A reduced color carotenoid saccharomyces marxianus inm3118, its method of preparation and use in whole grain products

By screening and applying the Max Kluyveromyces INM3118 strain to ferment whole wheat flour, the bitterness problem caused by high colorant content in whole wheat products was solved, thus improving the taste and flavor of whole wheat products.

CN119193349BActive Publication Date: 2026-07-31ZHEJIANG INM FOOD CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHEJIANG INM FOOD CO LTD
Filing Date
2024-10-16
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

The existing technology lacks strains that can effectively degrade cronol during the production of whole wheat products, which makes it impossible to effectively solve the bitterness problem of whole wheat products. Furthermore, there is insufficient research on the application of existing yeast strains and their ability to reduce cronol.

Method used

The Kluyveromyces martensii strain INM3118 was used to reduce the coloritol content of whole wheat flour through fermentation. The screening method included isolating and screening Kluyveromyces martensii colonies that met specific morphologies from fermented milk curd samples, and then inoculating them into whole wheat products for fermentation at a temperature of 30℃ and an inoculation amount of 104-108 cfu/mL.

Benefits of technology

It significantly reduces the coloritol content in whole wheat products, improves product taste and flavor, and does not affect the overall product process and safety. It is suitable for whole wheat bread, toast, European bread and dinner rolls.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193349B_ABST
    Figure CN119193349B_ABST
Patent Text Reader

Abstract

This invention provides a Kluyveromyces marxianus strain INM3118 with reduced colorant content, its preparation method, and its application in whole wheat products. The strain is Kluyveromyces marxianus INM3118, which was deposited on August 13, 2024, at the Guangdong Provincial Microbial Culture Collection Center (accession number: GDMCC 65004), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province. Its advantages include: effectively reducing colorant content in fermented whole wheat dough, improving the taste of whole wheat products, and reducing bitterness.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a Kluyveromyces martensii INM3118 with reduced ascorbic acid content, its preparation method, and its application in whole grain products. Background Technology

[0002] Tryptophol is a chemical substance with the molecular formula C10H11NO, a molecular weight of 161.2004, and a density of 1.219 g / cm³. Current research on tryptophol mainly focuses on chemical and pharmaceutical applications, primarily because it is an important chemical and pharmaceutical intermediate. However, a 2016 study by Qing and Peterson et al. showed that tryptophol is closely related to the bitterness of whole wheat products. Tryptophol is mainly a metabolite of tryptophan, and its production is closely related to the fermentation of tryptophan by brewer's yeast. In fermented whole wheat products, the application of brewer's yeast is essential. Whole wheat flour contains 192-398 mg / 100g of tryptophan, thus producing a large amount of tryptophol during fermentation, which affects the flavor of whole wheat products.

[0003] Kluyveromyces marxianus, a eukaryotic microorganism with the highest growth rate, can grow at temperatures as high as 45–52°C. Its broad metabolic substrate range (including hexoses such as glucose, mannose, galactose, and lactose, and pentoses such as xylose and arabinose) makes it a good alternative to brewer's yeast for fermenting lignocellulose to produce ethanol. Kluyveromyces marxianus offers significant health benefits, enhancing the body's antibacterial, antiviral, and antioxidant capabilities, helping to prevent infection, delay aging, and protect the immune system. It can also lower cholesterol and blood sugar, improve immune function, reduce swelling and pain, improve endocrine and nutritional imbalances, and reduce harmful substances in the body.

[0004] Currently, research on the metabolism of cronols by *Kluyveromyces martensii* is limited. Patent CN202010857, "A Method for Producing Cretonols by a Saccharomyces cerevisiae Strain," discloses a method for producing cronols using a *Saccharomyces cerevisiae* strain, specifically fermenting *Saccharomyces cerevisiae* KMLY1-2. However, it does not involve the fermentation and reduction of cronols by *Kluyveromyces martensii*, thus differing from the application direction of this patent. Therefore, it is clear that the understanding of the impact of cronols on whole wheat products is currently lacking in China. Consequently, developing a safe and effective strain to reduce cronols and decrease the bitterness of whole wheat products holds great promise for future applications.

