Application of plant transcription factor AP2 / ERF family protein and coding gene thereof in regulation and control of aging and / or active oxygen level of Chinese rose petals

Abstract

The invention discloses application of a plant transcription factor AP2 / ERF family protein and a coding gene thereof in regulation and control of the aging and / or active oxygen level of Chinese rose petals. The plant transcription factor AP2 / ERF family protein is RhERF4-2, and the amino acid sequence of the plant transcription factor AP2 / ERF family protein is shown as SEQ ID NO.3. The invention further discloses a preparation method of the plant transcription factor AP2 / ERF family protein. The RhERF4-2 gene is cloned from Chinese rose petals, and it is verified that silencing of the RhERF4-2 gene can reduce the speed of petals from the level 5 to losing the ornamental value. In petals silenced by the RhERF4-2, the expression of the senescence-related gene RhSAG12 is remarkably reduced. The invention discloses the effect of RhERF4-2 in regulation and control of petal reactive oxygen species (ROS) and senescence, provides a new thought and technical means for regulation and control of plant flower senescence, especially post-harvest preservation of fresh Chinese rose flowers, opens up a new flower regulation and control research field, and has great academic value and important production and application prospects.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to the application of plant transcription factor AP2 / ERF family proteins and encoding genes thereof in regulating rose petal senescence and / or active oxygen levels. Background Art

[0002] Rose is an important ornamental crop in the world, with extremely high ornamental and economic value, and is widely used in cut flowers, potted flowers, courtyards and landscaping. Cut roses suffer huge losses during long-distance storage and transportation, and premature aging of petals is the main reason for the serious loss of cut roses. Cultivating new varieties that are resistant to storage and transportation and developing efficient post-harvest preservation technologies are effective ways to break through the industry bottleneck of "high post-harvest losses of cut roses", and the discovery of key genes for petal aging and the analysis of their biological mechanisms are the theoretical basis for variety improvement and technological innovation. Ethylene is an important hormone that promotes petal aging. By analyzing the gene functions that respond to ethylene treatment, theoretical support is provided for analyzing the specific regulatory mechanism of ethylene on rose petal aging. Summary of the invention

[0003] Purpose of the invention: The first purpose of the present invention is to provide an application of a plant transcription factor AP2 / ERF family protein in the regulation of rose petal senescence and / or reactive oxygen levels. The second purpose of the present invention is to provide an application of the RhERF4-2 gene encoding the above-mentioned AP2 / ERF family protein in the regulation of rose petal senescence and / or reactive oxygen levels. The third purpose of the present invention is to provide an application of a silencing vector of the RhERF4-2 gene and a RhERF4-2 gene silencing strain in delaying the senescence of rose petals. The fourth purpose of the present invention is to provide a rose RhERF4-2 gene downregulator. The fifth purpose of the present invention is to provide a method for delaying the senescence of rose petals or prolonging the flowering period.

[0004] Technical solution: The plant transcription factor AP2 / ERF family protein of the present invention is used in regulating rose petal senescence and / or reactive oxygen levels. The plant transcription factor AP2 / ERF family protein is RhERF4-2, and its amino acid sequence is shown in SEQ ID NO.3.

[0005] The present invention provides an application of the RhERF4-2 gene encoding the AP2 / ERF family protein in regulating rose petal senescence and / or reactive oxygen levels, wherein the nucleotide sequence of the RhERF4-2 gene is shown in SEQ ID NO.1.

[0006] Furthermore, the rose variety is 'Samantha'.

[0007] The silencing vector of the RhERF4-2 gene or its specific fragment and the silencing strain of the RhERF4-2 gene or its specific fragment of the present invention are used in delaying the senescence of rose petals. The RhERF4-2 gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the specific fragment of the RhERF4-2 gene is shown in SEQ ID NO.12.

[0008] Furthermore, the silencing vector is obtained by constructing the entire ORF of the RhERF4-2 gene or its specific fragment sequence into the vector pTRV2.

[0009] Furthermore, the silenced strain is obtained by introducing a silencing vector of the RhERF4-2 gene into Agrobacterium.

[0010] Furthermore, the Agrobacterium is GV3101.

