Application of TaMIP1 protein and its encoding gene in regulating plant drought resistance

By editing the TaMIP1 gene in wheat and regulating its protein content or activity, the problem of regulating plant drought resistance has been solved, and the survival ability of wheat under drought conditions has been improved.

CN119177250BActive Publication Date: 2026-07-17INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2024-09-29
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate plant drought resistance, resulting in wheat growth and development being affected by drought stress and yield reduction.

Method used

By regulating the content or activity of TaMIP1 protein in wheat, the TaMIP1 gene was edited using the CRISPR/Cas9 system to reduce its expression level or activity in plants, thereby preparing and cultivating plants with reduced drought resistance.

Benefits of technology

It significantly reduces the drought resistance of plants and improves the survival rate and growth performance of wheat under drought conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005066887570000011
    Figure HDA0005066887570000011
  • Figure HDA0005066887570000021
    Figure HDA0005066887570000021
Patent Text Reader

Abstract

This invention discloses the application of the TaMIP1 protein and its encoding gene in regulating plant drought resistance. The TaMIP1 protein disclosed in this invention is as follows: A1) a protein with the amino acid sequence of SEQ ID No. 2, SEQ ID No. 5, or SEQ ID No. 8; A2) a protein with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2, SEQ ID No. 5, or SEQ ID No. 8; A3) a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2). Experiments have demonstrated that the invented TaMIP1 protein and its encoding gene can regulate plant drought resistance and have great potential for production application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically the application of the TaMIP1 protein and its encoding gene in regulating plant drought resistance. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of my country's three major grain crops, and wheat production is crucial for ensuring my country's food security. In recent years, due to climate change and frequent extreme weather events, abiotic stresses such as drought have severely affected wheat growth and development, directly leading to reduced yields. Therefore, identifying genes related to wheat drought resistance is an important means to accurately select target traits and improve breeding efficiency, and can provide a theoretical basis for breeding drought-resistant varieties. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to regulate the drought resistance of plants.

[0004] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the content or activity of said proteins:

[0005] D1) Regulates plant drought resistance;

[0006] D2) Preparation of products that regulate plant drought resistance;

[0007] D3) Cultivating drought-resistant modified plants;

[0008] D4) Preparation and cultivation of drought-resistant modified plant products;

[0009] The protein is derived from wheat and is named TaMIP1, which is referred to as A1), A2), or A3).

[0010] A1) A protein whose amino acid sequence is SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8;

[0011] A2) Proteins that have the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8 in the sequence listing;

[0012] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The TaMIP1 protein in A2) above refers to a protein that shares 75% or more amino acid sequence identity with and has the same function as the proteins shown in SEQ ID No. 2, SEQ ID No. 5, or SEQ ID No. 8. Identity refers to the similarity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained. The phrase "having 75% or more of the sameness" means having 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.

[0014] The TaMIP1 protein mentioned in A2 above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0015] The gene encoding the TaMIP1 protein in A2) above can be obtained by deleting one or more amino acid residues from the DNA sequence shown in positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag coding sequence to its 5′ and / or 3′ ends. Specifically, the DNA molecules shown in positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, and positions 173-1504 of SEQ ID No. 7 encode the TaMIP1 proteins shown in SEQ ID No. 2, SEQ ID No. 5, and SEQ ID No. 8, respectively.

[0016] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0017] In the above applications, the substance may be any one of B1) to B9):

[0018] B1) Nucleic acid molecules encoding the TaMIP1 protein;

[0019] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0021] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0022] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0023] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0024] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0025] B8) Nucleic acid molecules that reduce the content or activity of TaMIP1 protein;

[0026] B9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues or transgenic plant organs containing the nucleic acid molecules described in B8).