[0005] Research on the practical application of tryptophan still has shortcomings: (1) The microorganisms involved in the degradation of tryptophan by microorganisms are currently unknown. (2) In industrial applications, there is still a lack of strains that can be directly applied to degrade tryptophan during the production of whole wheat products. Summary of the Invention

[0006] To address the above problems, this invention provides a method for reducing cranol content in Kluwer Max Marx yeast INM3118, its preparation method, and its application in whole-wheat products. Without altering existing processes, this method uses Kluwer Max Marx yeast to ferment whole-wheat starter, resulting in a method for reducing cranol content in whole-wheat products. This not only reduces the cranol content in whole-wheat products but also improves their texture. Whole-wheat products produced using this preparation do not have their overall processing characteristics affected after fermentation, thus improving both the texture and reducing adverse factors introduced during processing.

[0007] The objective of this invention is achieved through the following method: a strain of Kluyveromyces macrocephala that reduces astaxanthin.

[0008] The strain is Kluyveromyces marxianus INM3118, which was deposited on August 13, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC 65004, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0009] Furthermore, the colony characteristics of Kluyveromyces martensii are as follows: After culturing on solid malt extract agar plates for 48 hours, single colonies of Kluyveromyces martensii are 1-2 mm in size, round in shape, with neat edges, opaque, milky white in color, raised in the middle, with a bright and smooth surface, and a moist texture that is easy to pick up.

[0010] A method for preparing Kluyveromyces martensii with reduced ascorbol content is as follows:

[0011] (1) Isolation of Kluyveromyces martensii: Kluyveromyces martensii was isolated and screened from fermented milk curd samples. The milk curd products were made into a paste and added to sterile water to dilute the concentration to 10. 5 -10 6 Different concentrations of dairy products were evenly spread on solid malt extract medium and incubated at 30°C for 48 hours. White colonies of Kluyveromyces with the correct morphology were selected from the solid malt extract medium for screening.

[0012] (2) Screening of Kluyveromyces martensii: The obtained Kluyveromyces martensii was cultured to the logarithmic growth phase, and then inoculated at a rate of 1%, with a final strain concentration of 1×10⁻⁶. 6 The cfu / mL concentration was inoculated into the selection medium solution and incubated at 30℃ for 3 days to obtain the fermentation broth.

[0013] Furthermore, the screening medium formula is as follows: commercial malt extract medium is prepared according to the formula requirements, sterilized at 0.1 MPa and 121℃ for 15 min, and 0.1% color alcohol is added before use.

[0014] The application of a strain of Max Kluwer yeast that reduces astaxanthin, based on the whole wheat product manufacturing process, involves an inoculation rate of 10 in the fermentation of whole wheat flour. 4 -10 8 The concentration of cfu / mL was 12 h, and the fermentation temperature was 30 °C.

[0015] Application of a Max Kluwer yeast strain that reduces bitterness in whole wheat.

[0016] Application of a Max Kluyveromyces strain that reduces cronol levels.

[0017] Advantages of the present invention: (1) The screening method of the present invention is universal and can be widely used in the screening of strains to reduce the content of croteric alcohol in whole wheat products.

[0018] (2) The Max Kluwer yeast provided by the present invention has the ability to reduce the bitterness of whole wheat and there will be no off-flavor in the fermented whole wheat product. It can be mixed with other grain powders in the later stage, which preserves the nutrition and flavor of whole wheat and has no safety risks.

[0019] (3) It can effectively reduce the chromol content of whole wheat dough after fermentation, improve the taste of whole wheat products, and reduce bitterness. Attached Figure Description

[0020] Figure 1 The results of screening different yeast strains for the degradation of crcotol are shown in the figure.

[0021] Figure 2 This is a morphological observation of strain INM3118 on solid maltose agar plates.

[0022] Figure 3 This is a microscopic image of the INM3118 strain after Gram staining.

[0023] Figure 4 The results show the stability of the INM3118 strain after passage.

[0024] Figure 5 The graph shows the results of the crenoic acid content in whole wheat bread in Example 3.

[0025] Figure 6 The inoculation concentration for Example 3 was 1.0 × 10⁻⁶. 7 Figure showing the results of whole wheat bread colorant content after CFU / mLINM3118 strain.

