Monoclonal antibodies against tpo and methods of making and using the same

Abstract

This invention relates to the field of immunology, and particularly to anti-TPO monoclonal antibodies, their preparation methods, and applications. This invention provides a human anti-TPO virus antibody obtained through phage surface display technology. The anti-TPO fully human monoclonal antibodies TH507 and TH512 have purities >90%, transient expression levels of 150 mg / L and 120 mg / L, respectively. Both specifically recognize the TPO recombinant antigen and can undergo significant enzyme-linked immunosorbent assay (ELISA) reactions with the antigen. Furthermore, their accelerated stability at 37°C meets the requirements for use in reagent kits. As quality control materials, they can play an important role in the detection of thyroid function and TPO.

Description

Technical Field

[0001] This invention relates to the field of immunology, and in particular to anti-TPO monoclonal antibodies, their preparation methods, and applications. Background Technology

[0002] Thyroid peroxidase (TPO) is a large membrane-bound glycoprotein (103 kDa) composed of 933 amino acids. It is located in the apical membrane of thyroid follicular cells and is expressed only in thyroid cells. It is a key enzyme that catalyzes the synthesis of thyroid hormones. Its structure consists of three parts: an extracellular structural region, a transmembrane region, and an intracellular structural region.

[0003] TPO plays a crucial role in the synthesis of thyroid hormones at the apex of follicular cells, and most TPO is degraded within thyroid cells. If the activity of thyroid peroxidase is inhibited or attacked by the immune system, it can lead to impaired thyroid hormone synthesis, resulting in thyroid disease. High levels of thyroid peroxidase antibodies indicate that the body's immune system has attacked the thyroid gland, which is often associated with autoimmune thyroid diseases. For example, surgery, trauma, infection, and other causes can lead to TPO leakage, triggering an autoimmune response and the production of anti-TPO autoantibodies, namely thyroid peroxidase antibodies (TPO-Ab). This enzyme can synergistically work with TG to iodinate L-tyrosine and link monoiodotyrosine and diiodotyrosine to form thyroid hormones T4, T3, and rT3. The main indication for detecting these antibodies is autoimmune thyroid diseases (including Graves' disease and Hashimoto's thyroiditis), and they are of significant diagnostic value for these diseases.

[0004] TPO is a potential autoantigen, and TPO antibodies are thyroid peroxidase antibodies, or TPO-Ab, which are autoantibodies produced by the body against TPO. TPO-Ab is a glycoprotein containing a hemoglobin cofactor and is present on the microsomes of thyroid cells. It is significantly elevated in patients with Hashimoto's thyroiditis, Graves' disease, and idiopathic myxedema, especially in Hashimoto's thyroiditis. Elevated TPO-Ab levels can be detected in approximately 65% ​​of Graves' disease patients, 95% of Hashimoto's thyroiditis or congenital myxedema patients, 19% of differentiated thyroid cancer patients, and 11% of other mixed non-autoimmune thyroid diseases. In patients with primary hypothyroidism, elevated TPO-Ab levels, combined with elevated TSH, can help identify early-stage hypothyroidism, with an annual risk of 3%–4% to develop hypothyroidism. In suspected hypothyroidism patients, elevated TPO-Ab levels are helpful in differentiating between primary and secondary hypothyroidism. In patients with HT, TPO-Ab persists throughout life. If clinical manifestations are typical and TPO-Ab levels remain consistently high, this can be used as a diagnostic criterion. Elevated TPO-Ab levels can also be seen in postpartum thyroiditis, atrophic thyroiditis, some cases of nodular goiter, and certain autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus. Pregnant women with elevated TPO-Ab levels are prone to hypothyroidism. Elevated TPO-Ab levels have been detected in some healthy individuals, especially the elderly, with a significantly higher positive rate in elderly women than in elderly men.

