis detection kits.

[0021] The present invention also provides primer probe sets, including at least one set of primer probe set 1, primer probe set 2, primer probe set 3, and primer probe set 4;

[0022] The primer-probe set 1 includes primer 1, primer 2, and probe 1;

[0023] The primer-probe set 2 includes primer 3, primer 4 and probe 2;

[0024] The primer-probe set 3 includes primer 5, primer 6 and probe 3;

[0025] The primer-probe set 4 includes primer 7, primer 8 and probe 4;

[0026] Primer 1 has the following characteristics:

[0027] (1) A nucleotide sequence as shown in SEQ ID NO:1; or

[0028] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and whose function is the same as or similar to that of (1); or

[0029] (3) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (1) or (2);

[0030] Primer 2 has the following characteristics:

[0031] (4) A nucleotide sequence as shown in SEQ ID NO:2; or

[0032] (5) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (4), and whose function is the same as or similar to that of (4); or

[0033] (6) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (4) or (5);

[0034] The probe 1 has:

[0035] (7) A nucleotide sequence as shown in SEQ ID NO:9; or

[0036] (8) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (7), and whose function is the same as or similar to that of (7); or

[0037] (9) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (7) or (8);

[0038] The primer 3 has the following characteristics:

[0039] (10) A nucleotide sequence as shown in SEQ ID NO:3; or

[0040] (11) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (10), and whose function is the same as or similar to that of (10); or

[0041] (12) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (10) or (11);

[0042] The primer 4 has the following characteristics:

[0043] (13) A nucleotide sequence as shown in SEQ ID NO:4; or

[0044] (14) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (13), and whose function is the same as or similar to that of (13); or

[0045] (15) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (13) or (14);

[0046] The probe 2 has:

[0047] (16) A nucleotide sequence as shown in SEQ ID NO:10; or

[0048] (17) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (16), and whose function is the same as or similar to that of (16); or

[0049] (18) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (16) or (17);

[0050] Primer 5 has the following characteristics:

[0051] (19) A nucleotide sequence as shown in SEQ ID NO:5; or

[0052] (20) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (19), and whose function is the same as or similar to that of (19); or

[0053] (21) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (19) or (20);

[0054] Primer 6 has the following characteristics:

[0055] (22) A nucleotide sequence as shown in SEQ ID NO:6; or

[0056] (23) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (22), and whose function is the same as or similar to that of (22); or

[0057] (24) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (22) or (23);

[0058] The probe 3 has:

[0059] (25) A nucleotide sequence as shown in SEQ ID NO:11; or

[0060] (26) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (25), and whose function is the same as or similar to that of (25); or

[0061] (27) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (25) or (26);

[0062] The primer 7 has the following characteristics:

[0063] (28) A nucleotide sequence as shown in SEQ ID NO:7; or

[0064] (29) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (28), and whose function is the same as or similar to that of (28); or

[0065] (30) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (28) or (29);

[0066] Primer 8 has the following characteristics:

[0067] (31) A nucleotide sequence as shown in SEQ ID NO:8; or

[0068] (32) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (31), and whose function is the same as or similar to that of (31); or

[0069] (33) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (31) or (32);

[0070] The probe 4 has:

[0071] (34) A nucleotide sequence as shown in SEQ ID NO:12; or

[0072] (35) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (34), and whose function is the same as or similar to that of (34); or

[0073] (36) A nucleotide sequence that is at least 95% homologous to the nucleotide sequence shown in (34) or (35);

[0074] The number of items is 2 to 5.

[0075] In some specific embodiments of the present invention, probe 1, probe 2, probe 3, and probe 4 of the above primer-probe set are independently connected to a fluorescent group and a quenching group, respectively;

[0076] The fluorescent groups include: FAM, HEX, ROX, VIC, Cy5, or CY5.5;

[0077] The quenching group includes BHQ1 or BHQ2.

[0078] The present invention also provides primer-probe combinations, including at least two of the primer-probe sets 1, 2, 3, and 4 described above.

[0079] The present invention also provides the application of the above primer-probe combination in detecting at least one of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis.

[0080] The present invention also provides the application of the above-mentioned primer-probe set or primer-probe combination in the preparation of reagents or kits for detecting at least one of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis.

[0081] The present invention also provides reagents, including the primer-probe set or primer-probe combination described above.

[0082] In some specific embodiments of the present invention, the above-mentioned reagents also include bifunctional DNA polymerase, uracil DNA glycosylase, dNTP, PCR amplification enhancer, and enzyme activator;

[0083] The PCR amplification enhancers include DMSO, Tween 20, and glycerol.