[0026] Figure 7 This is a flowchart of the operation process. Detailed Implementation

[0027] The present invention will be further described below with reference to specific embodiments:

[0028] Unless otherwise specified, the experimental methods used in the following implementation examples are all conventional methods; the materials and reagents used are all commercially available unless otherwise specified.

[0029] Example 1, see attached document Figure 1-7 A strain of Max Kluyveromyces yeast that reduces ascorbol.

[0030] The strain is Kluyveromyces marxianus INM3118, which was deposited on August 13, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC 65004, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0031] A strain of Kluyveromyces Marcius that reduces cronol has the following colony characteristics: After culturing on solid malt extract agar plates for 48 hours, single colonies of Kluyveromyces Marcius are 1-2 mm in size, round in shape, with neat edges, opaque, milky white in color, raised in the middle, with a bright and smooth surface, and a moist texture that is easy to pick up.

[0032] A method for preparing Kluyveromyces martensii with reduced ascorbol content, 1. Raw material processing

[0033] A sample of milk curds from Ewenki Banner, Hulunbuir City, was diluted with sterile saline to a concentration of 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 Concentrations were determined, and bacterial cell dilutions were prepared. 0.1 mL of each dilution was evenly spread onto malt extract agar plates and incubated at 30°C for 48 hours. Single colonies exhibiting white color, raised surfaces, smooth surfaces, and regular edges were selected. These colonies were then streaked onto malt extract agar plates for secondary purification, incubated at 30°C for 48 hours, and single colonies were selected for glycerol preservation. These colonies were named sequentially from NMY1001 to NMY1010. The screening process is as follows: Figure 7 .

[0034] 2. Preliminary screening of bacterial strains

[0035] The 10 bacterial strains were inoculated into malt extract liquid medium at a 1% inoculum concentration and cultured at 30°C with a shaker at 220 rpm / min for 24 h. Then, they were inoculated into selection medium at a 1% inoculum concentration and cultured statically at 30°C for 24 h, until the final bacterial density reached 10⁻⁶. 6 CFU / mL. Take samples from each tube, centrifuge at 10,000 rpm for 10 min, and the supernatant is the sample. The color alcohol is as shown in the results. Figure 1 As shown.

[0036] The screening medium formula is as follows: commercial malt extract medium is prepared according to the formula requirements, sterilized at 0.1 MPa and 121℃ for 15 min. Add 0.1% color alcohol before use.

[0037] Color alcohol detection method: Color alcohol is detected using high performance liquid chromatography (HPLC).

[0038] Liquid chromatography conditions: 10 μL of sample was injected into a CAPCELL PAK ADME (4.6 × 250 mm, 5 μm); mobile phase: phase A 0.1% phosphoric acid, phase B acetonitrile; flow rate: 1.0 ml / min; column temperature: 30 ℃; detector: DAD, wavelength 284 nm, detection time 0-25 min; mobile phase ratio was 20%-95% of mobile phase B, and the standard was dissolved in methanol.

[0039] Three strains with the highest croteric alcohol degradation rates, NMY1002, NMY1004, and NMY1008, were selected for secondary screening.

[0040] 3. Secondary screening of strains

[0041] The initially screened yeast strains NMY1002, NMY1004, and NMY1008 were reactivated and cultured. Inoculum was prepared according to the national standard GB / T14612-2008, with a cell concentration of 10-1. 6 The fermentation process was carried out at CFU / mL for 12 hours at a temperature of 30°C. Whole wheat bread was then prepared and its sensory evaluation was conducted. The results are shown in Table 1.

[0042] Table 1 Sensory Analysis of Fermented Bread

[0043]

[0044]

[0045] Note: Each indicator has a maximum score of 5 points, and the higher the score, the better the result.

[0046] As shown in Table 1, NMY1002 had the best sensory evaluation results. As a target strain for secondary screening, the morphological observation of this strain on solid maltose agar plates was as follows: Figure 2 As shown, the colonies are 4-5 mm in diameter, milky white in color, raised, round, with a smooth surface and neat edges. Gram staining followed by microscopic observation yields the following results: Figure 3 As shown.

