Construction method and application of visual mouse model for monitoring lung adenocarcinoma ferroptosis process in real time

Abstract

The invention relates to the technical field of lung adenocarcinoma ferroptosis visualization, in particular to a construction method and application of a visual mouse model for monitoring a lung adenocarcinoma ferroptosis process in real time. According to the application, a mouse model carrying exogenous Luciferase (LUC) and eGFP fragments is constructed, the change of a key marker of ferroptosis in lung adenocarcinoma cells is monitored in real time by using a living imaging technology, the dynamic change rule of a cell signal transduction network in the ferroptosis process is revealed, and the influence of different intervention measures on ferroptosis is evaluated. By utilizing the visual mouse model for monitoring the ferroptosis process of lung adenocarcinoma in real time, the sensitivity and resistance mechanism of lung adenocarcinoma cells to ferroptosis can be deeply explored, a theoretical basis and technical support are provided for developing a new therapy based on ferroptosis, and the influence of different drugs on ferroptosis can be evaluated; and a new thought is provided for treatment of lung adenocarcinoma.

Description

Technical Field

[0001] The present invention relates to the technical field of lung adenocarcinoma ferroptosis visualization, and in particular to a method for constructing and applying a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma. Background Art

[0002] Lung cancer is one of the leading causes of cancer death worldwide. Its main subtype is lung adenocarcinoma, and its morbidity and mortality rates remain high worldwide. Although modern medical technology has significantly improved the effectiveness of lung cancer treatment in the past decade, the five-year survival rate of patients with lung adenocarcinoma is still only between 10% and 20%. The high mortality rate of lung adenocarcinoma is related to multiple factors, and its pathogenesis is complex, involving multiple factors such as genetics and the environment. With the deepening of understanding of the biological behavior of lung adenocarcinoma, people have begun to realize that in addition to traditional chemotherapy, radiotherapy and surgical treatment, new therapeutic targets need to be found to improve efficacy.

[0003] In recent years, as the understanding of cell death forms continues to deepen, ferroptosis, as a new iron-dependent regulated cell death form, has attracted attention because of its association with the non-mutation mechanism of lung adenocarcinoma development. Ferroptosis was first defined by Dixon et al. in 2012 as a new type of cell death different from apoptosis and necrosis. The occurrence of ferroptosis is closely related to the increase of intracellular iron ion levels. Excessive iron ions will catalyze intracellular lipid peroxidation reactions, produce a large number of lipid reactive oxygen species (ROS), destroy the integrity of the cell membrane, and ultimately lead to cell death. In addition, ferroptosis is also closely related to the activity of glutathione peroxidase 4 (GPX4), an important antioxidant enzyme. The decrease in its activity will lead to the accumulation of lipid ROS, which in turn triggers ferroptosis. The unique metabolic characteristics and biochemical mechanisms of ferroptosis make it show great application potential in the field of tumor treatment. Enhanced cellular metabolic activity can induce tumor cells to produce more lipid peroxides. Therefore, the induction of ferroptosis in tumor cells, especially in lung adenocarcinoma, has become a new hot spot in tumor research. Therefore, ferroptosis may become a new treatment strategy, especially for patients who do not respond well to traditional treatments. However, to achieve this goal, we need to gain a deeper understanding of the specific mechanisms of ferroptosis in lung adenocarcinoma.

[0004] Although ferroptosis has shown great potential in the treatment of lung adenocarcinoma, its specific mechanism still needs to be further studied. Traditional ferroptosis research methods such as cell viability assays and flow cytometry can only provide static data, and it is difficult to monitor the dynamic changes in the ferroptosis process in real time. Therefore, it is particularly important to establish a model that can monitor the ferroptosis process in real time. Summary of the invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a method for constructing and applying a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma. The present invention uses a series of advanced molecular biology and biomedical technologies, including genetic engineering, cell culture, animal model construction, advanced fluorescent labeling technology, and in vivo imaging technology, to construct a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma, which can not only monitor the occurrence and development of ferroptosis in real time, but also evaluate the effects of different factors on ferroptosis, providing a powerful tool for the study of ferroptosis mechanisms and the development of new drugs.