[0084] In some specific embodiments of the present invention, the enzyme activator includes magnesium ion enzyme activator, manganese ion activator, or a combination thereof.

[0085] In some specific embodiments of the present invention, the bifunctional DNA polymerase described in the above reagent is a Tth DNA polymerase.

[0086] The present invention also provides a kit comprising the above-described primer-probe set or primer-probe combination.

[0087] In some specific embodiments of the present invention, the above-described kit includes the above-described reagents.

[0088] In some specific embodiments of the present invention, the above-mentioned kit includes PCR reaction solution, positive control and negative control;

[0089] The PCR reaction solution includes the primer and probe set or primer and probe combination described above.

[0090] The present invention also provides a detection method, including detection based on the above-described primer-probe set or primer-probe combination.

[0091] In some specific embodiments of the present invention, the above-described detection method includes detection based on the above-described reagents.

[0092] In some specific embodiments of the present invention, the above-described detection method includes detection based on the above-described reagent kit.

[0093] The biomarkers, primer-probe sets or primer-probe combinations, and kits of the present invention have the following effects:

[0094] Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma pyriformis have high nutritional requirements, are difficult to culture, and have long culture times, which may delay diagnosis and are not suitable for rapid clinical diagnosis. In contrast, the target gene, primer, and probe set provided by this invention can rapidly and accurately detect Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma pyriformis, and can achieve single and multiple detection, improving detection efficiency. This invention can detect samples such as urogenital tract secretions and urine, which are convenient to sample and have a wide sample coverage. It avoids the sampling pain caused by only being compatible with the type of genital tract swab sample. The kit provided by this invention can be stored at 2-8℃, is easy to operate, has good specificity and reproducibility, and the detection method is relatively time-consuming, providing a reliable molecular diagnostic basis for the auxiliary diagnosis of mycoplasma infection related to genital tract diseases and mycoplasma infection related to HIV. Attached Figure Description

[0095] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0096] Figure 1 The image shows the results of this invention in detecting positive samples of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis.

[0097] Figure 2 This invention demonstrates the detection results of samples of Mycoplasma genitalium (concentration 100 copies / mL), Mycoplasma penetratingis (concentration 100 copies / mL), Mycoplasma fermentans (concentration 100 copies / mL), and Mycoplasma pyriformis (concentration 100 copies / mL);

[0098] Figure 3 The amplification curves of the kit of the present invention for samples at a concentration 10 times the limit of detection (1000 copies / mL) after being stored at 2-8℃ for 6 months and 24 months are shown.

[0099] Figure 4The amplification curves of the kit of the present invention with samples stored at 2-8℃ for 6 months and 24 months, and with a detection limit of 2 times (200 copies / mL) are shown.

[0100] Figure 5 This invention demonstrates the results of detecting high-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, Group B Streptococcus, Candida albicans, Candida glabrata, Staphylococcus aureus, and inactivated Trichomonas vaginalis strains.

[0101] Figure 6 This invention demonstrates the results of detecting samples with added interfering drugs. Detailed Implementation

[0102] This invention discloses a primer and probe set and kit for the simultaneous detection of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0103] This invention utilizes PCR methods such as real-time quantitative PCR, melting curve assay, loop-mediated isothermal amplification, multiplex PCR, digital PCR, nested PCR, and point-of-care testing (POCT). It aims to detect novel target genes, including the rpmG gene of *Mycoplasma genitalium*, the rpoB gene of *Mycoplasma penetratingum*, and an unknown functional protein gene of *Mycoplasma fermentatum*. Probes and primers are designed targeting conserved regions in the rpmG gene of *Mycoplasma genitalium*, the rpoB gene of *Mycoplasma penetratingum*, the unknown functional protein gene of *Mycoplasma fermentatum*, and the 16S rRNA gene of *Mycoplasma piriformis*.

[0104] Probes and primers were designed from conserved regions of the following genes reported in the NCBI database: *Mycoplasma genitalium* rpmG gene (GenBank: L43967.2, >L43967.2:64400-64492), *Mycoplasma penetratingum* rpoB gene (GenBank: BA000026.2, >FJ765338.1:334-519), *Mycoplasma fermentatum* unknown functional protein gene (GenBank: AP009608.1, >LR214966.1:15460-15776), and *Mycoplasma piriformis* 16S rRNA gene (GenBank: AY757364.1). All target genes were searchable on NCBI, and all probes were TaqMan probes.

