Use of an agent that promotes or activates expression or transcription of the SCD1 gene in the preparation of a medicament for treating aortic aneurysm and dissection

CN119215172BActive Publication Date: 2026-08-28ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411394525.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-08
Publication Date
2026-08-28
Estimated Expiration
2044-10-08

AI Technical Summary

Technical Problem

然而,SCD1是否参与AAD的疾病进展尚不明确

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119215172B_ABST
    Figure CN119215172B_ABST
Patent Text Reader

Abstract

The application discloses application of stearoyl-CoA desaturase as an aortic aneurysm and dissection prevention and treatment target. ‑ / ‑ ) and SCD1 vascular smooth muscle specific overexpression mouse (Scd1-VSMC-KI) to construct an AAD model, and the prevention and treatment effect of SCD1 on AAD is detected through indexes such as survival rate, aortic dilation degree, aortic dissection and aortic aneurysm formation ratio, and the result shows that, targeted excitation of SCD1 can effectively relieve AAD occurrence and progress, which indicates that drug development aiming at SCD1 is expected to become a new strategy for preventing and treating AAD, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of stearoyl-CoA desaturase (SCD1) as a target for the prevention and treatment of aortic aneurysm and dissection, and belongs to the field of biomedical technology. Background Technology

[0002] Aortic aneurysm / dissection (AAD) is a common and life-threatening aortic disease. Current treatment is limited to regular imaging monitoring of aortic diameter and surgical repair. There are no effective drug treatments to limit the progression of AAD or prevent its rupture. Therefore, exploring potential therapeutic targets for AAD is crucial.

[0003] Stearoyl-CoA desaturase (SCD) is a transmembrane protein located in the endoplasmic reticulum (ER) responsible for introducing double bonds into saturated fatty acids to form unsaturated fatty acids. Polyunsaturated fatty acids typically regulate mitochondrial metabolic health, conferring cardiovascular protection. Abnormal accumulation of saturated fatty acids causes ER stress and inflammation, exacerbating the progression of acute arteriosclerosis (AAD). SCD1 has been widely reported to participate in the progression of diseases such as heart failure and cancer by regulating metabolic reprogramming. However, whether SCD1 is involved in the progression of AAD remains unclear. Currently, there are no reports on the role of SCD1 as a preventative or therapeutic target in AAD, nor its diagnostic and therapeutic value. Summary of the Invention

[0004] The purpose of this invention is to address the technical problem of insufficient existing drugs for the prevention and treatment of aortic aneurysm / dissection. This invention provides the application of stearoyl-CoA desaturase (SCD1) as a target for the prevention and treatment of aortic aneurysm / dissection. Through detection in clinical and animal samples, this invention shows that SCD1 is closely related to the occurrence and development of AAD. Animal experiments have demonstrated that targeted inhibition of SCD1 can effectively aggravate the progression of AAD, while targeted activation of SCD1 can effectively alleviate the occurrence and progression of AAD. This indicates that the development of drugs targeting SCD1 is expected to become a new strategy for the prevention and treatment of AAD and has important application value.

[0005] To achieve the above objectives, the present invention provides the application of SCD1 as a target in the preparation or screening of drugs for the treatment of aortic aneurysm and dissection.

[0006] The present invention also provides the application of the SCD1 gene or protein, the expression vector of the SCD1 gene or protein, the reagents for promoting or activating the expression or transcription of the SCD1 gene, and the reagents for promoting the expression or activity of the SCD1 protein in the preparation of drugs for treating aortic aneurysms and dissections.

[0007] Preferably, the reagents for promoting or activating SCD1 gene expression or transcription include at least one of an SCD1 gene overexpression vector, an SCD1 gene overexpression cell, and an SCD1 mRNA liposome.

[0008] Preferably, the primer sequence for synthesizing the sgRNA is shown in SEQ ID NO: 2.

[0009] Preferably, the reagent that promotes SCD1 protein expression or activity includes recombinant SCD1 protein.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] This invention, by detecting the expression of the SCD1 gene in the aortic tissue of AAD patients and AAD model mice, found that SCD1 is closely related to the occurrence and development of AAD; simultaneously, it applied systemic SCD1 gene knockout (Scd1)... - / - An AAD model was constructed using mice that specifically overexpress SCD1 in vascular smooth muscle (Scd1-VSMC-KI). The preventive and therapeutic effects of SCD1 on AAD were detected by measuring indicators such as survival rate, degree of aortic dilation, and degree of aortic lesions. This invention provides a theoretical basis for the application of SCD1 in the clinical prevention and treatment of AAD. Attached Figure Description

[0012] Figure 1 The expression level of SCD1 in the aorta was significantly increased in AAA patients and model mice: (A) Comparison of SCD1 expression levels in the aorta of AAD mice and normal control mice; (B) Comparison of SCD1 expression levels in the aorta of AAA patients and normal populations; p<0.05 was considered statistically significant; ** indicates p<0.01, *** indicates p<0.001.