[0006] The purpose of the present invention can be achieved by the following technical solutions:

[0007] The first object of the present invention is to provide a method for constructing a visual mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma, comprising the following steps:

[0008] (S1) Acsl4 (long-chain fatty acid coenzyme A ligase 4) IRES-LUC / + The mice were mated with wild-type mice to obtain positive heterozygous mice;

[0009] (S2) Hba1 (hemoglobin subunit α1) IRES-eGFP / + The mice were mated with the positive heterozygous mice prepared in step (S1) to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + Mouse: AH mouse;

[0010] (S3) Kras (Kirsten rat sarcoma viral oncogene homolog) LSL-G12D / + ;p53 LSL-R172H / + The mice were mated with the AH mice prepared in step (S2) to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL -R172H / + Mouse: AHKP mouse;

[0011] (S4) Crossbreeding lung-specific Sftpc-Cre mice (a transgenic mouse model with Cre recombinase inserted into the alveolar surfactant protein C gene locus) with the AHKP mice prepared in step (S3) to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / + ; Sftpc-Cre mice: AHKPC mice.

[0012] In one embodiment of the present invention, in step (S1), Acs14 IRES-LUC / +The fluorescent reporter gene-LUC was inserted into the 3' end of the stop codon of the Acsl4 gene in mice, and an IRES site was set at the 5' end of the fluorescent reporter group.

[0013] In one embodiment of the present invention, in step (S1), Acs14 IRES-LUC / + The mice were F0 generation Acsl4 IRES-LUC / + Mouse.

[0014] In one embodiment of the present invention, in step (S2), Hba1 IRES-eGFP / + The fluorescent reporter gene eGFP was inserted into the 3' end of the stop codon of the Hba1 gene in mice, and an IRES site was set at the 5' end of the fluorescent reporter group.

[0015] In one embodiment of the present invention, in step (S2), male Hba1 IRES-eGFP / + Mice were mated with female positive heterozygous mice.

[0016] In one embodiment of the present invention, the female heterozygous positive mouse is a 6-8 week old female heterozygous positive F1 mouse.

[0017] In one embodiment of the present invention, in step (S2), the AH mice are F1 generation AH mice of 6-8 weeks old.

[0018] In one embodiment of the present invention, AHKPC mice spontaneously develop lung adenocarcinoma under lung-specific Cre recombinase expression.

[0019] The second object of the present invention is to provide a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma and its application in the study of the ferroptosis mechanism of lung adenocarcinoma. The visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma is constructed by the above method.

[0020] The third object of the present invention is to provide a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma and its application in the development of new drugs for the treatment of lung adenocarcinoma. The visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma is constructed by the above method.

[0021] The present invention can reveal the mechanism of action of ferroptosis-related factors in ferroptosis of lung adenocarcinoma, and provide new ideas for the study of ferroptosis mechanism and the development of new drugs. At the same time, exploring more ferroptosis regulatory factors will not only help to understand the complexity of lung adenocarcinoma, but also provide more possibilities for tumor treatment and provide new ideas for personalized treatment of lung adenocarcinoma.

[0022] In the present invention, Acs14 IRES-LUC / +The mouse (referred to as "A mouse") refers to a transgenic mouse obtained by adding a fluorescent reporter group - LUC (Luciferase) to the 3' end of the termination codon of the mouse Acsl4 gene, and setting an IRES (Internal Ribosome Entry Site, which can be used to connect two genes so that they are independently translated on the same mRNA molecule) site before the 5' end of the fluorescent reporter gene.

[0023] Hba1 IRES-eGFP / + Mouse (abbreviated as "H mouse") refers to a transgenic mouse obtained by adding a luminescent reporter group - eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting an IRES site before the 5' end of the luminescent reporter gene.

[0024] Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + The mouse (abbreviated as "AH mouse") refers to a transgenic mouse obtained by adding a fluorescent reporter group -LUC (Luciferase) to the 3' end of the termination codon of the mouse Acsl4 gene, and setting an IRES site before the 5' end of the fluorescent reporter gene; adding a luminescent reporter group -eGFP to the 3' end of the termination codon of the mouse Hba1 gene, and setting an IRES site before the 5' end of the luminescent reporter gene.

[0025] Kras LSL-G12D / + ;p53 LSL-R172H / + The mouse (referred to as "KP mouse") refers to a mouse Kras gene in which a G12D point mutation is performed (the G12D point mutation refers to the replacement of glycine (Glycine, G) at the 12th amino acid position of the Kras gene by aspartic acid (Aspartic acid, D)), and LSL sequences (Lox-Stop-Lox sequence) are inserted at both ends of the gene); a mouse p53 gene in which a R172H point mutation is performed (the R172H point mutation refers to the replacement of arginine (Arginine, R) at the 172nd amino acid position of the p53 gene by histidine (Histidine, H)), and LSL sequences are inserted at both ends of the gene; the resulting transgenic mice.