[0105] This invention provides a primer-probe composition for detecting Mycoplasma genitalium, comprising a target gene primer-probe composition; the target gene primer-probe composition includes:

[0106] Primer 1 (upstream): 5'-GCACTGCTTGCAGTACTTGTTG-3' (SEQ ID NO:1);

[0107] Primer 2 (downstream): 5'-GTCTGTCAAGACTGTTTAAGTCG-3' (SEQ ID NO:2);

[0108] Probe 1: 5'-GATAAGTCGCTGCAAAGGTTGTTTTGTTCACCG-3' (SEQ ID NO: 9);

[0109] Target sequence: 5'-GCACTGCTTGCAGTACTTGTTGATGATAAGTCGCTGCAAAGGTTGT TTTGTTCACCGTTTTACATAGTTACGACTTAAACAGTCTTGACAGAC-3' (SEQ ID NO: 13);

[0110] This invention provides a primer-probe composition for detecting penetrating mycoplasma, comprising a target gene primer-probe composition; the target gene primer-probe composition includes:

[0111] Primer 3 (upstream): 5'-AGGCATGTCTTCAACTGGAAC-3' (SEQ ID NO:3);

[0112] Primer 4 (downstream): 5'-GAAGGAACGGTTGCAATGG-3' (SEQ ID NO:4);

[0113] Probe 2: 5'-CCCTTTGTTTCCATGACGTCCAGCC-3' (SEQ ID NO:10);

[0114] Target sequence: 5'-AGGCATGTCTTCAACTGGAACAATTTTAGAAATAATCCCTTTGTTTC CATGACGTCCAGCCATCTTATCACCAATTTGGATTTTTCTTTTTGTACAACATAAACT TTAATTTGTTCAATTACATCAGCATTCAATTCATAGTCATCTTCAACTTTGAATCTTTTT ACCATTGCAACCGTTCCTTC-3' (SEQ ID NO: 14);

[0115] This invention provides a primer-probe composition for detecting fermentation mycoplasma, comprising a target gene primer-probe composition; the target gene primer-probe composition includes:

[0116] Primer 5 (upstream): 5'-CTTCAGAACAAGAAAGTTCACTTG-3' (SEQ ID NO:5);

[0117] Primer 6 (downstream): 5'-GTTGGTCTATACAATTTTGTTGG-3' (SEQ ID NO: 6);

[0118] Probe 3: 5'-GGTTTAAAAGCTTTGCAACAACTTGATGGTGG-3' (SEQ ID NO:11);

[0119] Target sequence: 5'-CTTCAGAACAAGAAAGTTCACTTGTTTTTTGCAAAAAATGAAATGAA TGCAATTAAAAAATGATCAAATTTCTAAATTAGATAGTGAAGGTTTAAAAGCTTTGCAACAACTTGATGGTGGTGTTGATTTTACAAATAATGATTTAATTAAAAATTATTTAGAAAATGATTATTTATCAGCTGTTAAAGATTTAAGAGAATATTTCTTAAACAAACTAATTTACTTATTACATGAAAAATTTAATTATGGTGATGTATACTGATCTCCAACAAAATTGTATAGACCAAC-3'(SEQ ID NO:15);

[0120] This invention provides a primer-probe composition for detecting Mycoplasma pyriformis, comprising a target gene primer-probe composition; the target gene primer-probe composition includes:

[0121] Primer 7 (upstream): 5'-CATGACCAAAATAAATGTTGACATC-3' (SEQ ID NO:7);

[0122] Primer 8 (downstream): 5'-CACCTTATTACAATATTGGTGTTAA-3' (SEQ ID NO:8);

[0123] Probe 4: 5'-GCTTTGCGATGGGTTTTAACATTTAAATTGG-3' (SEQ ID NO:12);

[0124] Target sequence: 5'-CACCTTATTACAATATTGGTGTTAATAATTTTAAAATCCAATTTAAAT GTTAAAACCCATCGCAAAGCAAATTTGATGTCAACATTTATTTTGGTCATG-3' (SEQ ID NO: 16);

[0125] This invention provides a nucleic acid detection kit for simultaneous detection of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis, comprising a PCR reaction solution, a positive control, and a negative control. The PCR reaction solution contains the aforementioned primer and probe set, a bifunctional DNA polymerase, uracil DNA glycosylase, dNTPs, a PCR amplification enhancer, and manganese ions.