[0005] In summary, TPO-Ab is a major autoantibody in patients with autoimmune thyroid disease and is of great clinical significance. It is the gold standard for diagnosing chronic autoimmune thyroid disease. Furthermore, TPO-Ab can activate complement and is considered a major cause of thyroid dysfunction and hypothyroidism. In addition, the accuracy of TPO detection results largely depends on antibody performance; a highly reactive and stable antibody will help to accurately and rapidly detect TPO levels. Current monoclonal antibody preparation processes are cumbersome and time-consuming, resulting in low titers that do not meet clinical needs. Summary of the Invention

[0006] In view of this, the present invention provides anti-TPO monoclonal antibodies, their preparation methods, and applications. The present invention provides a human anti-TPO virus antibody obtained by screening using phage surface display technology, comprising a heavy chain and a light chain; the CDR1, CDR2, and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.71, SEQ ID NO.72, and SEQ ID NO.73, respectively; the CDR1, CDR2, and CDR3 of the light chain have the amino acid sequences shown in SEQ ID NO.74, SEQ ID NO.75, and SEQ ID NO.76, respectively. Among them, the fully human anti-TPO monoclonal antibodies TH507 and TH512, both with a purity >90%, transient expression levels of 150 mg / L and 120 mg / L, respectively, can specifically recognize the TPO recombinant antigen, can undergo a significant enzyme-linked immunosorbent assay (ELISA) reaction with the antigen, and their accelerated stability at 37°C meets the requirements for use in reagent kits. As quality control materials, they can play an important role in the detection of thyroid function TPO.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides a monoclonal antibody against TPO, comprising a heavy chain and a light chain; the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain are, in sequence, GXXFXXXDXX, XXXXXXXNXX, and XXXXXXXAXDI; the amino acid sequences of CDR1, CDR2, and CDR3 of the light chain are, in sequence, SGDXLPKQYAY, KDXERPS, and QSADXSGXXXV; wherein X is any one of the amino acids selected from G, A, V, L, I, F, W, Y, D, H, N, E, K, Q, M, R, S, T, C, P, U, and O.

[0009] In some specific embodiments of the present invention, the monoclonal antibody includes any of the following:

[0010] (I) The CDR1 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.1 or SEQ ID NO.17; and / or

[0011] The heavy chain's CDR2 has an amino acid sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 18; and / or

[0012] The heavy chain's CDR3 has an amino acid sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 19; and / or

[0013] (II) The CDR1 of the light chain has an amino acid sequence as shown in SEQ ID NO. 9 or SEQ ID NO. 25; and / or

[0014] The CDR2 of the light chain has an amino acid sequence as shown in SEQ ID NO. 10 or SEQ ID NO. 26; and / or

[0015] The CDR3 of the light chain has an amino acid sequence as shown in SEQ ID NO.11 or SEQ ID NO.27; or

[0016] (III) An amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence described in (I) or (II), and which has the same function as the amino acid sequence described in (I) or (II); or

[0017] (IV) An amino acid sequence that is more than 90% identical to the amino acid sequence described in any one of (I) to (III).

[0018] In some specific embodiments of the present invention, the monoclonal antibody includes any of the following:

[0019] (I) The CDR1, CDR2, and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; and

[0020] The light chain's CDR1, CDR2, and CDR3 sequentially have the amino acid sequences shown in SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11; or

[0021] (II) The CDR1, CDR2, and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19, respectively; and

[0022] The light chain's CDR1, CDR2, and CDR3 sequentially have the amino acid sequences shown in SEQ ID NO. 25, SEQ ID NO. 26, and SEQ ID NO. 27; or

[0023] (III) An amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence described in (I) or (II), and which has the same function as the amino acid sequence described in (I) or (II); or

[0024] (IV) An amino acid sequence that is more than 90% identical to the amino acid sequence described in any one of (I) to (III).

[0025] In some specific embodiments of the present invention, the monoclonal antibody includes any of the following:

[0026] (I) The FR1 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.4 or SEQ ID NO.20; and / or

[0027] The FR2 of the heavy chain has an amino acid sequence as shown in SEQ ID NO. 5 or SEQ ID NO. 21; and / or

[0028] The FR3 of the heavy chain has an amino acid sequence as shown in SEQ ID NO. 6 or SEQ ID NO. 22; and / or

[0029] The FR4 of the heavy chain has an amino acid sequence as shown in SEQ ID NO. 7 or SEQ ID NO. 23; and / or

[0030] (II) The FR1 of the light chain has an amino acid sequence as shown in SEQ ID NO.12 or SEQ ID NO.28; and / or

[0031] The FR2 of the light chain has an amino acid sequence as shown in SEQ ID NO.13 or SEQ ID NO.29; and / or

[0032] The FR3 of the light chain has an amino acid sequence as shown in SEQ ID NO.14 or SEQ ID NO.30; and / or

[0033] The FR4 of the light chain has an amino acid sequence as shown in SEQ ID NO.15 or SEQ ID NO.31; or

[0034] (III) An amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence described in (I) or (II), and which has the same function as the amino acid sequence described in (I) or (II); or

[0035] (IV) An amino acid sequence that is more than 90% identical to the amino acid sequence described in any one of (I) to (III).