[0026] Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / +The mouse (referred to as "AHKP mouse") refers to a transgenic mouse obtained by adding a fluorescent reporter group -LUC to the 3' end of the termination codon of the mouse Acsl4 gene, and setting an IRES site before the 5' end of the fluorescent reporter gene; adding a luminescent reporter group -eGFP to the 3' end of the termination codon of the mouse Hba1 gene, and setting an IRES site before the 5' end of the luminescent reporter gene; making a G12D point mutation in the mouse Kras gene, and inserting LSL at both ends of the gene; making a R172H point mutation in the mouse p53 gene, and inserting LSL sequences at both ends of the gene;

[0027] Lung-specific Sftpc-Cre mice refer to transgenic mice obtained by inserting Cre recombinase into the promoter region of the Sftpc gene (encoding surfactant protein C) to achieve specific expression of Cre recombinase in alveolar epithelial type II (ATII) cells.

[0028] Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / + ; Sftpc-Cre mice (abbreviated as "AHKPC mice") refer to transgenic mice obtained by adding a fluorescent reporter group -LUC to the 3' end of the termination codon of the mouse Acsl4 gene, and setting an IRES site before the 5' end of the fluorescent reporter gene; adding a fluorescent reporter group -eGFP to the 3' end of the termination codon of the mouse Hba1 gene, and setting an IRES site before the 5' end of the fluorescent reporter gene; performing a G12D point mutation on the mouse Kras gene, and inserting LSL at both ends of the gene; performing a R172H point mutation on the mouse p53 gene, and inserting LSL sequences at both ends of the gene; and inserting Cre recombinase into the promoter region of the mouse Sftpc gene.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention aims to reveal the mechanism of action of ferroptosis-related factors in ferroptosis of lung adenocarcinoma by constructing a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma, and to provide new ideas for the study of ferroptosis mechanisms and the development of new drugs. Subsequently, the visualization model can be further optimized to expand its application in other types of tumors, while exploring more ferroptosis regulatory factors, which will not only help to understand the complexity of lung adenocarcinoma, but also provide more possibilities for tumor treatment and provide new ideas for personalized treatment of lung adenocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1The results of the relationship between HBA1 / Hba1 and ACSL4 / Acsl4 gene expression and ferroptosis are shown in Figure 2. A: The expression of HBA1 / Hba1 and ACSL4 / Acsl4 mRNA in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells is positively correlated with the concentration of erastin; B: The expression of HBA1 / Hba1 and ACSL4 / Acsl4 mRNA in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells is positively correlated with the concentration of RSL3; C: The expression of Hba1 mRNA in mouse lung adenocarcinoma LLC cells is time-dependent on erastin; D: The expression of Acsl4 mRNA in mouse lung adenocarcinoma LLC cells is time-dependent on erastin; E: The expression of Hba1 mRNA in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3; F: The expression of Acsl4 mRNA in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3.

[0032] Figure 2 The results show the relationship between HBA1 / Hba1 and ACSL4 / Acsl4 promoter activity and ferroptosis regulation; A: HBA1 / Hba1 and ACSL4 / Acsl4 promoters are positively correlated with erastin concentration in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells; B: HBA1 / Hba1 and ACSL4 / Acsl4 promoter activities are positively correlated with RSL3 concentration in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells; C: Hba1 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on erastin; D: Acsl4 promoter activity in mouse lung adenocarcinoma LLC cells C is time-dependent on erastin; E: Hba1 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3; F: Acsl4 promoter activity in mouse lung adenocarcinoma LLC cells is time-dependent on RSL3.

[0033] Figure 3 Schematic diagram of the fluorescence and luminescence intensity of control mice and AH mice; AB: In vivo imaging of mice showing the Luciferase (LUC) fluorescence intensity (A) and GFP luminescence intensity (B) of control mice and AH mice; the left mouse is the control group, and the right mouse is Acsl4 with IRES-LUC IRES-LUC / + and IRES-eGFP Hba1 IRES-eGFP / + (AH) Mice.