[0126] The bifunctional DNA polymerase is Tth DNA polymerase, the uracil DNA glycosylase is UDG enzyme, the dNTPs are a combination of dATP, dGTP, dCTP and dUTP, and the PCR amplification enhancer consists of DMSO, Tween 20 and glycerol.

[0127] The concentrations of upstream and downstream primers used for target nucleotide amplification were 0.2–1.0 μmol / L; the concentration of the detection probe was 0.2–1.0 μmol / L. Positive control (used as a positive control) consisted of a 1:1:1:1 mixture of four target plasmids: *Mycoplasma genitalium* rpmG gene (GenBank: L43967.2, >L43967.2:64400-64492), *Mycoplasma penetratingis* rpoB gene (GenBank: BA000026.2, >FJ765338.1:334-519), *Mycoplasma fermentatus* unknown functional protein gene (GenBank: AP009608.1, >LR214966.1:15460-15776), and *Mycoplasma piriformis* 16S rRNA gene (GenBank: AY757364.1). Negative control (used as a negative control) was physiological saline.

[0128] In the method described in this invention, the real-time quantitative PCR system comprises:

[0129] Table 1: Composition of PCR reaction solution

[0130]

[0131]

[0132] Table 2: Composition of PCR reaction solution 2

[0133] <![CDATA[Mn(OAc)2(pH 6.0)]]> 0.1–0.4 mmol / L Sodium azide 0.0005~0.0015g / L <![CDATA[H2O]]> Add 15μL

[0134] Table 3: The amplification program for real-time quantitative PCR in the method of this invention:

[0135]

[0136] In fact, this application is not limited to tube-by-tube testing; it can detect one, two, three, or four pathogens in a single tube.

[0137] Unless otherwise specified, the raw materials, reagents, consumables and instruments involved in this invention are all commercially available products and can be purchased from the market.

[0138] The present invention will be further illustrated below with reference to the embodiments.

[0139] Example 1

[0140] This embodiment describes a nucleic acid detection kit for simultaneously detecting Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis, comprising the following components:

[0141] (1) 15 μL PCR reaction solution

[0142] The concentrations of each component in PCR reaction solution 1 are as follows:

[0143] 0.2 μmol / L primer 1, 0.2 μmol / L primer 2, 0.1 μmol / L probe 1;

[0144] 0.2 μmol / L primer 3, 0.2 μmol / L primer 4, 0.1 μmol / L probe 2;

[0145] 0.2 μmol / L primer 5, 0.2 μmol / L primer 6, 0.1 μmol / L probe 3;

[0146] 0.2 μmol / L primer 7, 0.2 μmol / L primer 8, 0.1 μmol / L probe 4;

[0147] Among them, probe 1 has a fluorescent group of FAM and a quenching group of BHQ1; probe 2 has a fluorescent group of HEX and a quenching group of BHQ1; probe 3 has a fluorescent group of ROX and a quenching group of BHQ2; and probe 4 has a fluorescent group of Cy5 and a quenching group of BHQ2.

[0148] 0.5 U / μL Tth DNA polymerase, 0.05 U / μL UDG enzyme, 0.2 mmol / L dATP, 0.2 mmol / L dGTP, 0.2 mmol / L dCTP, 0.4 mmol / L dUTP, 0.001 g / L preservative - sodium azide.

[0149] 50 mmol / L tris(hydroxymethyl)methylglycine (pH 8.3), 100 mmol / L potassium acetate;

[0150] 0.08 g / L DMSO, 0.0005 g / L Tween20, 0.002 g / L glycerin.

[0151] (2) 15 μL PCR reaction solution 2

[0152] The concentrations of each component in PCR reaction solution 2 are as follows:

[0153] 0.3 mmol / L Mn(OAc)2, 0.001 g / L preservative - sodium azide.

[0154] Positive control samples: The final concentration of each plasmid for the four target sequences of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentata, and Mycoplasma pyriformis was 1×10⁻⁶. 5 copies / mL;

[0155] Negative control: Sterile physiological saline.

[0156] Example 2

[0157] This invention is used to detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma piraceae. In this embodiment, the kit prepared in Example 1 is used to detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentatum, and Mycoplasma piraceae in samples such as genital tract secretions, urethral secretions, and urine.

[0158] (1) Reagent preparation

[0159] Based on the number of samples to be tested, negative controls, and positive controls, take the corresponding amounts of PCR reaction solution 1 and PCR reaction solution 2 in the proportion of (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), mix them thoroughly to form a PCR-MIX mixture, and centrifuge briefly before use.