[0011] The method for delaying rose petal senescence or extending the flowering period of the present invention comprises inhibiting or down-regulating the expression or activity of rose RhERF4-2 protein to extend the opening time of rose flowers, and the amino acid sequence of the RhERF4-2 protein is shown in SEQ ID NO.3.

[0012] Furthermore, the down-regulating expression or activity of the rose RhERF4-2 protein includes: knocking out or silencing the RhERF4-2 gene in the rose genome; or transferring a down-regulator that down-regulates RhERF4-2 gene transcription, polypeptide expression or polypeptide activity into the rose, or hybridizing a rose variety with a RhERF4-2 gene deletion with an ordinary rose variety, and the RhERF4-2 gene sequence is shown in SEQ ID NO.1 or 2.

[0013] Furthermore, knocking out or silencing the RhERF4-2 gene in the rose genome is to introduce a specific fragment of the RhERF4-2 gene into a silencing vector, and the nucleotide sequence of the specific fragment of the RhERF4-2 gene is shown in SEQ ID NO.12.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention cloned the RhERF4-2 gene from rose petals and verified that silencing the RhERF4-2 gene can slow down the speed at which petals lose their ornamental value from level 5. In petals where RhERF4-2 is silenced, the expression of the aging-related gene RhSAG12 is significantly downregulated. The present invention reveals the role of RhERF4-2 in regulating ROS and aging of petals, provides new ideas and technical means for regulating the aging of plant flowers, especially the post-harvest preservation of rose fresh cut flowers, opens up a new field of flower regulation research, and has great academic value and important production application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It shows that there are two ERF4 homologous proteins in rose. The phylogenetic tree was drawn using MEGA.

[0016] Figure 2 The effect of ethylene on the transcription level of RhERF4-2 is shown. Rose seedlings at developmental stage 2 were sampled 24 hours after ethylene (10 μL / L) treatment, and the control group was treated with air. RhUBI2 was used as an internal reference, with 6 biological replicates. The data in the figure are mean ± SD, and the two-tailed Student's t test was used. ns represents no significant difference, and *** represents p < 0.001.

[0017] Figure 3 The results show that silencing RhERF4-2 affects the senescence process of petals. (A) Observation of senescence phenotypes of RhERF4-2-silenced tissue culture seedlings and TRV control group. From the time when the flowers are fully opened to the time when the petals are senescent, photos are taken and recorded once a day. Scale bar: 5 cm. (B) Detection of RhERF4-2 expression. (C) Detection of RhSAG12 expression. (D) Statistics of senescence days of RhERF4-2-silenced tissue culture seedlings and TRV control group. RhUBI2 was used as an internal reference, and 6 biological replicates were performed. The data in the figure are mean ± SD. Two-tailed Student's t test was used. * represents p < 0.05, ** represents p < 0.01, and **** represents p < 0.0001.

[0018] Figure 4 It shows that RhERF4-2 promotes ROS accumulation. (Left) DAB staining of rose petals after RhERF4-2 gene silencing, scale is 1 cm. (Right) Quantitative results of DAB staining levels of rose petals after RhERF4-2 gene silencing. Petals at developmental stage 5 were taken, with 6 biological replicates in each group. The data in the figure are mean ± SD, and the two-tailed Student's t test was used. *** represents p < 0.001. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0020] Virus-induced gene silencing (VIGS) is a post-transcriptional gene silencing technology. As an effective reverse genetics technology, it has been widely used in the study of plant genetic engineering. Among them, the more commonly used viral vector is tobacco rattle virus (TRV). TRV is jointly functioned by two vectors pTRV1 and pTRV2. The vectors pTRV-1 and pTRV-2 of the present invention were donated by Professor Liu Yule of Tsinghua University. In the present invention, the combination of the control pTRV-1 and pTRV-2 is named TRV, and the combination of pTRV-1 and pTRV-2-RhTIP1;1 is named TRV-RhERF4-2.

[0021] Example 1 Gene cloning and sequence analysis

[0022] Total RNA was extracted from the petals of R. hybrida 'Samantha' using the hot borate method (Ma, N., Tan, H., Liu, X., Xue, J., Li, Y., & Gao, J. (2006). Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha. Journal of experimental botany, 57 (11), 2763–2773). cDNA was obtained from 1 μg of total RNA using HiScript III reverse transcriptase (Vazyme). RhERF4-2-ORF (SEQ ID NO. 2) was amplified from the cDNA of 'Samantha' petals using primers RhERF4-2-ORF-F (SEQ ID NO. 4) and RhERF4-2-ORF-R (SEQ ID NO. 5). PCR conditions are shown in Tables 1 and 2.