[0047] The NMY1002 strain obtained through the above screening was identified by ITS sequencing. Comparative analysis showed that the 28S rRNA region sequence of the strain obtained in this invention had a 99.82% similarity to *Kluyveromyces marxianus*, confirming that this strain is indeed *Kluyveromyces marxianus* and can be used in the food fermentation industry. It was named *Kluyveromyces marxianus* INM3118. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on August 13, 2024, with accession number GDMCC65004. Therefore, in this application, INM3118 and NMY1002 refer to the same strain. The gene sequence of the NMY1002 strain of this invention is as follows:

[0048] ACGGCGGCATTTAACCATTACGCCAGCATCCTTGACAAAAGTCGCAATCCTCAGTCCCAGCT

[0049] GGCTGTATTCCCACGGGCTATAACACTCTACCGAAGCAGAGCCACATTCCCGAGGATTTATCC

[0050] AACCGCTAAAACTGATGCTGGCCCAGCGAAAGCCGAAGCAAACGCCATGTCTGATCAAATGCC

[0051] CTTCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCA

[0052] TCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCC

[0053] ACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGCACTTTACAAATAACTGGGATCC

[0054] TCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGACCAGC

[0055] TACAAAGTCGCCTTCTTCAAATTACAACTCGGACGTCGAAGACGCCAGATTTCAAATTTGAGC

[0056] TTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCCTC

[0057] Example 2: Genetic stability test of Kluyveromyces martensii INM3118

[0058] The *Kluyveromyces martensii* INM3118 from Example 1 was passaged 10 times on screening liquid medium. Samples from generations 1, 5, and 10 were centrifuged at 10,000 rpm for 10 min, and the supernatant was used as the sample. Physicochemical indicators were analyzed, and the method for determining the chromol content was the same as in Example 1. Sensory evaluation was also performed to determine its passage stability; specific data can be found in… Figure 4 .

[0059] Figure 4 The results showed that the fermentation performance of Kluyveromyces martensii INM3118 strains of different generations was normal, the change in the content of chromol reduction rate was within 5%, the genetic stability of the strains was good, and they met the requirements for production and use.

[0060] Example 3: Making Whole Wheat Bread with Max Kluwer Yeast INM3118 Whole Wheat Starter

[0061] Kluyveromyces INM3118 was used to inoculate and ferment whole wheat dough starter. The whole wheat dough starter was prepared according to the national standard GB / T14612-2008. The concentration of Kluyveromyces INM3118 inoculated was 10... 4 -10 8 At CFU / mL, whole wheat bread was made separately, with the control group not containing the experimental Max Kluyveromycin.

[0062] Extraction of crantrol: Dissolve 5g of whole wheat bread in 10 times its weight of methanol, centrifuge at 8000rpm / min, 5℃ for 10min, filter through a 0.45μm filter membrane, freeze-dry, and dissolve in 1 times its weight of methanol. The method for detecting crantrol in the bread is the same as in Example 1. The results are as follows: Figure 5 As shown.

[0063] Table 2 Sensory evaluation results of whole wheat bread

[0064]

[0065] Note: Each evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items. The higher the score, the better the result.

[0066] Depend on Figure 5As shown in Table 2, Kluyveromyces Marcius INM3118 significantly reduces the colorant content in whole wheat bread, and the higher the inoculum size, the lower the colorant content. However, excessively high concentrations of Kluyveromyces Marcius INM3118 can negatively impact the flavor of the bread, as the metabolism of Kluyveromyces Marcius affects the sourness, bitterness, and texture of the bread. The optimal inoculum concentration is 1.0 × 10⁻⁶. 7 At a concentration of CFU / mL, this bacterial strain can effectively reduce the tryptophan content to 14.45 ± 0.13 mg / Kg, as shown in the test results. Figure 6 It can also enhance the flavor and texture of whole wheat bread.

[0067] Example 4: Making Whole Wheat Toast with Max Kluwer Yeast INM3118 Starter

[0068] The final concentration of Kluyveromyces martensii INM3118 was 10. 7 Whole wheat starter was prepared at a dose of CFU / mL, and whole wheat toast was made according to the national standard GB / T14612-2008. Kluyveromyces martensii was used as a control group without the addition of the experimental strain. The content of crtanol was extracted and detected according to the methods in Examples 1 and 3. At the same time, a professional evaluator was asked to conduct a sensory evaluation of the flavor of the whole wheat toast. The results are recorded in Table 3.