[0160] (2) Sample processing

[0161] 1. Rinse one urogenital tract swab sample (positive sample for sequencing of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, or Mycoplasma pyriformis) with 1 mL of physiological saline 5 to 10 times, and keep the rinsed liquid for later use.

[0162] One positive urine sample was collected and kept on standby (sequencing confirmed it was positive). After digital PCR determination, the concentrations of the corresponding pathogens in the urogenital swab sample and the urine sample were adjusted to be consistent with the corresponding dilution matrix (Mycoplasma genitalium: 600 copies / mL, Mycoplasma penetratingis: 600 copies / mL, Mycoplasma fermentans: 600 copies / mL, Mycoplasma pyriformis: 300 copies / mL).

[0163] 2. Take 200μL of swab positive sample and 200μL of urine positive sample, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd. (Medical Device Filing Certificate No. / Product Technical Requirements No.: Yu Zheng Xie Bei 20180037) to extract nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingus, Mycoplasma fermentum and Mycoplasma pyriformis from the sample to be tested, and set aside for later use;

[0164] 3. Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, then add 20 μL of extracted nucleic acid from the test sample and 20 μL of nucleic acid product from the negative / positive quality control sample. Make 3 replicates for each sample and centrifuge for 10 seconds.

[0165] (3) Fluorescent PCR reaction

[0166] 1. Place the PCR reaction tubes into the sample slots of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0167] 2. Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0168] 3. The specific PCR reaction procedure is as follows: 50℃ for 2 min; 95℃ for 2 min; (95℃ for 10 s, 60℃ for 22 s, 45 Cycle); 40℃ for 10 s.

[0169] (4) Results Analysis

[0170] After the PCR reaction is complete, the test result is determined based on the Ct value. The intersection of the amplification curve and the threshold line is called the Ct value (i.e., the cycle threshold, which refers to the number of cycles the fluorescence signal in the PCR reaction tube takes to reach the set threshold). The instrument software can determine the test result based on the Ct value of each sample. For samples with a Ct value ≤ 38.00, a positive result is reported; for samples with a Ct value > 38 (≥ 40), a result less than the detection limit is reported; for samples with no Ct value, a negative result is reported; if a Ct value > 40 (≥ 45), the sample is retested.

[0171] The results are as follows Figure 1 As shown in Table 4, this kit can be used to detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis, and there is no interference between the four targets. The detection results of urogenital swab samples and urine samples are not different.

[0172] Table 4

[0173]

[0174] Example 3

[0175] This embodiment uses the kit prepared in Example 1 to detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma piraceae in urogenital tract secretion samples to verify the detection effect of the present invention.

[0176] (1) Samples of urogenital secretions of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentatum, and Mycoplasma piriformis with known concentrations (digital PCR values) (the final concentration of each target in the sample is 100 copies / mL) were extracted for nucleic acid according to Example 2 and then detected by fluorescent PCR reaction according to Example 2.

[0177] (2) Results Analysis

[0178] The results were analyzed according to Example 2, and the results are as follows: Figure 2 As shown, the kit can stably detect samples at a concentration of 100 copies / mL, demonstrating high sensitivity.

[0179] Example 4

[0180] The kit of the present invention can be stored at 2-8℃. According to the number of test samples, negative controls and positive controls, take the corresponding amount of PCR reaction solution 1 and PCR reaction solution 2 stored at 2-8℃ for 0 days in the ratio (15μL / person PCR reaction solution 1 + 15μL / person PCR reaction solution 2), mix them thoroughly to form a PCR-MIX mixture, and then centrifuge briefly for later use.

[0181] (1) Mix the positive samples from the urogenital tract with the target sample concentrations of 2 times the limit of detection (200 copies / mL) and 10 times the limit of detection (1000 copies / mL) and set aside.

[0182] (2) Take 200 μL of the sample to be tested, negative control and positive control, and extract nucleic acid from the sample to be tested using the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd., and set aside;

[0183] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, and then add 20 μL each of the extracted test sample and negative / positive quality control nucleic acid product. Centrifuge for 10 seconds.

[0184] (4) Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0185] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0186] (6) The specific PCR reaction procedure is as follows: 50℃ for 2 min; 95℃ for 2 min; (95℃ for 10 s, 60℃ for 22 s, 45 Cycle); 40℃ for 10 s.

[0187] (7) Repeat the above steps when the kit is stored at 2-8℃ for 6 months and 24 months, and compare the differences before and after.