[0036] In some specific embodiments of the present invention, the monoclonal antibody includes any of the following:

[0037] (I) The heavy chain FR1, FR2, FR3 and FR4 have the amino acid sequences shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively; and

[0038] The light chain FR1, FR2, FR3, and FR4 have amino acid sequences as shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, respectively; or

[0039] (II) The heavy chain FR1, FR2, FR3 and FR4 have the amino acid sequences shown in SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22 and SEQ ID NO.23, respectively; and

[0040] The light chain FR1, FR2, FR3, and FR4 have amino acid sequences as shown in SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30, and SEQ ID NO.31, respectively; or

[0041] (III) An amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence described in (I) or (II), and which has the same function as the amino acid sequence described in (I) or (II); or

[0042] (IV) An amino acid sequence that is more than 90% identical to the amino acid sequence described in any one of (I) to (III).

[0043] In some specific embodiments of the present invention, the variable region of the heavy chain has an amino acid sequence as shown in SEQ ID NO. 8 or SEQ ID NO. 24; the variable region of the light chain has an amino acid sequence as shown in SEQ ID NO. 16 or SEQ ID NO. 32.

[0044] In some specific embodiments of the present invention, the variable region of the heavy chain has an amino acid sequence as shown in SEQ ID NO. 8, and the variable region of the light chain has an amino acid sequence as shown in SEQ ID NO. 16; or

[0045] The variable region of the heavy chain has an amino acid sequence as shown in SEQ ID NO.24, and the variable region of the light chain has an amino acid sequence as shown in SEQ ID NO.32.

[0046] In some specific embodiments of the present invention, the monoclonal antibody is a humanized antibody.

[0047] In some specific embodiments of the present invention, the constant region of the heavy chain includes human IgG; the constant region of the light chain includes Kappa type or lamuda type.

[0048] The present invention also provides a nucleic acid molecule encoding the monoclonal antibody.

[0049] The present invention also provides an expression vector comprising the nucleic acid molecule.

[0050] In some specific embodiments of the present invention, the expression vector includes pTT5.

[0051] The present invention also provides a host, including the expression vector.

[0052] In some specific embodiments of the present invention, the host includes HEK 293F cells.

[0053] The present invention also provides a method for preparing the monoclonal antibody, comprising culturing the host, harvesting the supernatant, and separating and purifying the monoclonal antibody.

[0054] This invention also provides the application of any of the following in the preparation of products for detecting TPO:

[0055] (I) the monoclonal antibody; and / or

[0056] (II) the nucleic acid molecule; and / or

[0057] (III) the expression vector; and / or

[0058] (IV) The host; and / or

[0059] (V) Monoclonal antibodies prepared by the method described above.

[0060] This invention also provides the use of any of the following in the preparation of products for diagnosing, preventing, and / or treating thyroid dysfunction:

[0061] (I) the monoclonal antibody; and / or

[0062] (II) the nucleic acid molecule; and / or

[0063] (III) the expression vector; and / or

[0064] (IV) The host; and / or

[0065] (V) Monoclonal antibodies prepared by the method described above.

[0066] In some specific embodiments of the present invention, the product includes one or more of the following: blocking agents, quality control products, standards, reagent kits, antibody drugs, or drug combinations.

[0067] The present invention also provides a drug or combination of drugs, including any of the following:

[0068] (I) the monoclonal antibody; and / or

[0069] (IV) Monoclonal antibodies prepared by the method described above.

[0070] This invention also provides reagent combinations or kits, including any of the following:

[0071] (I) the monoclonal antibody; and / or

[0072] (IV) Monoclonal antibodies prepared by the method described above.