[0034] Figure 4Schematic diagram of the results of the gross fluorescence and luminescence intensity of the lung tissues of the control group mice and AHKPC mice; A: Gross photography results of the lung tissues, the left side is the lung tissues of the control group mice, and the right side is the gross photography results of the AHKPC mice, scale: 1 cm; B: In vivo imaging of mice shows the fluorescence intensity of Luciferase (LUC) in the lung tissues of the control group mice and AHKPC mice; C: In vivo imaging of mice shows the GFP luminescence intensity in the lung tissues of the control group mice and AHKPC mice.

[0035] Figure 5 Schematic diagram of the fluorescence and luminescence intensity of AHKPC mice before and after ferroptosis induction; AB: In vivo imaging of mice shows the Luciferase (LUC) fluorescence intensity (A) and GFP luminescence intensity (B) of AHKPC mice before and after IKE treatment; the left side shows the fluorescence and luminescence of mice without IKE treatment, and the right side shows the fluorescence and luminescence of mice after IKE treatment.

[0036] Among them, *p<0.05, **p<0.01. DETAILED DESCRIPTION

[0037] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] In the following embodiments, the steps of in vivo imaging of mice and dissecting and sampling of mouse lung tissue are as follows:

[0039] (1) In vivo imaging of mice:

[0040] 1) Animal anesthesia: Place the mouse in an anesthesia induction box and use isoflurane for inhalation anesthesia, with an initial concentration of about 4% and a maintenance concentration of about 2%. Observe the mouse's respiratory rate to ensure that it reaches an appropriate level of anesthesia.

[0041] 2) Injection of imaging reagent: Give mice an appropriate amount of D-luciferin (150 mg / kg) by intraperitoneal injection. Wait for 10-15 minutes after injection to allow the substrate to fully diffuse and be absorbed by cells. For imaging preparation, carefully place the anesthetized mouse on the sample stage of the imaging system, taking care to keep it in a natural posture. Use a cover to cover the area that does not need to be imaged to reduce background noise.

[0042] 3) Imaging: Adjust instrument parameters, set appropriate exposure time and wavelength range to obtain clear luminescence / fluorescence images. Start collecting data and record the distribution of luminescence / fluorescence signals in the mouse.

[0043] 4) Post-experimental processing: After imaging, immediately move the mouse back to the cage and observe its recovery until it is fully awake. Clean the experimental table and disinfect all used instruments.

[0044] (2) Dissection and collection of mouse lung tissue

[0045] 1) Animal preparation: Select healthy mice and AHKPC mice of the same age and gender, fix the torso of the mouse by hand, and quickly and decisively stretch the neck of the mouse to achieve cervical dislocation. Make sure the operation is quick and forceful to ensure that the mouse loses consciousness immediately and avoids pain.

[0046] 2) Dissection: Clean the mouse chest and abdominal skin with alcohol cotton balls to reduce the risk of infection. Make a small incision on the midline of the mouse abdomen to expose the abdominal cavity. Use surgical scissors to carefully separate the abdominal muscles and expose the diaphragm. Carefully cut the diaphragm to open the chest cavity so that the heart and lung tissue on both sides can be seen.

[0047] 3) Sampling: Carefully separate the lung tissue with forceps and surgical scissors, taking care not to damage the lungs. Cut the trachea near the larynx to facilitate the removal of the lung tissue. Gently remove the lung tissue from the chest cavity and place it on a sterile dissection tray. Rinse the surface of the lung tissue with sterile saline to remove blood and other impurities.

[0048] 4) Fixation: Place the lung tissue in a fixative (4% paraformaldehyde) to ensure that the tissue is completely immersed for easy subsequent processing.

[0049] 5) Observation and record: Use the naked eye to observe and take photos to record the appearance characteristics, including color, texture, shape, etc.

[0050] 6) Post-experimental treatment: After ensuring that the mice have no signs of life, place the mouse carcasses in a special garbage bag and dispose of them in accordance with relevant regulations. Thoroughly clean the dissection area, disinfect all used instruments, and place discarded surgical materials and specimen bottles in designated trash cans.

[0051] In the following examples, unless otherwise specified, all reagents used are commercially available reagents, and all detection means and methods used are conventional detection means and methods in the art.

[0052] Example 1

[0053] This example provides preliminary research on ferroptosis level indicators: ACSL4 and HBA1 can be used as indicators reflecting ferroptosis level.