[0188] The results are as follows Figure 3 , Figure 4 As shown, after 6 months and 24 months of storage, the CT values ​​and amplification heights showed no significant changes compared to the control group, indicating that storage at 2–8℃ has no effect on the detection results of the reagent kit provided by this invention, and the reagent can be stored at 2–8℃. As shown in Table 5, the difference between the real-time and control group CT values ​​was no higher than 0.33CT, meeting the difference requirement.

[0189] Table 5

[0190]

[0191] Example 5

[0192] This embodiment verifies the specificity of the kit of the present invention. According to the number of test samples, negative controls and positive controls, take the corresponding amount of PCR reaction solution 1 and PCR reaction solution 2 in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2), mix them thoroughly to form a PCR-MIX mixture, and then centrifuge briefly for later use.

[0193] (1) High-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, Group B streptococci, Candida albicans, Candida glabrata, Staphylococcus aureus, and inactivated strains of Trichomonas vaginalis, which may be cross-contaminated, were added to the negative swab samples of the urogenital tract at the concentrations shown in Table 6. The samples were then mixed and set aside.

[0194] Table 6

[0195] High-risk human papillomavirus type 16 <![CDATA[4.3×10 6 genomic copies / mL]]> High-risk human papillomavirus type 18 <![CDATA[4.3×10 6 genomic copies / mL]]> Herpes simplex virus type 2 <![CDATA[2.27×10 5 TCID50 / mL]]> Varicella-zoster virus <![CDATA[2.5×10 5 TCID50 / mL]]> Human cytomegalovirus <![CDATA[1.00×10 5 IU / mL]]> EB virus <![CDATA[1.00×10 5 IU / mL]]> Chlamydia trachomatis <![CDATA[7.83×10 6 CFU / mL]]> Neisseria gonorrhoeae <![CDATA[3.20×10 6 CFU / mL]]> Ureaplasma urealyticum <![CDATA[1.23×10 6 copies / mL]]> Mycoplasma hominis <![CDATA[1.30×10 6 CFU / mL]]> Mycoplasma pneumoniae <![CDATA[1.80×10 6 CFU / mL]]> Group B Streptococcus <![CDATA[2.00×10 6 CFU / mL <!-- 11 -->]]> Candida albicans <![CDATA[3.00×10 6 CFU / mL]]> Candida glabrata <![CDATA[7.87×10 6 CFU / mL]]> Staphylococcus aureus <![CDATA[7.52×10 6 CFU / mL]]> Trichomonas vaginalis <![CDATA[3.14×10 5 [pcs / ml]]>

[0196] (2) Take 200 μL of the sample to be tested, negative control and positive control, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd. (medical device filing certificate number / product technical requirements number: Yu Zheng Xie Bei 20180037) to extract nucleic acid from the sample to be tested, and set it aside;

[0197] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, and then add 20 μL each of the extracted test sample and negative / positive quality control nucleic acid product. Centrifuge for 10 seconds.

[0198] (4) Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0199] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0200] (6) The specific PCR reaction procedure is as follows: 50℃ for 2 min; 95℃ for 2 min; (95℃ for 10 s, 60℃ for 22 s, 45 Cycle); 40℃ for 10 s.

[0201] The results are as follows Figure 5As shown, the kit provided by this invention can detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis, but it cannot detect the nucleic acids of high-risk human papillomavirus type 16, high-risk human papillomavirus type 18, herpes simplex virus type 2, varicella-zoster virus, human cytomegalovirus, Epstein-Barr virus, Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum, Mycoplasma hominis, Mycoplasma pneumoniae, Group B Streptococcus, Candida albicans, Candida glabrata, Staphylococcus aureus, and inactivated strains of Trichomonas vaginalis. This kit does not cross-react with the above pathogens.

[0202] Example 6

[0203] This embodiment verifies the anti-interference ability of the kit in Example 1. According to the number of test samples, negative controls and positive controls, take the corresponding amount of PCR reaction solution 1 and PCR reaction solution 2 in proportion (15μL / person PCR reaction solution 1 + 15μL / person PCR reaction solution 2), mix them thoroughly to form a PCR-MIX mixture, and then centrifuge briefly before use.

[0204] (1) To assess the impact of commonly used drugs for treating sexually transmitted diseases on test results, the following drugs were included: penicillin sodium, azithromycin, levofloxacin hydrochloride, vancomycin, clindamycin, erythromycin, ampicillin, doxycycline hydrochloride, cefotaxime, minocycline hydrochloride, ciprofloxacin, and nifuratel-nystatin. These interfering substances were added to weakly positive samples (2-3 times the limit of detection concentration), and mixed thoroughly. The control group consisted of weakly positive samples without the addition of these interfering substances.