[0073] This invention includes, but is not limited to, the following beneficial effects:

[0074] This invention provides a human anti-TPO virus antibody obtained by screening using phage surface display technology. Among them, the anti-TPO fully human monoclonal antibodies TH507 and TH512 have a purity of >90% and transient expression levels of 150 mg / L and 120 mg / L, respectively. Both can specifically recognize the TPO recombinant antigen and can undergo a significant enzyme-linked immunosorbent assay (ELISA) reaction with the antigen. Moreover, their accelerated stability at 37°C meets the requirements for use in the kit. As a quality control material, they can play an important role in the detection of thyroid function TPO. Attached Figure Description

[0075] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0076] Figure 1 Agarose gel electrophoresis image of RNA extracted from peripheral blood lymphocytes;

[0077] Figure 2 Agarose gel electrophoresis images of PCR products of VL and VH genes;

[0078] Figure 3 Agarose gel electrophoresis image of PCR products of the scFv gene;

[0079] Figure 4 The following are SDS-PAGE and HPLC chromatograms; where A: TH507 non-reduced (1) and reduced bands (treated with reducing agent / DTT) (3); B: TH512 non-reduced (2) and reduced bands (treated with reducing agent / DTT) (4); C: SEC-HPLC chromatogram, where the blue peaks: the markers from left to right are 1340 kDa, 670 kDa, 300 kDa, 150 kDa, 45 kDa, and 17 kDa; the light green and red peaks: correspond to the HPLC peak chromatograms of TH507 and TH512, respectively. Detailed Implementation

[0080] This invention discloses anti-TPO monoclonal antibodies, their preparation methods, and applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0081] This invention provides a method for preparing a fully human monoclonal antibody against TPO. Using this monoclonal antibody as a quality control and calibrator, it exhibits a significant enzyme-linked immunosorbent assay (ELISA) reaction with TPO antigen, and its accelerated stability at 37°C meets the requirements for use in reagent kits. Furthermore, the preparation method is simple and suitable for mass production.

[0082] The present invention provides anti-TPO fully human IgG monoclonal antibodies TH507 and TH512, the amino acid sequences of their heavy chain variable regions are shown in SEQ ID NO.8 and SEQ ID NO.26, and the amino acid sequences of their light chain variable regions are shown in SEQ ID NO.17 and SEQ ID NO.35.

[0083] The anti-TPO fully human monoclonal antibody of the present invention further includes a heavy chain constant region and a light chain constant region, wherein the heavy chain constant region is of the human IgG subtype and the light chain constant region is of the Kappa type.

[0084] The present invention also provides a DNA molecule encoding the aforementioned anti-TPO fully human monoclonal antibody.

[0085] The present invention also provides an expression vector containing a DNA molecule encoding the aforementioned anti-TPO fully human monoclonal antibody.

[0086] In some specific embodiments, the backbone vector of the expression vector of the present invention is pTT5.

[0087] The present invention also provides a recombinant host containing the aforementioned expression vector. In some specific embodiments, the host cell is HEK 293F cell.

[0088] This invention also provides a method for preparing a fully human monoclonal antibody against TPO, comprising:

[0089] (1) Construct an expression vector containing the DNA molecule;

[0090] (2) Transform the expression vector described in step (1) into host cells;

[0091] (3) Culture the host cells obtained in step (2);

[0092] (4) The monoclonal antibody was obtained by separation and purification.

[0093] This invention also provides the application of the aforementioned anti-TPO fully human monoclonal antibody in in vitro diagnostic reagents.

[0094] The fully human monoclonal antibodies TH507 and TH512 against TPO provided by this invention have a purity of >90% and transient expression levels of 150 mg / L and 120 mg / L, respectively. TH507 has been identified as having a higher titer. This monoclonal antibody can be used as a positive control, and its titer and stability meet the requirements for use, providing a reliable basis for clinical diagnosis and treatment.

[0095] The specific sequence information of the anti-TPO fully human monoclonal antibody described in this invention is shown in Table 1.

[0096] Table 1 Sequence Information

[0097]

[0098]

[0099] Unless otherwise specified, the anti-TPO monoclonal antibody, its preparation method, and the raw materials and reagents used in its application provided by this invention are all commercially available.