[0027] In the above applications, the nucleic acid molecule described in B1) may be as follows: (b11) or (b12) or (b13) or (b14) or (b15) or (b16)

[0028] b11) The coding sequence is the cDNA or DNA molecule at positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing;

[0029] b12) cDNA or DNA molecules shown in positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing;

[0030] b13) The cDNA or DNA molecule shown in SEQ ID No. 1, SEQ ID No. 4 or SEQ ID No. 7 in the sequence listing;

[0031] b14) The DNA molecule shown in SEQ ID No. 3, SEQ ID No. 6 or SEQ ID No. 9 in the sequence listing;

[0032] DNA molecules that have 75% or more identity with the nucleotide sequence defined by b15) and b11) or b12) or b13) or b14) and encode the TaMIP1 protein;

[0033] b16) hybridizes under strict conditions to a nucleotide sequence defined by b11) or b12) or b13) or b14) or b15) and is a DNA molecule encoding the TaMIP1 protein.

[0034] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0035] Those skilled in the art can readily mutate the nucleotide sequence encoding the TaMIP1 protein of this invention using known methods, such as directed evolution and point mutation. Any artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence of the TaMIP1 protein isolated according to this invention, provided they encode and function the TaMIP1 protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0036] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the protein of SEQ ID No. 2, SEQ ID No. 5, or SEQ ID No. 8 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0037] In the above applications, the stringent conditions may be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS.

[0038] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0039] In the above application, the expression cassette (TaMIP1 gene expression cassette) containing a nucleic acid molecule encoding the TaMIP1 protein described in B2) refers to DNA capable of expressing the TaMIP1 protein in a host cell. This DNA may include not only a promoter to initiate TaMIP1 gene transcription but also a terminator to terminate TaMIP1 gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0040] Recombinant vectors containing the TaMIP1 gene expression cassette can be constructed using existing expression vectors.

[0041] B8) The nucleic acid molecule that reduces TaMIP1 content may be an sgRNA that targets the gene encoding TaMIP1.

[0042] B9) The recombinant vector may be a recombinant vector prepared using the Crisper / Cas9 system capable of editing the TaMIP1 gene. The recombinant vector may express sgRNA targeting the nucleic acid molecule described in B1). The target sequence of the sgRNA may be positions 230-252 and / or 412-434 of SEQ ID No. 3 in the sequence listing (i.e., positions 219-241 and / or 404-426 of SEQ ID No. 6, and positions 237-259 and / or 422-444 of SEQ ID No. 9).

[0043] In the above applications, the microorganisms may be yeast, bacteria, algae, or fungi. Among them, bacteria may be Agrobacterium.

[0044] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0045] In the above applications, the substance that regulates the content or activity of TaMIP1 protein can be a substance that reduces the content or activity of TaMIP1 protein; the substance that regulates plant drought resistance can be a substance that reduces plant drought resistance; and the substance that cultivates drought-resistant plants can be a substance that cultivates plants with reduced drought resistance.

[0046] The present invention also provides any of the following methods:

[0047] X1) Methods for reducing plant drought resistance include: reducing the content or activity of TaMIP1 protein in the recipient plant, or knocking out the gene encoding TaMIP1 protein in the recipient plant, or reducing the expression level of the gene encoding TaMIP1 protein in the recipient plant, to obtain a target plant with reduced drought resistance compared to the recipient plant, thereby reducing plant drought resistance.

[0048] X2) Methods for cultivating plants with reduced drought resistance include: reducing the content or activity of TaMIP1 protein in the recipient plant, or knocking out the gene encoding TaMIP1 protein in the recipient plant, or reducing the expression level of the gene encoding TaMIP1 protein in the recipient plant, to obtain a target plant with reduced drought resistance compared to the recipient plant.

[0049] Methods X1) and X2) can be implemented by editing the gene encoding the TaMIP1 protein. The encoding gene can be the nucleic acid molecule described in B1).

[0050] Gene editing of the encoded gene using the CRISPR / Cas9 method can be achieved by introducing a recombinant vector encoding Cas9 and capable of transcribing sgRNA that targets the encoded gene into the recipient plant and then screening to obtain the target plant in which the encoded gene has been edited.

[0051] In one embodiment of the present invention, the target plant is mip1-1 , mip1-2 and mip1-6 :

[0052] mip1-1 The genome contains deletions of positions 247-417 of SEQ ID No. 3, positions 235-409 of SEQ ID No. 6, and positions 253-427 of SEQ ID No. 9.