[0054] Long-chain fatty acid coenzyme A ligase 4 (ACSL4) is an important enzyme that plays a central role in fatty acid metabolism. It catalyzes the conversion of fatty acids into acyl-CoA, a step that is essential for the β-oxidation of fatty acids and the construction of biofilms. In particular, ACSL4 plays an irreplaceable role in the CoA synthesis of long-chain polyunsaturated fatty acids (LC-PUFA). Studies in recent years have shown that ACSL4 also plays an important role in ferroptosis. The expression level of ACSL4 is positively correlated with the sensitivity of cells to ferroptosis, so ACSL4 can be monitored as a potential ferroptosis marker. Another important gene is HBA1, which encodes the hemoglobin α chain. Although its main function is related to oxygen transport, it also shows a certain association in the study of ferroptosis. HBA1 is considered to be one of the important downstream targets of HIC1 (a known transcriptional repressor), which is activated under ferroptosis conditions and promotes the transcription of ferroptosis-related genes including HBA1. The expression level of HBA1 was also positively correlated with the progression of ferroptosis, which further supports the view that HBA1 may serve as a biomarker of ferroptosis.

[0055] To verify whether ACSL4 and HBA1 can be used as effective indicators of ferroptosis, the researchers conducted experiments to observe the expression changes of these genes in human lung adenocarcinoma H1299 and mouse lung adenocarcinoma LLC cells after treatment with ferroptosis inducers such as erastin (inducing ferroptosis by inhibiting System Xc-) and RSL3 (inducing ferroptosis by directly inhibiting glutathione peroxidase 4). The results showed that the expression of ACSL4 / ACSL4 and HBA1 / Hba1 mRNA showed concentration dependence on erastin and RSL3 treatment ( Figure 1 A-1B), this finding suggests that during ferroptosis, the expression levels of these two genes may be proportional to the degree of ferroptosis in the cell. In addition, in mouse lung adenocarcinoma LLC cells, the expression of Hba1 and Acsl4 mRNA also showed a time dependence on erastin and RSL3 treatment ( Figure 1 C-1F). This phenomenon suggests that in addition to the concentration effect, time factors may also affect the performance of these two genes as ferroptosis markers. These data together support the potential of ACSL4 and HBA1 as biomarkers in the ferroptosis process.

[0056] Therefore, based on the changes in the expression of ACSL4 / Acsl4 and HBA1 / Hba1 mRNA, we also explored the promoter activity of these genes in order to better understand their possible role in the ferroptosis process. The experimental results showed that in human lung adenocarcinoma H1299 cells and mouse lung adenocarcinoma LLC cells, as the concentration of ferroptosis inducers erastin and RSL3 increased, the promoter activity of ACSL4 / Acsl4 and HBA1 / Hba1 genes also increased ( Figure 2 A-2B). This finding provides molecular evidence that under ferroptosis conditions, the transcription initiation activity of these genes is enhanced, possibly because certain regulatory elements in the promoter region respond to changes in intracellular signaling pathways, leading to enhanced binding of transcription enhancers or transcription factors. In addition, for mouse lung adenocarcinoma LLC cells, the promoter activity of the Hba1 and Acsl4 genes also showed significant time dependence after exposure to erastin and RSL3 for different time periods ( Figure 2 C-2F). This means that as the cells are exposed to ferroptosis inducers for a longer period of time, the activity of the promoter regions of these genes gradually increases, which is consistent with the time-dependence of mRNA expression observed previously. These results suggest that, from the transcriptional level, the increase in the expression of ACSL4 / Acsl4 and HBA1 / Hba1 can reflect the occurrence and development of ferroptosis to a certain extent. Specifically, changes in promoter activity may reflect the early events of cellular response to ferroptosis inducers, while subsequent changes in mRNA expression levels represent the sustained effects of this response. Therefore, ACSL4 / Acsl4 and HBA1 / Hba1 are not only potential markers of ferroptosis, but may also be involved in the regulatory mechanism of ferroptosis.

[0057] Example 2

[0058] This embodiment provides a method for constructing a visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma.

[0059] (S1) Commissioned Shanghai Model Organisms to construct Acsl4 IRES-LUC / + Mouse (A mouse);

[0060] Among them, Acsl4 IRES-LUC / + The mouse (abbreviated as "A mouse") refers to a transgenic mouse obtained by adding a fluorescent reporter group -LUC to the 3' end of the stop codon of the mouse Acsl4 gene and setting an IRES site before the 5' end of the fluorescent reporter gene.

