Rice oscmpg1 gene and application thereof in rice disease resistance

Abstract

This invention discloses rice OsCMPG1 This research, focusing on genes and their application in rice disease resistance, falls under the field of molecular bio-agricultural technology. The gene is knocked out using CRISPR / Cas9 technology. OsCMPG1 Obtaining knockout mutants oscmpg1 Through rice blast resistance identification, it was found that, compared with wild-type rice, the mutant... oscmpg1 It is more resistant to disease, with smaller lesion areas and less rice blast fungus carried on diseased leaves, indicating that... OsCMPG1 Negative regulation of rice resistance to rice blast. Through bacterial blight resistance identification, it was found that, compared with wild-type rice, the mutant... oscmpg1 More resistant to disease, shorter lesions, indicating OsCMPG1 Negative regulation of rice resistance to bacterial blight.

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural technology, specifically relating to the application of the rice OsCMPG1 gene and its encoded protein in improving rice disease resistance. Background Technology

[0002] Rice (Oryza sativa L.) is an important food crop, with more than half of the world's population relying on it as a staple food. However, rice yield and quality are threatened by various pathogens. Rice blast and bacterial blight, caused by Pyricularia oryzae and Xanthomonas oryzae pv. oryzae respectively, are major diseases affecting rice production. These diseases are prevalent in rice-growing regions of my country and around the world, causing significant yield reductions and becoming major limiting factors in rice production, as well as a significant threat to global food security. When rice is infected by Pyricularia oryzae or bacterial blight, normal growth and development are affected, and severe outbreaks can lead to substantial yield losses.

[0003] There are many methods for controlling rice diseases. Long-term production practice has proven that breeding and promoting disease-resistant new varieties is the most economical, effective, and environmentally friendly method for controlling diseases such as rice blast and bacterial blight. Therefore, identifying genes related to rice resistance to rice blast and bacterial blight and elucidating their molecular mechanisms is of great significance for breeding new disease-resistant rice varieties and developing disease control strategies. Currently, some disease-resistant genes have been applied in production practice. However, due to the complex and variable pathogen populations in the natural environment, disease-resistant varieties generally lose their resistance after 3-5 years of planting. Therefore, continuously discovering new disease-resistant genes is of paramount importance for breeding disease-resistant rice varieties and ensuring national food security. Summary of the Invention

[0004] The purpose of this invention is to solve the technical problems of traditional disease-resistant breeding by providing the OsCMPG1 gene and its encoded protein and its application in improving rice resistance.

[0005] The rice OsCMPG1 gene has the nucleotide sequence shown in SEQ ID NO.1 and the encoded amino acid sequence shown in SEQ ID NO.2.

[0006] The application of the rice OsCMPG1 gene in rice blast and bacterial blight, as shown in SEQ ID NO.1.

[0007] A method for breeding disease-resistant rice is achieved by knocking out the OsCMPG1 gene in rice varieties, as shown in SEQ ID NO.1.

[0008] The knockout is performed using CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the OsCMPG1 gene knockout target is: CGTCTCAGCAACGATATCTCtgg.

[0009] A gene knockout vector that inserts the target nucleotide sequence of the OsCMPG1 gene, namely CGTCTCAGCAACGATATCTCtgg, into the vector pYLCRISPR / Cas9P. ubi Built in -H.

[0010] This invention provides the application of the rice OsCMPG1 gene and its encoded protein in improving rice disease resistance, achieved by knocking out the rice OsCMPG1 gene. The nucleotide sequence of the OsCMPG1 gene is shown in SEQ ID NO.1. The knockout is performed using CRISPR / Cas9 gene editing technology. The target nucleotide sequence of the OsCMPG1 gene is: CGTCTCAGCAACGATATCTCtgg. This invention knocks out the OsCMPG1 gene using CRISPR / Cas9 technology to obtain the knockout mutant oscmpg1. Rice blast resistance identification revealed that, compared with wild-type rice, the knockout mutant oscmpg1 is more resistant to rice blast, with smaller lesion areas and less rice blast fungus carried on diseased leaves, indicating that the OsCMPG1 gene negatively regulates rice resistance to rice blast. The knockout mutant oscmpg1, lacking the OsCMPG1 gene, exhibits enhanced resistance to rice blast. Rice bacterial blight resistance identification revealed that, compared with wild-type rice, the knockout mutant oscmpg1 was more resistant to the disease, with significantly smaller lesion lengths, indicating that the OsCMPG1 gene negatively regulates rice resistance to bacterial blight. The oscmpg1 knockout mutant, lacking the OsCMPG1 gene, exhibits enhanced resistance to rice bacterial blight and can be widely applied in practice. This invention is beneficial for breeding rice varieties resistant to rice blast and bacterial blight, providing a basis for later screening of highly resistant and broad-spectrum resistant rice varieties. Attached Figure Description