[0023] Table 1 High-fidelity enzyme amplification system

[0024]

[0025]

[0026] Table 2 High-fidelity enzyme reaction procedures

[0027]

[0028] The cloned fragments were recovered by gel running and then connected to the ZT4 vector (ZC205, Zhuangmeng Biotechnology Co., Ltd.) and transformed into Escherichia coli DH5α (TSC-C01, Qingke Biotechnology Co., Ltd.) by heat shock method. After overnight culture, single clones were picked and shaken for testing.

[0029] The sequencing results showed that the cDNA sequence of the rose RhERF4-2 gene was 1191 bp, and the corresponding gene number in the R. chinensis'OldBlush' database (https: / / lipm-browsers.toulouse.inra.fr / pub / RchiOBHm-V2 / ) was RchiOBHm_Chr5g0032721 (full-length gene, SEQ ID NO.1). The ORF length of RchiOBHm_Chr5g0032721 was 753 bp (SEQ ID NO.2), which can encode a protein containing 250 amino acids (SEQ ID NO.3).

[0030] Example 2 Ethylene induction analysis

[0031] Rose 'Samantha' tissue culture seedlings were cultured on MS medium containing 1.0 mg / L 6-benzylaminopurine (6-BA), 0.05 mg / L α-naphthylacetic acid (NAA) and 3 mg / L gibberellin (GA3) at 22±1°C and long day (16 h light / 8 h dark) until they were four weeks old. The four-week-old seedlings were transferred to 1 / 2 MS medium containing 0.1 mg / L NAA to take root. Next, the rooted seedlings were transplanted into a culture soil with a 1:1 ratio of vermiculite to peat, and continued to be cultured at 22±1°C, 60% relative humidity, and long day (16 h light / 8 h dark) until flowering.

[0032] Flower opening stages were defined according to a previous publication (Ma, N., Cai, L., Lu, W., Tan, H., & Gao, J. (2005). Exogenous ethylene influences flower opening of cut roses (Rosa hybrida) by regulating the genes encoding ethylene biosynthesis enzymes. Science in China. Series C, Life sciences, 48(5), 434–444. https: / / doi.org / 10.1360 / 062004-37), Stage 1, sepals of flowers split open, revealing petals; Stage 2, sepals of flowers fully open, petals not open; Stage 3, flowers are in the early stage of opening, cup-shaped; Stage 4, flowers, petals have completed expansion, close to opening to the maximum flower diameter, but the center of the flower is not exposed; Stage 5, flowers reveal the center of the flower; Stage 6, flowers are aging and wilting, and petal samples at different stages are collected from the middle petals of flowers (Wu, L., Ma, N., Jia, Y., Zhang, Y., Feng, M., Jiang, C. Z., Ma, C., & Gao, J. (2017). An Ethylene-Induced Regulatory Module Delays Flower Senescence by Regulating Cytokinin Content. Plant physiology, 173(1), 853–862. https: / / doi.org / 10.1104 / pp.16.01064). The 2nd grade cut roses were treated with ethylene. The roses in the vase were treated with 10 μL / L ethylene in a sealed glass box for 24 hours. The control group was treated with air. Six biological replicates were set for each treatment.

[0033] Fluorescence quantitative RT-PCR (qRT-PCR) was used to react in the Applied Biosystems StepOnePlusTM real-time quantitative PCR system using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) reagent (Vazyme). RhUBI2 was used as an internal reference. The PCR conditions are shown in Tables 3 and 4. The expression of related genes was calculated using the 2-ΔΔCT method. Among them, the quantitative primer RhUBI2-qRT-F sequence is SEQ ID NO.6, and the RhUBI2-qRT-R sequence is SEQ ID NO.7; the RhERF4-2-qRT-F sequence is SEQ ID NO.8, and the RhERF4-2-qRT-R sequence is SEQ ID NO.9; the RhSAG12-qRT-F sequence is SEQID NO.10, and the RhSAG12-qRT-R sequence is SEQ ID NO.11.