[0061] Commissioned Shanghai Model Organisms to construct Hba1 IRES-eGFP / + Mouse (H mouse);

[0062] Hba1 IRES-eGFP / +Mouse (abbreviated as "H mouse") refers to a transgenic mouse obtained by adding a luminescent reporter group - eGFP to the 3' end of the stop codon of the mouse Hba1 gene and setting an IRES site before the 5' end of the luminescent reporter gene.

[0063] Among them, A mice and H mice are both heterozygous, and the wild allele is retained while the exogenous reporter gene is inserted. In addition, the fluorescent insertion site is located at the 3' end of the stop codon of the Acsl4 and Hba1 genes, and an IRES site is set before the 5' end of the fluorescent reporter gene. The purpose of this design is that when the endogenous promoters of Acsl4 and Hba1 function normally, it will not affect the translation of Acsl4 and Hba1 mRNA, thereby minimizing the impact on the development and growth of mice and ferroptosis itself.

[0064] (S2) mating F0 generation A mice with wild-type mice to obtain positive heterozygous mice;

[0065] (S3) The H mice (male mice) from step (S1) were crossed with the positive heterozygous mice (female mice) from step (S2) to obtain mice carrying both Acsl4 IRES-LUC / + and Hba1 IRES-eGFP / + Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + Mice (AH mice) (6-8 week old F1 mice were used for subsequent experiments);

[0066] Among them, AH mice were observed using a mouse in vivo imaging device; in AH mice, significantly increased LUC fluorescence intensity and GFP luminescence intensity were observed compared with the control group (wild-type mice) ( Figure 3 A-3B), indicating that a bioluminescent / fluorescent dual-labeled whole-organ ferroptosis visualization model has been successfully constructed. This model allows researchers to monitor changes in ferroptosis-related biomarkers throughout an organ in real time.

[0067] (S4) The AH mice obtained in step (S3) were crossed with the Kras strain that had been stably established. LSL-G12D / + ;p53 LSL-R172H / + mice (KP mice, purchased from Jackson Laboratory, USA) were crossed to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL -R172H / + (AHKP) mice (commonly used due to the presence of the "Stop" sequence, Kras LSL-G12D and p53 LSL-R172H In the absence of Cre recombinase, effector proteins cannot be produced);

[0068] (S5) The AHKP mice obtained in step (S4) were hybridized with lung-specific Sftpc-Cre mice (transgenic mice obtained by inserting Cre recombinase into the mouse alveolar surfactant protein C locus; purchased from Shanghai Model Organisms Technology Co., Ltd.; catalog number NM-KI-18020) to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / + ; Sftpc-Cre mice (AHKPC mice).

[0069] Under lung-specific Cre recombinase expression, these mice can spontaneously develop lung adenocarcinoma. The researchers compared the lung tissues of the control group (wild-type mice) and AHKPC mice and found that the lungs of AHKPC mice had a harder texture, irregular borders, an uneven surface, and obvious nodules ( Figure 4 A), indicating that AHKPC mice had developed lung cancer ( Figure 4 A). In addition, the fluorescence intensity of Luciferase (LUC) and GFP in the lung tissue of AHKPC mice also increased significantly compared with the control group ( Figure 4 B-4C), further confirming the successful construction of the AHKPC model and its application value in the subsequent visual monitoring of ferroptosis levels.

[0070] To further verify the effectiveness of the constructed visualized mouse (AHKPC) model for real-time monitoring of ferroptosis in lung adenocarcinoma, the researchers treated mice with IKE, an in vivo ferroptosis-inducing drug, and observed the LUC fluorescence and GFP luminescence intensity through in vivo imaging. Compared with mice not treated with IKE, the LUC fluorescence and GFP luminescence intensity of AHKPC mice treated with IKE increased significantly ( Figure 5 A-5B). This indicates that the AHKPC model can indeed effectively monitor the occurrence level of ferroptosis and provide a powerful tool for studying the mechanism of ferroptosis and its application in tumor therapy.