[0205] Table 7

[0206] sodium penicillin 400μg / mL Azithromycin 2μg / mL Levofloxacin hydrochloride 2μg / mL Vancomycin 1500 μg / mL clindamycin 8μg / mL Erythromycin 7μg / mL Ampicillin 17 μg / mL Doxycycline hydrochloride 2.5 μg / mL Cefotaxime 4.6 μg / mL Minocycline hydrochloride 5.1 μg / mL Ciprofloxacin 2.5 μg / mL Nifuratel Nystatin 1.35 μg / mL

[0207] (2) Take 200 μL of the sample to be tested, negative control and positive control, and use the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd. (medical device filing certificate number / product technical requirements number: Yu Zheng Xie Bei 20180037) to extract nucleic acid from the sample to be tested, and set it aside;

[0208] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, and then add 20 μL each of the extracted test sample and negative / positive quality control nucleic acid product. Centrifuge for 10 seconds.

[0209] (4) Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0210] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel for detection; set the reference fluorescence to none;

[0211] (6) The specific PCR reaction procedure is as follows: 50℃ for 2 min; 95℃ for 2 min; (95℃ for 10 s, 60℃ for 22 s, 45 Cycle); 40℃ for 10 s.

[0212] The results are as follows Figure 6 As shown, common interfering drugs for sexually transmitted pathogens do not affect the detection results of the kit provided by this invention. Table 8 shows the comparison results of CT values ​​between the experimental group and the control group.

[0213] Table 8

[0214]

[0215]

[0216] Example 7

[0217] To further demonstrate that this kit can specifically detect the nucleic acids of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis, this example verifies the detection results of 50 collected clinical samples. Based on the number of samples to be tested, negative controls, and positive controls, the samples were thoroughly mixed in proportion (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2) to form a PCR-MIX mixture, which was then briefly centrifuged and set aside for later use.

[0218] (1) Rinse the 55 collected clinical samples with 1 mL of physiological saline, mix well and set aside;

[0219] (2) Take 200 μL of the sample to be tested, negative control and positive control, and extract nucleic acid from the sample to be tested using the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd., and set aside;

[0220] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, and then add 20 μL each of the extracted test sample and negative / positive quality control nucleic acid product. Centrifuge for 10 seconds.

[0221] (4) Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0222] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel, and CY5 channel to detect the target; set the reference fluorescence to none;

[0223] (6) The specific PCR reaction procedure is as follows: 50℃ for 2 min; 95℃ for 2 min; (95℃ for 10 s, 60℃ for 22 s, 45 Cycle); 40℃ for 10 s.

[0224] The detection results of this kit were compared with the sequencing results, and the results showed that the detection results of this kit and the sequencing results were consistent, as shown in Table 9.

[0225] Table 9

[0226]

[0227]

[0228] Example 8

[0229] This example demonstrates an internal standard addition experiment to verify the reliability of experimental data. The internal standard genes amplified and detected include β-globin, RNase P gene, Actin, or GAPDH. This example uses the human β-globin gene as an example.

[0230] The internal standard primer-probe composition includes:

[0231] Internal standard upstream primer: 5'-CAGGTTTAAGGAGACCAATAG-3' (SEQ ID NO:17);

[0232] Internal standard downstream primer: 5'-GAGAGTCAGTGCCTATCAG-3' (SEQ ID NO:18);

[0233] Internal standard fluorescent probe: 5'-CTGGGCATGTGGAGACAGAGAAGA-3' (SEQ ID NO:19).

[0234] The sequence of the internal standard: 5'-CAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAG AGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTC-3' (SEQ ID NO: 20).

[0235] This example verifies the effectiveness of this kit for detecting internal standards in clinical samples. Based on the number of test samples, negative controls, and positive controls, mix thoroughly in the specified ratio (15 μL / person PCR reaction solution 1 + 15 μL / person PCR reaction solution 2) to form a PCR-MIX mixture, briefly centrifuge, and set aside. Perform testing in two tubes:

[0236] Tube 1: Contains Mycoplasma genitalium primers and probes, Mycoplasma penetrating primers and probes, and internal standard primers and probes (the internal standard fluorescent probe is labeled with the reporter fluorescent group Cy5 at the 5' end and with the non-luminescent quencher group labeled BHQ2 at the 3' end);

[0237] Tube 2: Contains Mycoplasma fermentata primers and probes, Mycoplasma pearata primers and probes, and internal standard primers and probes (the fluorescent probe is labeled with the reporter fluorescent group HEX at the 5' end and with the non-luminescent quencher group labeled 3'BHQ1 at the 3' end).

