Application of HrpW protein and its coding gene in regulating resistance to bacterial fruit blotch of melon

Abstract

The application discloses HrpW protein and application of a coding gene thereof in regulating resistance to bacterial fruit blotch of melons. The protein provided by the application is named as HrpW protein, which is a protein shown in positions 41-361 of SEQ ID NO:1. A nucleic acid molecule coding the HrpW protein also belongs to the protection scope of the application. The application also protects application of the HrpW protein or the nucleic acid molecule coding the HrpW protein in positively regulating disease resistance and / or antibiosis of plants. The application also protects application of HrpW protein related biological materials: application in preparing products for improving disease resistance and / or antibiosis of plants; application in plant breeding; application in preparing antibacterial agents. The application has important significance for realizing fruit blotch resistant plant breeding and improving broad-spectrum and persistent disease resistance of plants against fruit blotch.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of HrpW protein and its encoding gene in regulating resistance to bacterial fruit spot disease in cucurbits. Background Technology

[0002] Paracidovorax citrulli is the pathogen that causes bacterial fruit blotch (BFB) in cucurbitaceous crops. BFB is a serious, globally transmitted disease that causes significant economic losses worldwide.

[0003] Currently, the main methods for controlling bacterial fruit spot disease include plant quarantine, breeding disease-resistant varieties, and chemical control. Watermelon acidophilus is primarily transmitted through seed-borne transmission; therefore, strengthening seed-borne disease detection to prevent infected seeds from entering the market is crucial to avoiding large-scale outbreaks of BFB. Currently, breeding disease-resistant varieties is the most economical and effective method for controlling the pathogen; however, no effective resistant materials have yet been found for bacterial fruit spot disease in cucurbits. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the HrpW protein and its encoding gene in regulating resistance to bacterial fruit spot disease in cucurbits.

[0005] The protein provided by this invention is named HrpW protein, and is as follows (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6) or (a7) or (a8):

[0006] (a1) The protein represented by positions 41-361 in SEQ ID NO: 1;

[0007] (a2) The protein shown in SEQ ID NO: 1;

[0008] (a3) The protein shown in SEQ ID NO: 3;

[0009] (a4) A fusion protein having the protein described in (a1);

[0010] (a5) A protein related to plant disease resistance obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein described in (a1), (a2) or (a3);

[0011] (a6) is a protein that has more than 98% identity with the protein described in (a1), (a2), or (a3) ​​and is associated with plant disease resistance;

[0012] (a7) A protein related to plant antimicrobial activity obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein described in (a1), (a2) or (a3);

[0013] (a8) is a protein that shares more than 98% identity with the proteins described in (a1), (a2), or (a3) ​​and is associated with plant antimicrobial activity.

[0014] Specifically, the fusion protein described in (a4) may be a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1).

[0015] Specifically, the fusion protein described in (a4) may be a fusion protein obtained by linking a signal peptide to the N-terminus and / or C-terminus of the protein described in (a1).

[0016] Nucleic acid molecules encoding the HrpW protein are also within the scope of protection of this invention.

[0017] The nucleic acid molecule can be either a DNA molecule or an RNA molecule.

[0018] Specifically, the nucleic acid molecule is as follows (b1) or (b2) or (b3):

[0019] (b1) Nucleic acid molecules whose coding region is shown as positions 121-1083 in SEQ ID NO: 2;

[0020] (b2) A nucleic acid molecule that has more than 95% identity with (b1) and encodes the protein;

[0021] (b3) A nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under strict conditions and encodes the protein thereon.

[0022] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.

[0023] The nucleic acid molecule may be the HrpW gene.

[0024] Specifically, the HrpW gene can be a DNA molecule with a coding region as shown in positions 121-1083 of SEQ ID NO: 2.

[0025] Specifically, the HrpW gene can be a DNA molecule with a coding region as shown in SEQ ID NO: 2.

[0026] Specifically, the HrpW gene can be a DNA molecule with a coding region as shown in SEQ ID NO: 4.