[0100] The present invention will be further illustrated below with reference to the embodiments:

[0101] Example 1 Primer Synthesis and Gene Acquisition

[0102] Lymphocytes were isolated from anticoagulated blood of thyroid patients using human peripheral blood lymphocyte separation medium (Beijing Solarbio, P8610), and total cellular RNA was extracted using an RNA extraction kit (Sangon Biotech, B511311-0500). Figure 1 RNA extracted using Oligo-dT primers was transcribed into cDNA using a template. This cDNA was then used as a template to amplify the scFv heavy and light chain gene fragments. The primer sequences used are as follows:

[0103] The upstream primers for the heavy chain are as follows:

[0104] VHF1(SEQ ID NO.33):CAGGTBCAGCTGGTRCAGTC

[0105] VHF2(SEQ ID NO.34):CAGGTCAACTTAAGGGAGTCTGG

[0106] VHF3(SEQ ID NO.35):CAGGTGCAGCTGGTGGAGTCTGG

[0107] VHF4 (SEQ ID NO.36): CAGGTGCAGCTGCAGGAGTCGGG

[0108] VHF5 (SEQ ID NO.37): CAGGTGCAGCTGTTGCAGTCTGC

[0109] VHF6 (SEQ ID NO.38): CAGGTACAGCTGCAGCAGTCAGG

[0110] VHF7 (SEQ ID NO.39): CAGGTCCAGCTKGTGCARTC

[0111] VHF8 (SEQ ID NO.40): CAGGTCCAGCTGGTGCAGTC

[0112] VHF9 (SEQ ID NO.41): CAGGTACAGCTGGTGGAGTC

[0113] Heavy chain downstream primer:

[0114] VHR1 (SEQ ID NO.42): TGAGGAGACGGTGACCTTTG

[0115] VHR2 (SEQ ID NO.43): TGAGGAGACGGTGACCAGGG

[0116] VHR3 (SEQ ID NO.44): TGAAGAGACGGTGACCATTG

[0117] VHR4 (SEQ ID NO.45): TGAGGAGACGGTGACCGTGG

[0118] Light chain kappa subtype upstream primer:

[0119] Kappa1F (SEQ ID NO.46): GACATCCAGATGACCCAGTCTCC

[0120] Kappa2F (SEQ ID NO.47): GATGTTGTGATGACTCAGTCTCC

[0121] Kappa3F (SEQ ID NO.48): GAAATTGTGTTGACGCAGTCTCC

[0122] Kappa4F (SEQ ID NO.49): GACATCGTGATGACCCAGTCTCC

[0123] Kappa5F(SEQ ID NO.50):GAAACGACACTCACGCAGTCTCC

[0124] Kappa6F(SEQ ID NO.51):GAAATTGTGCTGACTCAGTCTCC

[0125] Light chain kappa subtype downstream primer

[0126] KappaR1 (SEQ ID NO.52):TTTGATATCCACTTTGGTCC

[0127] KappaR2 (SEQ ID NO.53):TTTGATCTCCACCTTGGTCC

[0128] KappaR3 (SEQ ID NO.54):TTTGATTTCCAGCTTGGTCC

[0129] KappaR4 (SEQ ID NO.55):TTTAATCTCCAGTCGTGTCC

[0130] Light chain lamuda subtype upstream primer

[0131] λ1F(SEQ ID NO.56):CAGTTCTGTGTTGACGCAGCCGCC

[0132] λ2F(SEQ ID NO.57):CAGTCTGCCCTGACTCAGCCTGC

[0133] λ3F(SEQ ID NO.58):TCCTATGTGCTGACTCAGCCACC

[0134] λ4F(SEQ ID NO.59):TCTTCTGAGCTGACTCAGGACCC

[0135] λ5F(SEQ ID NO.60):CACGTTATACTGACTCAACCGCC

[0136] λ6F(SEQ ID NO.61):CAGGCTGTGCTCACTCAGCCGTC

[0137] λ7F(SEQ ID NO.62):AATTTTATGCTGACTCAGCCCCA

[0138] Light chain lamuda subtype downstream primer

[0139] λ1R (SEQ ID NO.63): TAGGACGGTCAGCTTGGTCC

[0140] λ2R (SEQ ID NO.64):GAGGACGGTCAGCTGGGTGC

[0141] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and a final extension at 72℃ for 10 min. The light and heavy chain variable regions, purified by gel excision, were ligated into T vectors and sent for assay to obtain the light and heavy chain variable region sequences. Then, using the SfiI restriction site, the two were spliced ​​into the scFv gene fragment using OverLap PCR technology. The PCR products of the light chain, heavy chain, and scFv gene fragment were all detected by 1% agarose gel electrophoresis. Figure 2 and Figure 3 The results showed that the variable region size of the heavy and light chains was around 350 bp, and the size of the spliced ​​ScFV fragment was about 750 bp.