[0011] Figure 1 A schematic diagram of knocking out the OsCMPG1 gene in a Nipponbare (NIP) rice background using CRISPR / Cas9 gene editing technology;

[0012] Figure 2Analysis of the resistance of the oscmpg1 mutant to rice blast after spray inoculation; A represents the phenotype of wild-type Nipponbare (NIP) and the oscmpg1 mutant after inoculation with rice blast fungus; B represents the statistical results of the leaf lesion area after inoculation of wild-type Nipponbare (NIP) and the oscmpg1 mutant with rice blast fungus; C represents the detection results of rice blast fungus inoculum in leaves after inoculation of wild-type Nipponbare (NIP) and the oscmpg1 mutant with rice blast fungus.

[0013] Figure 3 Analysis of the resistance of the oscmpg1 mutant to rice blast after punch inoculation; A represents the phenotype of wild-type Nipponbare (NIP) and the oscmpg1 mutant after inoculation with rice blast fungus; B represents the statistical results of the leaf lesion area after inoculation of wild-type Nipponbare (NIP) and the oscmpg1 mutant with rice blast fungus.

[0014] Figure 4 Analysis of resistance of oscmpg1 mutant to bacterial blight after leaf cutting inoculation; A represents the phenotype of wild-type Nipponbare (NIP) and oscmpg1 mutant after inoculation with bacterial blight pathogen; B represents the statistical results of leaf lesion length after inoculation of wild-type Nipponbare (NIP) and oscmpg1 mutant with bacterial blight pathogen. Detailed Implementation

[0015] Example 1 Cloning of the OsCMPG1 gene

[0016] Cloning primers for the target gene OsCMPG1 (base sequence shown in SEQ ID NO. 1) were designed using Primer Premier 5.0 software. RNA was extracted from the rice variety *Oryza sativa* L. var. *Nipponbare* (preserved by Jilin Agricultural University) and cDNA was obtained via reverse transcription. Using this cDNA as a template, PCR amplification was performed using the designed cloning primers, yielding a PCR product of 1362 bp. This PCR product contains nucleotides 1 to 1362 of the sequence shown in SEQ ID NO: 1.

[0017] OsCMPG1-F: ATGGTTTTGCCGATGTCTCG;

[0018] OsCMPG1-R: TCAGAATGGCCTCTTGAGACCC.

[0019] The PCR amplification system was prepared according to the Phusion DNA Polymerase instructions, specifically: 10 μL of 2×PhantaMax Buffer, 0.4 μL of dNTP Mix, 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 400 ng of cDNA template, 0.4 μL of Phusion DNA Polymerase, and ddH2O to a final volume of 20 μL.

[0020] The PCR reaction system was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min 24 s, for 32 cycles; 72℃ full extension for 5 min.

[0021] Example 2: Construction of OsCMPG1 gene mutant

[0022] I. Construction of OsCMPG1 gene mutant using CRISPR / Cas9 gene editing technology

[0023] Using the website http: / / skl.scau.edu.cn / , editing target sites were designed for the target gene OsCMPG1 (base sequence shown in SEQ ID NO.1 of the sequence listing). The target site locations are as follows: Figure 1 As shown, the target nucleotide sequence is: CGTCTCAGCAACGATATCTCtgg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and subsequently, using the Golden Gate cloning method, the OsU6a-target-sgRNA fragment was inserted into the final vector pYLCRISPR / Cas9P using the BsaI restriction site. ubi-H (For specific construction steps, refer to: Ma Xingliang, Zhang Qunyu, Zhu Qinlong, Liu Wei, Chen Yan, Qiu Rong, Wang Bin, Yang Zhongfang, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 8(8), 1274-1284.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced by wild-type Nipponbare embryos using Agrobacterium-mediated transformation, and positive transgenic plants were obtained by hygromycin screening.

[0024] II. Molecular Identification of Editing Forms in Positive Transgenic Plants

[0025] Primers for identifying the oscmpg1 mutant were designed using Primer 5 software. Using genomic DNA from rice leaves as a template, PCR amplification was performed using the following primers. The amplified products were then subjected to Sanger sequencing to analyze the mutant editing pattern.

[0026] The primers for identifying OsCMPG1 gene mutants are:

[0027] OsCMPG1-CRISPR-F:CCAAGCCATTCAACGGTCAACA;

[0028] OsCMPG1-CRISPR-R:ACGCACCAGTCCTGGATCATC.

[0029] The PCR amplification system was prepared according to the instructions for 2×EsTaq MasterMix (Dye), specifically: 12.5 μL of 2×EsTaq MasterMix (Dye), 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 1.5 μg of DNA template, and ddH2O added to a final volume of 25 μL.