[0027] Expression cassettes, recombinant vectors, recombinant microorganisms, or transgenic plant cells containing the aforementioned nucleic acid molecules are all within the scope of protection of this invention.

[0028] Specifically, the recombinant vector containing the nucleic acid molecule is obtained by replacing the DNA fragments containing the CmR gene and ccdB gene from attR1 to attR2 in the vector pCPP5371 with a DNA fragment containing a foreign DNA molecule (as shown in nucleotides 1-1083 of SEQ ID NO: 2). Specifically, the preparation method of the recombinant vector containing the nucleic acid molecule is as follows: using the double-stranded DNA molecule shown in SEQ ID NO: 2 as a template, PCR amplification is performed using a primer pair composed of HrpWattB1 and HrpWattB2 to obtain the PCR amplification product. The PCR amplification product is compared with Gateway. TM pDONR TM Vector 221 was subjected to BP recombination to obtain an intermediate vector. The intermediate vector was then subjected to LR recombination with vector pCPP5371 to obtain the recombinant plasmid pCPP5371-HrpW. Specifically, the recombinant vector containing the nucleic acid molecule is obtained by inserting the double-stranded DNA molecule represented by nucleotides 4-1083 in SEQ ID NO: 2 between the NdeI and XhoI restriction sites of the pET22b(+) vector.

[0029] Specifically, the recombinant microorganism containing the aforementioned nucleic acid molecule is a recombinant bacterium obtained by introducing a recombinant vector containing the aforementioned nucleic acid molecule into *Pseudomonas fluorescens* EtHAn. Specifically, the preparation method of the recombinant microorganism containing the aforementioned nucleic acid molecule is as follows: HrpW gene donor bacteria, pRK600 plasmid donor bacteria, and *Pseudomonas fluorescens* EtHAn are co-cultured to obtain recombinant *Pseudomonas fluorescens* containing the aforementioned nucleic acid molecule. The recombinant plasmid pCPP5371-HrpW gene is introduced into *Escherichia coli* DH5α competent cells to obtain recombinant *Escherichia coli*, which is the HrpW gene donor bacteria. The pRK600 plasmid is introduced into *Escherichia coli* DH5α competent cells to obtain recombinant *Escherichia coli*, which is the pRK600 plasmid donor bacteria. Specifically, the recombinant microorganism containing the aforementioned nucleic acid molecule is a recombinant bacterium obtained by introducing a recombinant vector containing the aforementioned nucleic acid molecule into *Escherichia coli* BL21.

[0030] This invention also protects the use of the HrpW protein or nucleic acid molecules encoding the HrpW protein in the positive regulation of disease resistance and / or antibacterial activity in plants.

[0031] Positive regulation means that as the content of HrpW protein increases, the plant's disease resistance and / or antibacterial activity also increase.

[0032] Positive regulation means that an increase in the content of nucleic acid molecules encoding HrpW proteins leads to increased disease resistance and / or antibacterial activity in plants.

[0033] The present invention also protects the application of biological materials, as follows (c1) or (c2) or (c3):

[0034] (c1) Application in the preparation of products for improving the disease resistance and / or antibacterial properties of plants;

[0035] (c2) Application in plant breeding; the goal of the plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0036] (c3) Application in the preparation of antibacterial agents.

[0037] The present invention also provides a product containing biological materials;

[0038] The functions of the product are as follows (d1) or (d2) or (d3):

[0039] (d1) Enhance the disease resistance and / or antibacterial properties of plants;

[0040] (d2) Plant breeding; the goal of the plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0041] (d3) Antibacterial agent.

[0042] The biological material described above may be HrpW protein, nucleic acid molecule encoding HrpW protein, expression cassette containing nucleic acid molecule encoding HrpW protein, recombinant vector containing nucleic acid molecule encoding HrpW protein, or recombinant microorganism containing nucleic acid molecule encoding HrpW protein.