[0034] Table 3 Real-time fluorescence quantitative PCR reaction system

[0035]

[0036] Table 4 Real-time fluorescence quantitative PCR reaction program

[0037]

[0038] The expression of RhERF4-2 in rose petals after treatment was detected, and it was found that ethylene treatment significantly increased the transcription level of RhERF4-2 compared with the control group ( Figure 2 ). Therefore, it is speculated that RhERF4-2 may be involved in ethylene-related petal senescence.

[0039] Example 3

[0040] The experimental method was based on the previous study of the inventors of the present application (Tian, ​​J., Pei, H., Zhang, S., Chen, J., Chen, W., Yang, R., Meng, Y., You, J., Gao, J., & Ma, N. (2014). TRV-GFP: a modified Tobaccorattle virus vector for efficient and visualizable analysis of gene function. Journal of experimental botany, 65(1), 311–322.). Specifically, a pTRV2 vector containing EcoRI and BamH I restriction sites (donated by Professor Liu Yule of Tsinghua University) was used to insert a 363 bp RhERF4-2 specific fragment (162 bp in the ORF region and 201 bp in the 3' untranslated region, SEQ ID NO.12: ctggacaaaagcgtcaaggcagccgcctctccgtccggcggttccctctccggcctcagcgactcggactcctccaccgtcgtggatttcg ctcactcccccgccaagaaaggaccgctcgatctcgacctcaacctcccccctccaccggagaaagcctgaatccgccgccgccggaaactctgtcc gcctccacatttttccttccgttctttaattagaaaagcaaaaaaagccaacctcttagagcgagaaaggcaaagctcaaagctgacatgtaatcat gagttttgcattagcctatgttgtttattaactgcagctttgtatatagacaaaactagaaaacccaaaaccgcagc) construct pTRV2-RhERF4-2 vector.The vectors carrying pTRV-1, pTRV-2, and pTRV2-RhERF4-2 were transformed into the Agrobacterium tumefaciens strain GV3101, respectively, and grown in Luria-Bertani (LB) medium supplemented with 50 μg / mL kanamycin and 50 μg / mL rifampicin, followed by shaking in liquid culture medium at 28°C, 200 rpm for 14 h. The Agrobacterium cells were collected by centrifugation at 4000 g and resuspended in infiltration buffer (10 mM 2-(N-Morpholino)ethanesulfonic acid (MES), 200 mM acetosyringone and 10 mM magnesium chloride (MgCl2), pH 5.6, and the final concentration of the bacteria was OD. 600 =0.8~1.0. The Agrobacterium bacteria carrying the pTRV1 vector and the pTRV2-RhERF4-2 vector were mixed in a ratio of 1:1 (v / v) as the experimental group (the control group TRV was a mixed bacteria solution of Agrobacterium carrying the pTRV1 and pTRV2 vectors in a ratio of 1:1 (v / v)), and cultured at room temperature in the dark for 3-4 hours, and then the rose seedlings were immersed in the infiltration buffer containing the above-mentioned Agrobacterium bacteria solution, placed in a -0.8MPa vacuum for transformation, until the bacteria solution was sucked into the plant by a vacuum pump. Keep for 5 minutes, and then slowly intake air to ensure that the bacteria solution completely enters the plant. Rinse the test tube seedlings with deionized water, and then culture them in the dark at 8°C for 3 days. Transplant to culture soil and grow at 22±1°C, relative humidity of 60%, and long daylight (16h light / 8h dark). Culture for 40 days.

[0041] 1. Effect of RhERF4-2 on the senescence process of rose petals

[0042] Flower phenotypes of level 1 flowers were continuously monitored.

[0043] Fluorescence quantitative RT-PCR (qRT-PCR) was used to react in Applied Biosystems StepOnePlusTM real-time quantitative PCR system using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) reagent (Vazyme). PCR conditions were the same as those in Example 2. RhUBI2 was used as an internal reference. The primer sequences used were SEQ ID NO. 8 to 9. The expression of related genes was calculated using the 2-ΔΔCT method.