[0238] (1) Select 10 positive clinical samples of Mycoplasma genitalium and Mycoplasma penetratingis (tested with tube 1), 10 positive clinical samples of Mycoplasma fermentans and Mycoplasma piriformis (tested with tube 2), and 10 negative clinical samples (either tube 1 or tube 2) and rinse them with 1 mL of physiological saline, mix them well and set aside.

[0239] (2) Take 200 μL of the sample to be tested, negative control and positive control, and extract nucleic acid from the sample to be tested using the magnetic bead nucleic acid extraction reagent of Zhengzhou Antu Bioengineering Co., Ltd., and set aside;

[0240] (3) Take several PCR reaction tubes, add 30 μL of PCR-MIX mixture, and then add 20 μL each of the extracted test sample and negative / positive quality control nucleic acid product. Centrifuge for 10 seconds.

[0241] (4) Place the PCR reaction tube into the sample slot of the amplification instrument and set the names of the samples to be tested in the corresponding order;

[0242] (5) Fluorescence detection channel selection: Select FAM channel, HEX channel, ROX channel and CY5 channel for detection; set the reference fluorescence to none.

[0243] The test results are shown in Table 10.

[0244] Table 10

[0245]

[0246]

[0247] It is evident that the internal standard can be reliably detected in both negative and positive samples.

[0248] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A primer-probe set, including at least one of primer-probe set 1, primer-probe set 2, primer-probe set 3, and primer-probe set 4; The primer-probe set 1 includes primer 1, primer 2, and probe 1; The primer-probe set 2 includes primer 3, primer 4 and probe 2; The primer-probe set 3 includes primer 5, primer 6 and probe 3; The primer-probe set 4 includes primer 7, primer 8 and probe 4; The nucleotide sequence of primer 1 is shown in SEQ ID NO: 1; The nucleotide sequence of primer 2 is shown in SEQ ID NO: 2; The nucleotide sequence of probe 1 is shown in SEQ ID NO: 9; The nucleotide sequence of primer 3 is shown in SEQ ID NO: 3; The nucleotide sequence of primer 4 is shown in SEQ ID NO: 4; The nucleotide sequence of probe 2 is shown in SEQ ID NO: 10; The nucleotide sequence of primer 5 is shown in SEQ ID NO: 5; The nucleotide sequence of primer 6 is shown in SEQ ID NO: 6; The nucleotide sequence of probe 3 is shown in SEQ ID NO: 11; The nucleotide sequence of primer 7 is shown in SEQ ID NO: 7; The nucleotide sequence of primer 8 is shown in SEQ ID NO: 8; The nucleotide sequence of probe 4 is shown in SEQ ID NO:

12.

2. The primer-probe set as described in claim 1, characterized in that, include: The probes 1, 2, 3, and 4 are independently connected to a fluorescent group and a quenching group, respectively. The fluorescent groups include: FAM, HEX, ROX, VIC, Cy5 or CY5.5; the quenching groups include BHQ1 or BHQ2.

3. The application of the primer-probe set as described in claim 1 or 2 in any of the following: (B1) Detection of at least one of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis for non-diagnostic purposes; (B2) Prepare reagents or kits for detecting at least one of Mycoplasma genitalium, Mycoplasma penetratingum, Mycoplasma fermentans, and Mycoplasma pyriformis.

4. A reagent, characterized in that, Includes the primer-probe set as described in claim 1 or 2.

5. The reagent as described in claim 4, characterized in that, It also includes DNA polymerase, dNTPs, PCR amplification enhancers, and enzyme activators; The PCR amplification enhancer includes at least one of DMSO, Tween 20, and glycerol.

6. A reagent kit, characterized in that, include: (C1) The primer-probe set as described in claim 1 or 2; or (C2) The reagent as described in claim 4 or 5.

7. The kit according to claim 6, characterized in that, This includes PCR reaction solution, positive control, and negative control. The PCR reaction solution includes the primer and probe set as described in claim 1 or 2.

8. A detection method for non-diagnostic purposes, characterized in that, Based on any of the following tests: (D1) The primer-probe set as described in claim 1 or 2; (D2) The reagent as described in claim 4 or 5; (D3) The kit as described in claim 6 or 7; The detection method is used to detect at least one of Mycoplasma genitalium, Mycoplasma penetratingis, Mycoplasma fermentans, and Mycoplasma pyriformis.

Images