[0043] This invention also provides a method for cultivating plants with enhanced disease resistance and / or antibacterial activity, comprising the following steps: introducing a nucleic acid molecule encoding an HrpW protein into a recipient plant to obtain a plant with enhanced disease resistance and / or antibacterial activity. Specifically, in the method, a recombinant vector containing the nucleic acid molecule or a recombinant microorganism containing the nucleic acid molecule is introduced into the recipient plant.

[0044] The present invention also provides a method for cultivating plants with enhanced disease resistance and / or antibacterial properties, comprising the following steps: increasing the content of HrpW protein in the plant to obtain plants with enhanced disease resistance and / or antibacterial properties.

[0045] This invention also protects the application of any of the methods described above in plant breeding. The goal of the plant breeding is to obtain plant germplasm with enhanced disease resistance and / or antibacterial properties.

[0046] Specifically, the disease resistance refers to resistance to fruit spot disease.

[0047] Specifically, the disease resistance refers to resistance to bacterial fruit spot disease.

[0048] Specifically, the bacterial fruit spot disease refers to bacterial fruit spot disease of cucurbits.

[0049] Specifically, the melons mentioned are watermelons and / or cantaloupes.

[0050] Specifically, the bacterial fruit spot disease is caused by *Ligustrum lucidum*.

[0051] Specifically, the antibacterial property refers to resistance to acid-eating bacteria.

[0052] Specifically, the antibacterial property refers to resistance to citrus acidophilus.

[0053] Specifically, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0054] Specifically, the plant in question belongs to the Cucurbitales order.

[0055] Specifically, the plant in question is a member of the Cucurbitaceae family.

[0056] Specifically, the plant in question is a member of the genus *Citrus*.

[0057] Specifically, the plant in question is a watermelon, such as the Jingxin No. 4 watermelon.

[0058] Pretreatment of plants (e.g., watermelon leaves) with the aforementioned biological material triggers an ETI response (ETI response: an immune response triggered by effector factors), thereby enhancing the plant's disease resistance.

[0059] This invention discovers that HrpW protein is a Harpin protein capable of stimulating plant immunity, enhancing plant resistance to and inhibiting bacterial fruit spot pathogens, thus providing a theoretical and practical basis for watermelon disease resistance research. This invention is of great significance for breeding plants resistant to fruit spot and improving the broad-spectrum and long-lasting resistance of plants to the disease. Attached Figure Description

[0060] Figure 1 For Gateway TM pDONR TM Vector map of vector 221.

[0061] Figure 2 The vector map is for the pCPP5371 vector.

[0062] Figure 3 The result is the result of the salicylic acid content detection in step two of Example 2.

[0063] Figure 4 This is the result of detecting the expression of salicylic acid-regulated genes in step two of Example 2.

[0064] Figure 5 The results of the disease resistance test are for Example 3.

[0065] Figure 6 The results of the disease resistance test are for Example 4. Detailed Implementation

[0066] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0067] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Unless otherwise specified, all quantitative experiments in the following examples were performed in triplicate, and the results were averaged. *E. coli* DH5α competent cells: Tolo Biotech. product, catalog number CC96102. TM pDONR TM 221 Vector: Invitrogen product. The protein that can stimulate plant immunity discovered in this invention is the HrpW protein, as shown in SEQ ID NO: 1. The gene encoding the HrpW protein is named the HrpW gene, and its open reading frame is shown in SEQ ID NO: 2. In SEQ ID NO: 1, amino acid residues 1-40 constitute the signal peptide. In SEQ ID NO: 2, nucleotides 1-120 encode the signal peptide.

[0068] The composition of each liter of liquid KB medium (pH 7.2) is: 20g peptone, 15mL glycerol, 1.5g K₂HPO₄, 1.5g MgSO₄·7H₂O, with the remainder being water. The only difference between the liquid and solid KB medium is the addition of 15g agar.

[0069] The vector pCPP5371 is described in the following literature: Supramolecular Structure and Functional Analysis of the Type III Secretion System in Pseudomonas fluorescens 2P24; Frontiers in Plant Science (www.frontiersin.org), January 2016, Volume 6, Article 1190; doi:10.3389 / fpls.2015.01190. The vector pCPP5371 contains a gentamicin resistance gene.