[0053] mip1-2 The genome contains a deletion of positions 247-500 of SEQ ID No. 3 and an insertion of CCGCGGGCCCGCGGATCTATGTGTATGTGCGTGTTTTAACCTTTTCACAG; an insertion of an A between positions 235-236 of SEQ ID No. 6; and a deletion of positions 253-428 of SEQ ID No. 9.

[0054] mip1-6The genome has an A inserted between positions 246-247 of SEQ ID No. 3, a G inserted between positions 235-236 of SEQ ID No. 6, and positions 210-254 and 428-431 of SEQ ID No. 9 deleted.

[0055] The recombinant expression vector can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition)).

[0056] The target plant is understood to include not only first-generation plants containing the TaMIP1 protein or its encoding gene that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The target plant includes seeds, callus tissue, intact plants, and cells.

[0057] TaMIP1 protein or substances that regulate the content or activity of TaMIP1 protein are also within the scope of protection of this invention.

[0058] In this invention, the plant may be M1, M2, or M3.

[0059] M1) Monocotyledons or dicotyledons;

[0060] M2) Gramineae plants;

[0061] M3) wheat.

[0062] Experiments have shown that knocking out [certain substances] in plants TaMIP1 Genes can reduce the drought resistance of plants. The TaMIP1 protein and its encoding gene of this invention can regulate the drought resistance of plants and have great potential for production application.

[0063] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0064] Figure 1 This refers to sequence changes in gene-edited strains.

[0065] Figure 2 The results are for drought resistance testing. (a) WT and [other parameters] under drought stress during the seedling stage. mip1 Phenotype of the mutant. (b) Soil moisture content during drought treatment and rewatering. (c) Survival results. Detailed Implementation

[0066] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are all commercially available. All quantitative experiments in the following examples were performed in at least three replicates, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0067] Fielder wheat: A gift from Professor Xin Mingming's laboratory at China Agricultural University. A hexaploid common wheat, bred in the United States in 1974, commonly used for Agrobacterium-mediated transformation and gene editing receptors. Reference: Sato K, Abe F, Mascher M, Haberer G, Gundlach H, Spannagl M, Shirasawa K, Isobe S. Chromosome-scale genome assembly of the transformation-amenable common wheatcultivar 'Fielder'. DNA Res. 2021 Jun 25;28(3):dsab008. doi: 10.1093 / dnares / dsab008. PMID: 34254113; PMCID: PMC8320877.

[0068] Agrobacterium tumefaciens EHA105: Reference: Torisky RS, Kovacs L, Avdiushko S, Newman JD, Hunt AG, Collins GB. Development of a binary vector system for plant transformation based on the supervirulent Agrobacterium tumefaciens strain Chry5. Plant Cell Reports, (1997)17:102-108.; The public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0069] Example 1 TaMIP1 Genes can regulate the drought resistance of wheat.

[0070] This embodiment discovered a gene in wheat (Chinese spring variety) that can regulate drought resistance; its name is... TaMIP1 The three TaMIP1 homologs are TaMIP1-2A, TaMIP1-2B, and TaMIP1-2D.

[0071] In the Chinese New Year, TaMIP1 The full-length cDNA of the -2A gene is shown in SEQ ID No. 1 in the sequence listing. Nucleotides 169-1476 are open reading frames that encode the TaMIP1-2A protein shown in SEQ ID No. 2. Its genomic sequence is shown in SEQ ID No. 3. TaMIP1 The full-length cDNA of the -2B gene is shown in SEQ ID No. 4 in the sequence listing. Nucleotides 155-1489 are open reading frames that encode the TaMIP1-2B protein shown in SEQ ID No. 5. Its genomic sequence is shown in SEQ ID No. 6. TaMIP1 The full-length cDNA of the -2D gene is shown in SEQ ID No. 7 in the sequence listing. Nucleotides 173-1504 are open reading frames that encode the TaMIP1-2D protein shown in SEQ ID No. 8, whose genomic sequence is shown in SEQ ID No. 9.