[0030] The PCR reaction system was as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 41 s, for 35 cycles; 72℃ extension for 2 min.

[0031] The results are as follows Figure 1As shown, two homozygous knockout mutant lines, oscmpg1-5 and oscmpg1-7, were obtained. In the oscmpg1-5 mutant, a two-base AT deletion occurs 57 bp downstream of the start codon ATG in the OsCMPG1 gene, resulting in a frameshift mutation and the premature formation of a stop codon at 154-156 bp. In the oscmpg1-7 mutant, a five-base GAGAT deletion occurs 52 bp downstream of the start codon ATG in the OsCMPG1 gene, resulting in a frameshift mutation and the premature formation of a stop codon at 151-153 bp.

[0032] Example 3: Identification of rice blast resistance using spray inoculation method

[0033] Wild-type Nipponbare (NIP) and knockout mutant line oscmpg1-7 seeds were disinfected by soaking in 50% sodium hypochlorite solution for 20 min. The disinfected seeds were then soaked in distilled water and cultured in an incubator at 37℃ until germination. The seeds were then planted in seedling trays and inoculated with rice blast fungus when they reached the five-leaf stage.

[0034] To prepare tomato-oat culture medium, take 30 g of oats, add 500 mL of distilled water, boil for 10 min, cool to 30-40℃, filter to remove the oats, and retain the filtrate. Crush 100 g of tomatoes using a juicer, add them to the filtrate, add distilled water to a final volume of 1 L, stir well, and dispense into Erlenmeyer flasks. Add 2 g of agar powder to every 100 mL of culture medium, and sterilize at 121℃ for 20 min.

[0035] The *Bacillus oryzae* strain TCB-M, preserved on filter paper, was inoculated onto tomato-oat agar plates and activated at 28°C. After mycelial growth, the mycelia were scraped off and transferred to new tomato-oat agar plates for further culture. The mycelia were broken up using a sterilized cotton swab dipped in ddH2O and placed in a 28°C black light incubator to induce sporulation. The plates were washed with 0.1% Tween solution, filtered, and a *Bacillus oryzae* spore suspension was obtained. The spore concentration was adjusted to 3.0 × 10⁻⁶. 5 Quantity / mL, ready for use.

[0036] At inoculation, rice leaves were evenly sprayed with 0.1% Tween solution, and the rice blast fungus spore eluate was evenly sprayed onto the leaves. After inoculation, the leaves were incubated in the dark and moist for 24 hours. After removing the shading cloth, the leaves were incubated under normal light. Seven days after inoculation, the leaves were cut and photographed to record the disease incidence. The area of ​​lesions on the inoculated leaves was counted using Photoshop software. Simultaneously, the amount of fungus carried on the diseased leaves was detected using real-time quantitative PCR. Equal amounts of leaves from wild-type Nipponbare (NIP) and the knockout mutant oscmpg1 were taken, and genomic DNA was extracted. Real-time quantitative PCR was performed using the following primers to compare the amount of rice blast fungus carried by wild-type NIP and knockout mutant oscmpg1 leaves, thereby completing the evaluation of the knockout mutant's resistance to rice blast.

[0037] The primers for real-time quantitative PCR are:

[0038] MoPot2-F: ACGACCCGTCTTTACTTATTTGG;

[0039] MoPot2-R:AAGTAGCGTTGGTTTTGTTGGAT;

[0040] OsUbi-F:GCCCAAGAAGAAGATCAAGAAC;

[0041] OsUbi-R: AGATAACAACGGAAGCATAAAAGTC.

[0042] The real-time PCR amplification system was prepared according to the instructions for use of the 2×SYBR qPCR Mixture, specifically: 5 μL of 2×SYBR qPCR Mixture, 0.2 μL of upstream primer (10 μM), 0.2 μL of downstream primer (10 μM), 0.6 μL of DNA template, and ddH2O to a final volume of 10 μL. Each sample was replicated in triplicate.

[0043] The quantitative PCR reaction system was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, 60℃ annealing for 1 min, 40 cycles; 72℃ extension for 2 min.

[0044] The results are as follows Figure 2 As shown, compared with the wild type, the leaf lesion area and blast fungus content in the homozygous knockout mutant line oscmpg1-7 were significantly lower than those in the wild type, indicating that knocking out the OsCMPG1 gene significantly enhanced the wild type's resistance to rice blast.

[0045] Example 4: Identification of rice blast resistance using the punch inoculation method

[0046] Wild-type Nipponbare (NIP) and knockout mutant line oscmpg1-7 seeds were soaked and disinfected. The disinfected seeds were then soaked in distilled water and cultured in an incubator at 37°C until germination. The seeds were then planted in seedling trays and cultured in a greenhouse. When the seedlings reached the six-leaf stage, they were inoculated with rice blast fungus.