[0044] Compared with the TRV control, the expression of RhERF4-2 in the petals of RhERF4-2 silenced plants was reduced by 46.1%, indicating that RhERF4-2 silenced plants can be used for subsequent studies ( Figure 3B) The difference in flowering process between RhERF4-2 silenced plants and TRV control plants ranged from grade 5 to loss of ornamental value ( Figure 3 A), the growth period of control plants increased from 3.7±0.5 days to 4.8±1.2 days in RhERF4-2 silenced plants ( Figure 3 D). RhSAG12 expression in petals of level 5 RhERF4-2 silenced cells was reduced by 32.1% compared to the TRV control ( Figure 3 C) These results indicate that RhERF4-2 plays a significant positive regulatory role in petal senescence.

[0045] 2. Effect of RhERF4-2 on ROS in Rose Petals

[0046] Take DAB powder and dissolve it in water, adjust the pH to 3.8 with hydrochloric acid, and wrap the reagent with tin foil to prevent the reagent from being decomposed by light; take rose petals, wash the petals with deionized water, and wipe the moisture on the petals with paper; transfer the petals to DAB solution (1 mg / mL, pH3.8), vacuum pump to -0.8 MPa, maintain for 5 minutes, and release for 5 minutes; react in a dark incubator at 22°C for 8 hours; wash off excess DAB solution with clean water, transfer the petals to decolorization solution (acetic acid: glycerol: ethanol volume ratio of 1:1:3) and soak for decolorization for 3 days; use a scanner to record the DAB staining of the petals.

[0047] DAB staining was used to indicate the level of ROS (reactive oxygen species) in the petals, and Image J software was used to quantitatively analyze the staining intensity. Figure 4 As shown in the figure, the level of ROS in the petals of RhERF4-2 transiently silenced roses was significantly higher than that in the TRV control group, indicating that RhERF4-2 can promote the accumulation of ROS in rose petals.

[0048] In summary, RhERF4-2 is induced by ethylene and plays an important role in regulating the senescence process of petals by affecting the level of ROS in petals.

Claims

1. An application of a plant transcription factor AP2 / ERF family protein in regulating rose petal senescence and / or reactive oxygen levels, characterized in that: The plant transcription factor AP2 / ERF family protein is RhERF4-2, and its amino acid sequence is shown in SEQ ID NO.

3.

2. Use of the RhERF4-2 gene encoding the AP2 / ERF family protein of claim 1 in regulating rose petal senescence and / or reactive oxygen levels, characterized in that: The nucleotide sequence of the RhERF4-2 gene is shown in SEQ ID NO.

1.

3. The use according to claim 1 or 2, characterized in that: The rose variety is 'Samantha'.

4. Application of a silencing vector of the RhERF4-2 gene or its specific fragment, or a silencing strain of the RhERF4-2 gene or its specific fragment in delaying the senescence of rose petals, characterized in that: The RhERF4-2 gene sequence is shown as SEQ ID NO.1, and the nucleotide sequence of the specific fragment of the RhERF4-2 gene is shown as SEQ ID NO.

12.

5. The use according to claim 4, characterized in that: The silencing vector is obtained by constructing the entire ORF of the RhERF4-2 gene or its specific fragment sequence into the vector pTRV2.

6. The use according to claim 4, characterized in that: The silencing strain is obtained by introducing the silencing vector of the RhERF4-2 gene into Agrobacterium.

7. The use according to claim 5, characterized in that: The Agrobacterium is GV3101.

8. A method for delaying rose petal senescence or extending the flowering period, characterized in that: The method comprises inhibiting or down-regulating the expression or activity of rose RhERF4-2 protein to prolong the opening time of rose flowers, and the amino acid sequence of the RhERF4-2 protein is shown in SEQ ID NO.

3.

9. The method according to claim 8, characterized in that The down-regulating expression or activity of the rose RhERF4-2 protein includes: knocking out or silencing the RhERF4-2 gene in the rose genome; or transferring a down-regulator that down-regulates RhERF4-2 gene transcription, polypeptide expression or polypeptide activity into the rose, or hybridizing a rose variety with a RhERF4-2 gene deletion with an ordinary rose variety, and the RhERF4-2 gene sequence is shown in SEQ ID NO.1 or 2.

10. The method according to claim 9, characterized in that Knocking out or silencing the RhERF4-2 gene in the rose genome is to introduce a specific fragment of the RhERF4-2 gene into a silencing vector. The nucleotide sequence of the specific fragment of the RhERF4-2 gene is shown in SEQ ID NO.12.

Images