[0072] I. Preparation of Genetically Modified Wheat

[0073] Using wheat Fielder as the receptor, the TaMIP1 gene was knocked out. The cDNA, genomic sequence, and encoded proteins of TaMIP1-2A, TaMIP1-2B, and TaMIP1-2D in Fielder were identical to those of Chinese Spring wheat.

[0074] 1) Construction of recombinant gene editing vectors

[0075] 1. Utilize online websites ( http: / / www.e-crisp.org / E-CRISP / ) Predicting TaMIP1 Editing site of the gene point

[0076] 2. According to TaMIP1 Genome Search TaMIP1 -2A、 TaMIP1 -2B TaMIP1 -2D conservative area design TaMIP1The gene target sites were identified as positions 230-252 and 412-434 of SEQ ID No. 3, positions 219-241 and 404-426 of SEQ ID No. 6, and positions 237-259 and 422-444 of SEQ ID No. 9. Four primers were then designed according to the vector instructions: upstream primer F (5'-aataatggtctcAGGCgTGTCTCACACGGCATGTGG-3'), F0 (5'-gTGTCTCACACGGCATGTGG-3'), and F0 (5'-gTGTCTCACACGGCATGTGG-3'). gttttagagctagaaatagc -3') and downstream primer R(5'-ATTATT) GGTCTCTAAAC GGGAACAACAGCTCCGTAA-3'), R0 (5'-GGGAACAACAGCTCCGTAACGCTTCTTGGTGCC-3').

[0077] 3. Dissolve and mix the four primers ( TaMIP1- The target sequence (MT1T2 F / F0 / R0 / R) was ligated using T4 DNALigase and the restriction enzyme BasI (both products of NEB) in a digestion-ligation-as-a-time manner. The Golden Gate vector construction method was employed, using pCBC-MT1T2 as the intermediate vector and pBUE414 as the final vector to construct a vector for editing. TaMIP1 Gene recombination vectors, i.e. TaMIP1 The gene-edited wheat vector was able to simultaneously transcribe two sgRNAs targeting SEQ ID No. 3, 6, and 9.

[0078] 4. TaMIP1 After the gene-editing wheat vector was introduced into Agrobacterium tumefaciens EHA105, wheat Fielder was transformed using Agrobacterium-mediated genetic transformation to obtain gene-edited plants. Specific primers were then synthesized targeting the editing site to amplify the target gene, followed by sequencing to identify the editing status. TaMIP1 Gene-edited genetically modified wheat mip1-1, mip1-2 and mip1-6 .

[0079] Use a pair TaMIP1 The -2A genome-specific primers F (5′-CCACTACCCCTCATCTTAGCTTC-3′) and R (5′-ATGGGTCATTCAGCATGCTT-3′), a pair TaMIP1 -2B genome-specific primers F (5′-CCAGATCGGCCAAGAAAC-3′) and R (5′-AGCAGCAGCTGTTGTCCAG-3′), a pair TaMIP1-2D genome-specific primers F (5′-CATCTCGCTCCTCTCTGCC-3′) and R (5′-CACCAGCAGCAGCATCAG-3′) were used for amplification, and sequencing showed three ( mip1-1 , mip1-2 and mip1-6 Sequence changes in gene-edited strains, such as Figure 1 As shown, the details are as follows:

[0080] mip1-1 : TaMIP1 -2A genome deletion of 171 nucleotides (i.e. deletion of positions 247-417 of SEQ ID No. 3); TaMIP1 -2B genome deletion of 175 nucleotides (i.e. deletion of positions 235-409 of SEQ ID No. 6); TaMIP1 -2D genome deletion of 175 nucleotides (i.e. deletion of positions 253-427 of SEQ ID No. 9).