[0142] Example 2: Construction of ScFV phage library

[0143] The spliced ​​scFv gene fragment from Example 1 was ligated to the phage vector pComb3XSS (Fenghui Biotechnology, BR433) via the SfiⅠ restriction site. The ligation product was electroporated into E. coli TG1 competent cells, and 2YT-AG medium (2×YT medium containing 2% glucose and 100 μg / mL AMP) was added and cultured at 37°C with shaking for 1 h. 10 μL of bacterial culture was then inoculated into 2YT-AG medium and cultured overnight. Plaque formation was observed, and antibody library titers were calculated. 10–20 positive colonies were randomly selected and sent to Sangon Biotech for sequencing and colony PCR identification to analyze antibody library diversity. The remaining bacterial culture was added to helper phage-M13K07 (addgene, 37468), incubated at 37°C for 30 min, and then centrifuged to collect the bacterial cells. The cells were resuspended in 100 mL of 2YT medium (containing 1 μM IPTG and 100 μg / mL AMP) and cultured overnight at 30°C in a shaker. The supernatant was collected by centrifugation, and a quarter volume of 20% PEG / 2.5M NaCl was added. The cells were incubated on ice for 50 min to precipitate, and the precipitate was collected by centrifugation. The precipitate was resuspended in PBS to obtain the phage antibody library. The titer of the phage antibody library was calculated to be 1.28*10^9 PFU / mL using the following formula.

[0144] Antibody library titer (PFU / mL) = dilution × number of plaques (PFU) / volume of bacterial solution used for plating (mL).

[0145] Example 3: Enrichment and Screening of a Fully Human Anti-TPO Antigen Phage Antibody Library

[0146] The TPO recombinant antigen (NP_001193673.1) was coated onto the immunotubes at a concentration of 10 μg / mL and incubated overnight at 4°C. The tubes were then blocked with 5% skim milk at 37°C for 2 h. After washing twice with PBST, 1 mL of the ScFV phage library prepared in Example 2 was added. The tubes were incubated with shaking at room temperature for 2 h, washed 10 times with PBST, and 1 mL of triethylamine dissociation buffer (100 mM) was added. The tubes were incubated at room temperature for 10 min, neutralized with 1 M Tris-HCl (pH = 6.4), and 50 mL of E. coli TG1 bacterial culture in the logarithmic growth phase was added. The tubes were incubated at 37°C for 30 min, and 10 μL of the culture was spread onto 2YT-GA solid plates. The plates were incubated at 37°C overnight to detect the yield. The remaining bacterial culture was expanded until the bacterial culture A600 was about 0.5. Then helper phage M13K07 was added. The subsequent process was the same as in Example 2. The above screening process was repeated 4 times to enrich phages that bound to TPO recombinant antigen.

[0147] Example 4: Induction of expression of positive phage clones

[0148] Single colonies from the four rounds of enrichment in Example 3 were randomly selected and placed in 96-well plates, for a total of 6 plates. 400 μL of 2YT-GA medium (2% glucose, 50 μg / mL Amp) was added to each well, and the plates were incubated overnight at 37°C. The next day, 5 μL of the overnight culture was transferred to a 96-well plate containing 100 μL of 2YT liquid medium for activation. The plates were incubated at 37°C for 2–3 hours. When the OD value was approximately 2, 20 μL of a mixture of 2YT and helper phage (MOI = 5) was added to each well, and the plates were incubated at 37°C for 30 minutes. After 1.5 hours of shaking culture, 300 μL of 2YT-AK (100 μg / mL Amp, 50 μg / mL Kan) was added to each well. + Incubate overnight for 16–18 hours. The next day, centrifuge and collect the supernatant to obtain phage monoclonal samples for subsequent detection.