[0071] The establishment of the AHKPC lung adenocarcinoma ferroptosis visualization mouse model not only has important scientific research value - by real-time monitoring of the dynamic changes of ferroptosis in lung adenocarcinoma, we can have a deeper understanding of the mechanism of ferroptosis and its role in the development of lung cancer, providing new targets for clinical treatment; but also has significant clinical transformation potential - using this model to screen ferroptosis-related drugs can accelerate the discovery of potential effective treatments and shorten the time period from basic research to clinical application. In addition, the present invention also embodies the advantages of multidisciplinary intersection, combining knowledge from fields such as molecular biology, genetics and imaging, and promoting interdisciplinary cooperation and development. By using the AHKPC mouse model constructed with CRISPR / Cas9 technology and ES cell targeting strategy, researchers can monitor the occurrence and development of ferroptosis in real time in a living state through bioluminescence and fluorescence imaging technology, which provides unprecedented opportunities for studying the role of ferroptosis in tumor progression.

[0072] It should be noted that, in the present invention, the nucleotide sequence of Acsl4 specifically refers to NCBI Reference Sequence: NM_019477.3;

[0073] The nucleotide sequence of Hba1 is specifically referenced from NCBI Reference Sequence: NM_008218.2;

[0074] The nucleotide sequence of p53 is specifically referenced from NCBI Reference Sequence: NM_011640.4;

[0075] The nucleotide sequence of Kras is specifically referenced from NCBI Reference Sequence: NM_001403240.1;

[0076] The nucleotide sequence of Sftpc is specifically referenced from NCBI Reference Sequence: NM_011359.2;

[0077] The nucleotide sequence of EGFP is shown in SEQ ID NO.1 (5'-3'):

[0078] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0079] The nucleotide sequence of LUC is shown as SEQ ID NO.2 (5'-3'):

[0080]

[0081] The nucleotide sequence of IRES is shown in SEQ ID NO.3 (5'-3'):

[0082] GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCCTGGCCCTGTCTTCTTGACGA GCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACA GGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGA AGGTACCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC

[0083] The nucleotide sequence of lox is shown in SEQ ID NO.4 (5'-3'):

[0084] ATAACTTCGTATAGCATACATTATACGAAGTTAT

[0085] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the explanation of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma, characterized in that: The following steps are involved: (S1)Acsl4 IRES-LUC / + The mice were mated with wild-type mice to obtain positive heterozygous mice; (S2) Hba1 IRES-eGFP / + The mice were mated with the positive heterozygous mice prepared in step (S1) to obtain Acsl4 IRES -LUC / + ;Hba1 IRES-eGFP / + Mouse: AH mouse; (S3) Kras LSL-G12D / + ;p53 LSL-R172H / + The mice were mated with the AH mice prepared in step (S2) to obtain Acsl4 IRES-LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / + Mouse: AHKP mouse; (S4) Mating lung-specific Sftpc-Cre mice with AHKP mice prepared in step (S3) to obtain Acsl4 IRES -LUC / + ;Hba1 IRES-eGFP / + ;Kras LSL-G12D / + ;p53 LSL-R172H / + ; Sftpc-Cre mice: AHKPC mice.

2. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: In step (S1), Acs14 IRES-LUC / + The fluorescent reporter gene-LUC was inserted into the 3' end of the stop codon of the Acsl4 gene in mice, and an IRES site was set at the 5' end of the fluorescent reporter group.

3. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: In step (S1), Acs14 IRES-LUC / + The mice were F0 generation Acsl4 IRES-LUC / + Mouse.

4. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: In step (S2), Hba1 IRES-eGFP / + The luminescent reporter gene-eGFP was inserted into the 3' end of the termination codon of the Hba1 gene in mice, and an IRES site was set at the 5' end of the luminescent reporter group.

5. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: In step (S2), male Hba1 IRES-eGFP / + Mice were mated with female positive heterozygous mice.

6. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 3, characterized in that: The female heterozygous positive mice are 6-8 weeks old F1 generation female heterozygous positive mice.

7. The method for constructing a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: In step (S2), the AH mice are F1 generation AH mice of 6-8 weeks old.

8. The method for constructing a visual decimal model for real-time monitoring of ferroptosis in lung adenocarcinoma according to claim 1, characterized in that: Under lung-specific Cre recombinase expression, AHKPC mice spontaneously develop lung adenocarcinoma.

9. Application of a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma in the study of ferroptosis mechanism in lung adenocarcinoma, characterized in that: The visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma is constructed by the method described in any one of claims 1 to 8.

10. Application of a visual mouse model for real-time monitoring of ferroptosis in lung adenocarcinoma in the development of new drugs for the treatment of lung adenocarcinoma, characterized in that: The visualized mouse model for real-time monitoring of the ferroptosis process of lung adenocarcinoma is constructed by the method described in any one of claims 1 to 8.

Images