[0081] mip1-2 : TaMIP1 -2A genome deletion of 254 nucleotides and insertion of 52 nucleotides (i.e. deletion of positions 247-500 of SEQ ID No.3 and insertion of CCGCGGGCCCGCGGATCTATGTGTATGTGCGTGTTTTAACCTTTTCACAG) results in a frameshift mutation and premature termination of translation; TaMIP1 -2B The insertion of one nucleotide into the genome (i.e., an A is inserted between positions 235 and 236 of SEQ ID No. 6) results in a frameshift mutation and premature termination of translation; [[ID= -2D genome deletion of 176 nucleotides (i.e. deletion of positions 253-428 of SEQ ID No. 9).

[0082] ​ : ​ -2A genome insertion of 1 nucleotide (i.e., an A inserted between positions 246-247 of SEQ ID No. 3) results in a frameshift mutation and premature termination of translation; ​ -2B genome insertion of 1 nucleotide (i.e., insertion of a G between positions 235-236 of SEQ ID No. 6) results in a frameshift mutation and premature termination of translation; ​ -2D genome deletion of two segments totaling 49 nucleotides (i.e. deletion of positions 210-254 and 428-431 of SEQ ID No. 9) leads to frameshift mutation and premature termination of translation.

[0083] III. Drought Resistance Assessment

[0084] Wheat samples to be tested: Fielder wheat (negative control, WT), a transgenic recipient variety, and gene-edited lines. ​ , ​ and ​ The experiment was divided into two groups: a drought treatment group and a control group.

[0085] 1. Treat the wheat seeds to be tested with 1% hydrogen peroxide for 1 day to break dormancy.

[0086] 2. Select seedlings with consistent germination and growth and plant them in the same plastic box (56 cm × 38 cm × 11 cm). Sow 30 seeds for each line. Bury the plastic box in the outdoor soil environment and keep the height of the plastic box at the same level as the ground.

[0087] 3. Seedlings that have grown to the three-leaf stage were subjected to drought treatment (i.e., watering was stopped). After 18 days of drought treatment (i.e., when there was a significant difference in phenotype between wild-type and transgenic wheat plants), they were re-watered. The survival rate was counted 3 days after re-watering, and the soil moisture content was measured at each stage. Three independent biological replicates were set up. The seedlings that had not undergone drought treatment (normal watering) were used as a control.

[0088] The seedling survival rate is calculated using the following formula: Survival rate (%) = Number of surviving plants / Number of planted plants (30) × 100%.

[0089] The results are as follows ​ As shown, compared with the wild type, the leaves of the gene-edited lines exhibited significant wilting under drought stress. ​ (a) The survival rate of the wild type after rehydration was significantly higher than that of the wild type. ​ strain ( ​ (b, c) indicates ​ It can regulate the drought resistance of wheat seedlings.

[0090] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Any of the following applications of substances that reduce protein content: D1) Reduces wheat's drought resistance; D2) Preparation of products that reduce wheat drought resistance; D3) Breed wheat with reduced drought resistance; The protein is either A1 or A2 as follows: A1) The amino acid sequence of the protein is SEQ ID No. 2, SEQ ID No. 5 and SEQ ID No. 8; A2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1); The substance that reduces protein content is either B1 or B2 below. B1) Nucleic acid molecules that reduce the content of the aforementioned protein; B2) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in B1).

2. Any of the following methods: X1) Methods to reduce wheat drought resistance include: By reducing the content of the protein described in claim 1 in the recipient wheat, or knocking out the gene encoding the protein described in claim 1 in the recipient wheat, or reducing the expression level of the gene encoding the protein described in claim 1 in the recipient wheat, a target wheat with reduced drought resistance compared to the recipient wheat is obtained, thereby reducing the drought resistance of wheat. X2) A method for cultivating drought-resistant wheat, comprising: reducing the content of the protein described in claim 1 in the recipient wheat, or knocking out the coding gene of the protein described in claim 1 in the recipient wheat, or reducing the expression level of the coding gene of the protein described in claim 1 in the recipient wheat, to obtain target wheat with reduced drought resistance compared to the recipient wheat.

3. The method according to claim 2, characterized in that: Methods X1) and X2) are implemented by editing the gene encoding the protein described in claim 1.