[0047] To prepare tomato-oat culture medium, take 30 g of oats, add 500 mL of distilled water, boil for 10 min, cool to 30-40℃, filter to remove the oats, and retain the filtrate. Crush 100 g of tomatoes using a juicer, add them to the filtrate, add distilled water to a final volume of 1 L, stir well, and dispense into Erlenmeyer flasks. Add 2 g of agar powder to every 100 mL of culture medium, and sterilize at 121℃ for 20 min.

[0048] The *Bacillus oryzae* strain TCB-M, preserved on filter paper, was inoculated onto tomato-oat agar plates and activated by incubation at 28°C. After mycelial growth, the mycelia were scraped off and transferred to new tomato-oat agar plates for further culture. The mycelia were broken up using a sterilized cotton swab dipped in ddH2O and placed in a 28°C black light incubator to induce sporulation. The plates were washed with 0.1% Tween solution, filtered, and the resulting spore eluent was adjusted to a concentration of 3.0 × 10⁻⁶. 5 Quantity / mL, ready for use.

[0049] For inoculation, select a rice plant at the second-to-last leaf, 7 cm from the leaf tip. Apply a 5 cm long piece of transparent tape to the underside of the leaf. Using 2 mm diameter rat-ear forceps, make a wound on the epidermis on the left side of the leaf vein. Add 5 μL of rice blast fungus spore eluent to the wound. Slant the transparent tape to form an air cell encapsulating the bacterial solution. After inoculation, incubate in the dark under moist conditions for 24 hours. After removing the shading cloth, continue incubation under normal light. Seven days after inoculation, cut leaves and photograph them to record disease incidence. Use Photoshop software to statistically analyze the area of ​​lesions on the inoculated leaves, thus completing the evaluation of the knockout mutant's resistance to rice blast.

[0050] The results are as follows Figure 3 As shown, compared with the wild type, the lesion area in the leaves of the homozygous knockout mutant line oscmpg1-7 was significantly smaller than that in the wild type, indicating that knocking out the OsCMPG1 gene significantly enhanced the wild type's resistance to rice blast.

[0051] Example 5: Identification of resistance to bacterial blight using the leaf-cutting inoculation method

[0052] Wild-type Nipponbare (NIP) and knockout mutant lines oscmpg1-5 and oscmpg1-7 were planted in greenhouses, and rice plants that had grown for 6 weeks were inoculated with bacterial blight pathogen.

[0053] First, the *Bacillus thuringiensis* strain PXO99A, frozen at -80℃, was streaked onto beef extract peptone solid medium containing cephalexin for activation and incubated at 28℃ for one day. Single colonies were picked and transferred to beef extract peptone liquid medium containing cephalexin, and incubated at 28℃ with shaking for 48 h. The cells were then collected by centrifugation at 9000 rpm for 3 min. The cells were resuspended in 0.1 M MgCl2 solution, centrifuged at 9000 rpm for 3 min, and the supernatant was discarded. This process was repeated once. Finally, the cells were resuspended in 0.1 M MgCl2 solution, and the OD600 of the bacterial suspension was adjusted to 1.0 using a spectrophotometer for later use.

[0054] At inoculation, rice plants that have grown for 6 weeks are moved to a location with suitable sunlight and no rain. Using sterilized scissors, the bacterial suspension is applied to the leaves, approximately 10 cm below the tip of the second-to-last leaf of each plant. The leaves are left to stand for two weeks, during which time they are periodically sprayed with distilled water to keep them moist. Two weeks later, the length of lesions is measured, and the length of lesions on the leaves of wild-type NIP and the knockout mutant lines oscmpg1-5 and oscmpg1-7 is compared to evaluate the knockout mutant's resistance to bacterial blight.

[0055] The results are as follows Figure 4 As shown, compared with the wild type, the lesion length on the leaves of the knockout mutant lines oscmpg1-5 and oscmpg1-7 was significantly shorter than that of the wild type, indicating that the knockout mutant lines oscmpg1-5 and oscmpg1-7 had significantly enhanced resistance to bacterial blight.

Claims

1. A method for breeding disease-resistant rice, characterized in that: Knock out the OsCMPG1 gene in rice varieties as shown in SEQ ID NO.1 of the sequence listing; The rice variety mentioned is Nipponbare, and the disease mentioned is caused by bacterial blight fungus PXO99A.

2. The method for breeding disease-resistant rice according to claim 1, characterized in that: The knockout was performed using CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the knockout target was: CGTCTCAGCAACGATATCTCtgg.

Images