[0070] The fluorescens bacterium EtHAn (Pseudomonas fluorescens EtHAn) is described in the following literature: A Acterial Type Three Secretion-Based Delivery System for Functional Characterization of Sporisorium scitamineum Plant Immune Suppressing Effector Proteins; Molecular and Physiological Plant Pathology; DOI:10.1094 / PHYTO-08-21-0326-R.

[0071] The pRK600 plasmid is described in the following literature: Involvement of hrpX and hrpG in the Virulence of Acidovorax citrulli Strain Aac5, Causal Agent of Bacterial Fruit Blotch in Cucurbits; Frontiers in Microbiology, March 2018, Volume 9, Article 507; doi:10.3389 / fmicb.2018.00507.

[0072] The pBBR1MCS-2 plasmid is described in the following literature: Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes; Gene, 166(1995)175-176; DOI:10.1016 / 0378-1119(95)00584-1. The pBBR1MCS-2 plasmid contains a kanamycin resistance gene.

[0073] Example 1: Preparation of recombinant bacteria

[0074] I. Construction of recombinant plasmids

[0075] Using the double-stranded DNA molecule shown in SEQ ID NO: 2 as a template, PCR amplification was performed using a primer pair composed of HrpWattB1 and HrpWattB2 to obtain the PCR amplification product. The PCR amplification product was compared with Gateway. TM pDONR TM 221 vector (see vector map) Figure 1 BP recombination was performed to obtain the intermediate vector. The intermediate vector and the vector pCPP5371 (vector pattern shown in...) Figure 2 LR recombination was performed to obtain the recombinant plasmid pCPP5371-HrpW. Compared with the vector pCPP5371, the only difference of the recombinant plasmid pCPP5371-HrpW is that the DNA fragments containing the CmR gene and ccdB gene from attR1 to attR2 in the vector were replaced with a DNA fragment containing a foreign DNA molecule (as shown in nucleotides 1-1083 in SEQ ID NO: 2).

[0076] HrpWattB1:ggggacaagtttgtacaaaaaagcaggctATGCGACGCCGTGCATC;

[0077] HrpWattB2:ggggaccactttgtacaagaaagctgggtGACCGTCTGGATCGACTGGC.

[0078] II. Preparation of recombinant bacteria EtHAn-HrpW using triparental hybridization.

[0079] 1. The recombinant plasmid pCPP5371-HrpW was introduced into Escherichia coli DH5α competent cells to obtain recombinant E. coli, which is the HrpW gene donor. The pRK600 plasmid was introduced into E. coli DH5α competent cells to obtain recombinant E. coli, which is the pRK600 plasmid donor.

[0080] 2. The HrpW gene donor bacteria, pRK600 plasmid donor bacteria and fluorescent Pseudomonas EtHAn were mixed and inoculated into LB medium plates at pH 7.4 and co-cultured at 28°C for 8 hours. Then, the bacterial cells on the plates were collected with sterile water to obtain the bacterial solution.

[0081] 3. Inoculate the bacterial culture obtained in step 2 onto KB medium plates containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and incubate at 28°C for 48 h.

[0082] 4. After completing step 3, pick single clones from the plate for PCR identification. Select fluorescent Pseudomonas bacteria that are positive for PCR identification, which are the recombinant bacteria EtHAn-HrpW.

[0083] PCR identification method: Genomic DNA is extracted and PCR amplification is performed using primer pairs consisting of F1 (GGTGGAGGTGAACAAACCCA) and R1 (CGAAGCGGAAGAGGAAGGAT). If an amplification product of approximately 530 bp is obtained, the identification result is positive.

[0084] III. Preparation of recombinant bacteria EtHAn-EV.

[0085] By replacing the recombinant plasmid pCPP5371-HrpW with the vector pCPP5371 and following the procedure in step two, the recombinant bacteria EtHAn-EV was obtained.