[0149] Example 5: Phage Monoclonal ELISA Detection

[0150] TPO recombinant antigen (coating amount 1ug / ml) was coated onto an ELISA plate and incubated overnight at 4°C. Casion blocking was performed at 37°C for 2 hours, followed by drying. Monoclonal phage was added, and the plate was incubated at 37°C for 30 minutes. After washing 6 times with PBST buffer, the plate was dried. HRP-M13 was added, and the plate was incubated at 37°C for 30 minutes. After washing 5 times with PBST buffer, the plate was dried and allowed to develop color for 15 minutes. The reaction was terminated by adding 2M H2SO4. The absorbance at 450 nm was measured using an ELISA reader. The results are shown below:

[0151] Table 2. TPO antibody concentration values ​​(μg / mL) detected by phage monoclonal ELISA.

[0152]

[0153]

[0154] Example 6: Nucleic acid sequence analysis of variable region genes and construction of full-length IgG antibody

[0155] Two highly reactive clones (TH507 and TH512) from Example 5 were sent for sequencing.

[0156] Antibody 1-TH507: Its heavy chain variable region has the amino acid sequence shown in SEQ ID NO.8; its light chain variable region has the amino acid sequence shown in SEQ ID NO.16.

[0157] Antibody 2-TH512: Its heavy chain variable region has the amino acid sequence shown in SEQ ID NO.24; its light chain variable region has the amino acid sequence shown in SEQ ID NO.32.

[0158] Using two selected positive monoclonal antibodies as templates, the variable region genes (VH / VL) were amplified separately using PCR technology and spliced ​​with the human constant region CH / CL to obtain the full-length antibody sequences. These sequences were then constructed into the laboratory vector pTT5 (Fenghui Biotechnology, BR135) using HindIII / XbaI. After the recombinant plasmids were transfected into competent DH5α cells, positive clones were selected for sequencing and plasmid extraction, yielding full-length TgG antibody plasmids for TH507 and TH512, respectively.

[0159] Example 7: Full-length IgG antibody expression

[0160] One day before transfection, adjust the HEK293F cell density to 2–2.5 × 10⁻⁶ cells. 6 On the day of transfection, cells were diluted to 3–3.5 × 10⁶ cells / mL using SMM293-TII medium. 6 cells / mL. Example 6: Obtaining full-length TgG antibody plasmids of TH507 and TH512. According to the PEI transfection reagent instructions (Polysciences, 24885-2), the antibody plasmid DNA and PEI were diluted and transfected into cells at a ratio of 1 μg: 5 μL. After 24 h, 24% CHO feed was added, and the cells were cultured until the cell viability dropped to about 70-75%. The supernatant was harvested to obtain full-length IgG antibody expression solutions of TH507 and TH512, respectively.

[0161] Example 8: Purification of Fully Human TPO Full-Length IgG Antibody

[0162] The supernatant harvested from the TPO TH507 and TH512 antibodies in Example 7 (i.e., the expression solution of full-length IgG antibodies of TH507 and TH512) was filtered through a 0.45 μm filter membrane to obtain the filtered antibody supernatant.

[0163] The chromatography column packed with Protein A packing material was equilibrated sequentially with ultrapure water and buffer (0.02M PBS, pH 7.4). The filtered antibody supernatant was loaded onto the column, equilibrated again, and finally eluted with dissociation buffer (0.2M glycine + 0.15M NaCl, pH 2.7). The dissociation peak was collected to obtain purified TPO TH507 and TH512 antibodies. Protein content was then detected using a NanoDrop One spectrophotometer, and protein expression levels were determined by SDS-PAGE and SEC-HPLC.

[0164] The results showed that the expression levels of TPO TH507 and TH512 antibodies after purification were 150 mg / L and 120 mg / L, respectively, as determined by SDS-PAGE and SEC-HPLC. Figure 4 The results showed that the antibody purity reached over 98% (around 150KD), with the heavy chain size around 50KD and the light chain size around 25KD, consistent with expectations. Figure 4 ).

[0165] Example 9: Titer Detection of Fully Human TPO Full-Length IgG Antibody

[0166] The purified TPO TH507 and TH512 antibodies from Example 8 were adjusted to a protein concentration of 5 mg / mL and tested using an anti-thyroid peroxidase antibody detection kit (Keluo (Wuhan) Biotechnology Co., Ltd., ELK9058) according to the instructions. Based on the kit's criteria, an activity value greater than 30 IU / mL was considered positive. The detection results of the TH507 IgG and TH512 IgG human antibodies prepared in this experiment are shown in Table 3. The average detection concentrations of TH507 IgG and TH512 IgG were 298,500 IU / mL and 234,667 IU / mL, respectively, indicating strong reactivity, both meeting the reactivity requirements for quality control products.