[0069] Table 3. Results of Whole Wheat Toast Testing and Sensory Evaluation

[0070]

[0071] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.

[0072] As shown in Table 3, inoculating whole wheat flour with 10 7 Using CFU / mL Kluyveromyces martensii INM3118 to make whole wheat toast can significantly reduce the astaxanthin content of whole wheat toast; in addition, it can improve the sensory evaluation of whole wheat toast, increase the aroma of toast, enhance the flavor and texture of whole wheat toast, and make whole wheat toast fragrant and sweet and sour.

[0073] Example 5: Making whole wheat European bread with Max Kluyveromycin INM3118

[0074] The final concentration of Kluyveromyces martensii INM3118 was 10. 7 Whole wheat starter was prepared at a dose of CFU / mL, and whole wheat European bread was made according to the national standard GB / T14612-2008. The control group was not added with the experimental strain Kluyveromyces martensii. After fermentation, the crtanol content in the whole wheat European bread was extracted and detected according to the methods in Examples 1 and 3. A professional evaluator was asked to conduct a sensory evaluation of the flavor of the whole wheat European bread. The results are recorded in Table 4.

[0075] Table 4. Detection and sensory evaluation results of whole wheat European bread

[0076]

[0077] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.

[0078] As shown in Table 4, the final concentration in whole wheat was 10 7 Using CFU / mL Kluyveromycin INM3118 as a starter can significantly reduce the content of astaxanthin in whole wheat bread. In addition, it can improve the sensory evaluation of whole wheat bread, increase its aroma, enhance its flavor and texture, and make it fragrant, sweet and sour.

[0079] Example 6: Making Whole Wheat Bread with Kluyveromycin INM3118

[0080] The final concentration of Kluyveromyces martensii INM3118 was 10. 7 Whole wheat starter was prepared at a dose of CFU / mL, with Kluyveromyces martensii without the experimental strain used as a control group, and then meal rolls were made according to the national standard GB / T14612-2008.

[0081] After fermentation, the ascorbol content in the whole wheat bread was extracted and tested according to the methods in Examples 1 and 3. At the same time, a professional evaluator was asked to conduct a sensory evaluation of the flavor of the whole wheat bread. The results are recorded in Table 5.

[0082] Table 5. Detection and sensory evaluation results of whole wheat bread rolls

[0083]

[0084] Note: Each sensory evaluation item is worth 10 points, with a scoring interval of 0.1. The overall score is the sum of all items.

[0085] As shown in Table 5, inoculating whole wheat with 10 7 Using CFU / mL Kluyveromycin INM3118 as a starter can significantly reduce the content of ascorbol produced during fermentation; in addition, it can improve the sensory evaluation of bread rolls, increase the aroma of bread rolls, and enhance the flavor and texture of whole wheat bread rolls, making whole wheat bread rolls fragrant and sweet and sour.

[0086] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3118 provided by the present invention, when applied to whole wheat fermentation, can significantly reduce the content of chromols in related whole wheat products without changing the existing process, while also improving the aroma and taste of whole wheat products, thus significantly improving the quality of whole wheat products.

[0087] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, which fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention patent should be determined by the appended claims.

Claims

1. A strain of Kluyveromyces macrocephala that reduces ascorbol, characterized by: This strain is *Kluyveromyces martensii* (…). Kluyveromyces marxianus The strain INM3118 was deposited on August 13, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC 65004, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

2. The K. marxianus strain for reducing urobilin according to claim 1, characterized by: The colony characteristics of Kluyveromyces martensii are as follows: After culturing on solid malt extract agar plates for 48 hours, single colonies of Kluyveromyces martensii are 1-2 mm in size, round in shape, with neat edges, opaque, milky white in color, raised in the middle, bright and smooth in surface, moist in texture and easy to pick up.

3. The application of the Kluyveromyces martensii strain for reducing ascorbol as described in claim 1 in whole-wheat products, characterized in that: According to the whole wheat product manufacturing process, the inoculum level in fermented whole wheat flour is 10. 4 -10 8 The concentration of cfu / mL was 12 h, and the fermentation temperature was 30 °C.

4. The application of the Kluwer Maximilian yeast strain for reducing bitterness in whole wheat as described in claim 1 in whole wheat products.