[0086] Example 2: Functional Verification of HrpW Protein

[0087] I. Preparation of bacterial culture

[0088] The recombinant strain EtHAn-HrpW was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C with shaking at 200 rpm until OD. 600nm The value was 2.0, then 10 mmol / L MgCl2 aqueous solution was added until the bacterial concentration was 5 × 10⁻⁶. 8 cfu / mL is the bacterial culture EtHAn-HrpW.

[0089] The recombinant strain EtHAn-EV was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C with shaking at 200 rpm until OD. 600nmThe value was 2.0, then 10 mmol / L MgCl2 aqueous solution was added until the bacterial concentration was 5 × 10⁻⁶. 8 cfu / mL is the bacterial culture EtHAn-EV.

[0090] II. Functional Verification of HrpW Protein

[0091] Test bacterial suspension: bacterial suspension EtHAn-HrpW or bacterial suspension EtHAn-EV prepared in step one.

[0092] Jingxin No. 4 watermelons were cultured normally, and inoculated with the test bacterial solution 2-3 weeks after germination (at which time the plant had two cotyledons and some true leaves). Inoculation method: Inject the test bacterial solution into each cotyledon on both sides of the main vein, so that the leaf is filled with the test bacterial solution. Then continue normal culture.

[0093] 1. Detection of salicylic acid content

[0094] Timing began 48 hours after inoculation with the tested bacterial culture, and cotyledons were harvested. The salicylic acid content in the cotyledons was determined using the Shanghai Jianglai Biotechnology Plant Salicylic Acid Enzyme-Linked Immunosorbent Assay Kit (catalog number: JL13803), specifically the salicylic acid content in micrograms per gram of fresh cotyledon weight.

[0095] See results Figure 3 (Sample size N=9). Expression of the HrpW gene in watermelon significantly increased salicylic acid content.

[0096] 2. Detection of salicylic acid-regulated gene expression

[0097] Timing began 6 hours after inoculation with the tested bacterial culture; cotyledons were harvested afterward. Total RNA was extracted and reverse transcribed to obtain cDNA. Using the cDNA as a template, quantitative real-time PCR was performed. The relative expression level of the target gene was 2. -ΔΔCt The internal reference gene is the Wactin gene, and the primer pair used to amplify the internal reference gene consists of F2 (CCATGTATGTTGCCATCCAG) and R2 (GGATAGCATGGGGTAGAGCA). The target gene is the ClPR1 gene, and the primer pair used to amplify the target gene consists of F3 (TGTCGGCCCAACTGGTAATC) and R3 (AACCAGATCCAACACCCGTC).

[0098] See results Figure 4 (Sample size N=3). Expression of the HrpW gene in watermelon significantly enhanced the expression of the ClPR1 gene.

[0099] Example 3: Recombinant bacteria expressing HrpW protein enhance watermelon's resistance to bacterial fruit spot disease.

[0100] I. Preparation of Antibacterial Bacterial Solution

[0101] The recombinant strain EtHAn-HrpW was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C with shaking at 200 rpm until OD. 600nm The value was 2.0, and then 10 mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5 × 10⁻⁶. 6 A bacterial solution with cfu / mL is called bacterial solution EtHAn-HrpW.

[0102] The recombinant strain EtHAn-EV was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C with shaking at 200 rpm until OD. 600nm The value was 2.0, and then 10 mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5 × 10⁻⁶. 6 A bacterial culture with cfu / mL is called EtHAn-EV.

[0103] II. Preparation of pathogenic bacteria inoculum

[0104] The watermelon acidophilus AAC00-1, whose full name is Paracidovorax citrulli AAC00-1, has the NCBI number GCA_000015325.1 (RefSeq: GCF_000015325.1).