[0167] Table 3. Results of TH507 and TH512 IgG antibody reactivity assay

[0168]

[0169] Example 10 Antibody Stability Evaluation Detection

[0170] The purified TH507 and TH512 IgG antibodies from Example 8 were adjusted to three levels: low, medium, and high (target values ​​of 75±10, 180±10, and 300±10 IU / mL, respectively). After lyophilization, the titer changes after reconstitution and 37°C accelerated heating for 7 and 14 days were evaluated. The titer stability changes of both antibodies after lyophilization and reconstitution and 37°C accelerated heating for 7 and 14 days were both less than ±10%, meeting the performance requirements for quality control products. Furthermore, TH507 showed a smaller titer change after 37°C accelerated heating than TH512. Stability data are shown in Table 4.

[0171] Table 4. Results of TH507 and TH512 IgG antibody stability assay

[0172]

[0173] Example 11 Evaluation and detection of matrix effects between antibody batches and between reagent batches

[0174] The purified TH507 and TH512 IgG antibody titers from Example 8 were adjusted to the three levels required by the quality control standard: Q1, Q2, and Q3, with activity values ​​of 75±10, 180±10, and 300±10 IU / mL, respectively. The prepared quality control standards were tested on three different Antu A2000 plus instruments and different batches of Antu anti-thyroid peroxidase antibody detection kits to assess inter-instrument and batch-to-batch differences. A variation in the detected value within ±10% was considered acceptable for quality control. The data show that the inter-instrument and batch-to-batch differences for both TH507 and TH512 IgG antibodies were within 10%, meeting the performance requirements of the quality control standard (Tables 5 and 6).

[0175] Table 5. Results of inter-stage difference matrix effect detection for TH507 and TH512 IgG.

[0176]

[0177]

[0178] Table 6. Results of inter-batch matrix effect detection for TH507 and TH512 IgG reagents.

[0179]

[0180] Considering that TH507 IgG antibody has better reactivity and stability than TH512 IgG antibody, TH507 is preferred for use in kit quality control and calibrators.

[0181] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A monoclonal antibody against thyroid peroxidase, characterized in that, Including heavy chains and light chains; (I) The CDR1, CDR2, and CDR3 of the heavy chain are, in sequence, the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; and The CDR1, CDR2, and CDR3 of the light chain are, in sequence, the amino acid sequences shown in SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11; or (II) The CDR1, CDR2, and CDR3 of the heavy chain are, in sequence, the amino acid sequences shown in SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19; and The CDR1, CDR2, and CDR3 of the light chain are, respectively, the amino acid sequences shown in SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.

27.

2. A nucleic acid molecule encoding the monoclonal antibody as described in claim 1.

3. An expression vector, characterized in that, Includes the nucleic acid molecules as described in claim 2.

4. A host, characterized in that, Including the expression vector as described in claim 3.

5. The method for preparing the monoclonal antibody as described in claim 1, characterized in that, The host as described in claim 4 is cultured, the supernatant is harvested, and the monoclonal antibody is obtained by separation and purification.

6. Any of the following applications in the preparation of products for detecting thyroid peroxidase: (I) The monoclonal antibody as described in claim 1; and / or (II) The nucleic acid molecule as described in claim 2; and / or (III) The expression vector as described in claim 3; and / or (IV) The host as described in claim 4; and / or (V) The monoclonal antibody prepared by the method described in claim 5.

7. Any of the following can be used as a quality control material in the preparation of products for thyroid function diagnosis: (I) The monoclonal antibody as described in claim 1; and / or (II) The nucleic acid molecule as described in claim 2; and / or (III) The expression vector as described in claim 3; and / or (IV) The host as described in claim 4; and / or (V) The monoclonal antibody prepared by the method described in claim 5.

8. A reagent combination or kit, characterized in that Includes any of the following: (I) The monoclonal antibody as described in claim 1; and / or (IV) Monoclonal antibody prepared by the method described in claim 5.

Images