[0013] Figure 2 Aortic dilation and lesions in each group of mice: (A) Representative images of the aorta in each group of AAD model mice; (B) Statistical comparison of the maximum diameter of aortic dilation between each control group and AAD model mice; (C) Survival analysis of each group of AAD model mice; p<0.05 was considered statistically significant; *** indicates p<0.001 compared with the WT group, ### indicates p<0.001 compared with the Scd1 group. fl / fl Compared with the previous group, p < 0.001. Detailed Implementation

[0014] To make the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings.

[0015] Unless otherwise specified, the experimental methods in the following examples were performed using conventional methods and conditions or according to the product instructions; the materials and reagents used were all commercially available products unless otherwise specified; all quantitative experiments involved were performed in triplicate and the results were averaged.

[0016] Example

[0017] (I) Experimental Scheme

[0018] In this embodiment, adult male C57BL / 6 mice (purchased from Shanghai Jiesijie Laboratory Animal Co., Ltd.) and SCD1 knockout and overexpression mice (8 weeks old, 20-25g) were used. Mice were subcutaneously infused with Ang II (2500 ng / kg·min) via a subcutaneously implanted micro-osmotic slow-release pump for 28 consecutive days to establish an aortic aneurysm and dissection (AAD) model. The control group received 0.9% saline solution at a rate of 0.5 μl / hr subcutaneously using the same method. Mice were divided into wild-type (WT) and KO (Scd1) groups based on genotype. - / - Scd1 gene knockout group), Scd1 fl / fl The survival curves of mice in the KI group (control group) and the KI group (Scd1-VSMC-KI, Scd1 gene knock-in group) were recorded daily; among them, Scd1 fl / fl Mice in the target group, KO group, and KI group were provided by Cyagen Biosciences Co., Ltd. Mice in the KI group underwent targeted knock-in of the target mouse Scd1 gene using CRISPR-Cas9 gene editing technology. The reference sequence for the mouse Scd1 gene NC11 is NM 009127.4. The sgRNA targeting sequence used for CRISPR-Cas9 gene editing was 5'-CTCCAGTCTTTCTAGAAGATGGG-3' (SEQ ID NO: 1), and the primer sequence was 5'-CUCCAGUCUUUCUAGAAGAUGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUU-3' (SEQ ID NO: 2). Mice were euthanized after 28 days to obtain tissue samples. Aortic tissue was fixed and embedded for observation of aortic lesions. The experimental protocol was approved by the Animal Management and Ethics Committee of Fudan University. Aortic tissue was also collected from AAD patients who underwent aortic replacement surgery and from non-AAD organ donor patients to detect SCD1 expression in aortic tissues from different populations. All experimental protocols using human specimens were approved by the Institutional Ethics Committee of Zhongshan Hospital affiliated with Fudan University. Informed consent was obtained from all patients.

[0019] (II) Experimental Results

[0020] 1) The expression level of SCD1 in the aorta was significantly increased in AAD patients and model mice.

[0021] By detecting SCD1 expression in aortic tissues of different mice and humans, the results showed that SCD1 expression levels were significantly increased in AAD-WT modeled mice compared to the unmodeled control group (control-WT). Figure 1 As shown in Figure A, compared with healthy donors (controls), patients with AAD showed significantly elevated levels of SCD1 expression in the aorta, such as... Figure 1 As shown in B.

[0022] 2) By examining the aortic dilation and lesions in each group of model mice, the results showed that the maximum diameter of the aorta in the KO group was significantly increased. Figure 2 AB), the proportion of aortic dissection and aneurysm formation is increased ( Figure 2 AB), survival curve statistics show an increased mortality rate due to aortic rupture ( Figure 2 C); These lesions improved significantly in the KI group, such as Figure 2 As shown.

[0023] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make several improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

Claims

1. The application of a reagent that promotes or activates SCD1 gene expression or transcription in the preparation of a drug for treating aortic aneurysm and dissection, wherein the reagent that promotes or activates SCD1 gene expression or transcription is a CRISPR-Cas9 gene knock-in system, and the primer sequence for synthesizing sgRNA used in the CRISPR-Cas9 gene knock-in system is shown in SEQ ID NO: 2.

Citation Information

Patent Citations

  • Fatty acid analogs and their use in the treatment of conditions related to metabolic syndrome

    IN202017019856A