[0105] The pBBR1MCS-2 plasmid was introduced into *Acidophilus hygrophilus* AAC00-1 to obtain the recombinant bacterium AAC00-1-pBBR1MCS2. The recombinant bacterium AAC00-1-pBBR1MCS2 was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL kanamycin, and cultured at 28°C with shaking at 200 rpm until OD (dose expiratory volume). 600nm The value was 2.0, and then 10 mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 2 × 10⁻⁶. 8 A bacterial suspension with a concentration of cfu / mL is considered a pathogenic bacterial suspension.

[0106] III. Disease Resistance Testing

[0107] Test bacterial suspension: bacterial suspension EtHAn-HrpW or bacterial suspension EtHAn-EV prepared in step one.

[0108] Jingxin No. 4 watermelons were cultured normally. Two to three weeks after germination (when the plant had two cotyledons and some true leaves), the tested bacterial solution was inoculated, followed by the pathogenic bacterial solution 24 hours later. Then, normal culture continued.

[0109] Inoculation method of the test bacterial solution: Inject the test bacterial solution into each cotyledon on both sides of the main vein, so that the leaf is filled with the test bacterial solution.

[0110] Inoculation method for pathogenic bacteria solution: Spray the entire plant with 20 mL of pathogenic bacteria solution per plant.

[0111] Timing began from the start of inoculation with the pathogenic bacterial solution. Inoculated leaves were harvested and photographed 2 days and 4 days later. (Photos are available in the attached image.) Figure 5 The image on the right.

[0112] Timing began from the start of inoculation with the pathogenic bacterial suspension. Inoculated leaves were harvested 2 and 4 days later. Each leaf was sampled by punching holes with a 1 cm diameter circular punch, resulting in 1 cm diameter circular leaf samples, termed leaf discs. Six leaf discs were added to each 2 mL centrifuge tube, followed by 1 mL of deionized water. The leaves were then crushed and serially diluted 10-fold with sterile deionized water to obtain various dilutions. 10 μL of each dilution was inoculated onto KB agar plates containing 100 μg / mL ampicillin and 50 μg / mL kanamycin (six agar plates were used for each dilution as biological replicates). The plates were incubated at 28°C for 48 h, and the number of pathogenic bacterial colonies was counted. The CFU (cfu / fu) content of the pathogenic bacteria per square centimeter of leaf was calculated. Results are shown below. Figure 5 The left image (sample size N=6).

[0113] The results showed that the disease resistance of the group inoculated with EtHAn-EV was increased compared with that of the group inoculated with EtHAn-HrpW.

[0114] Example 4: HrpW protein enhances watermelon's resistance to bacterial fruit spot disease.

[0115] I. Preparation of HrpW protein

[0116] 1. The double-stranded DNA molecule represented by nucleotides 4-1083 of SEQ ID NO: 2 was inserted between the NdeI and XhoI restriction sites of the pET22b(+) vector to obtain a recombinant plasmid. The exogenously inserted DNA molecule and some nucleotides on the vector formed the fusion gene described in SEQ ID NO: 4, expressing the fusion protein shown in SEQ ID NO: 3.

[0117] 2. The recombinant plasmid obtained in step 1 was introduced into Escherichia coli BL21 competent cells to obtain recombinant bacteria.

[0118] 3. Inoculate the recombinant bacteria obtained in step 2 into liquid LB medium containing 100 μg / mL ampicillin, and incubate at 37℃ and 220 rpm until the bacterial concentration reaches (4-6) × 10⁻⁶. 8The concentration of the bacterial cells was 0.5 mM, and IPTG was added to make the concentration in the system 0.5 mM. The cells were then cultured at 28 °C and 220 rpm for 4-5 h with shaking. After that, the cells were centrifuged at 4 °C and 5000 g for 15 min and the bacterial pellet was collected.

[0119] 4. Resuspend the bacterial pellet obtained in step 3 with PBS buffer, then break the cells using an ultrasonic cell disruptor, and then centrifuge at 14500g for 20 minutes at 4°C and collect the supernatant.

[0120] 5. Take the supernatant obtained in step 4, use His-tag protein purification magnetic beads (Beaver, product number 70501-100) and follow the instructions to purify the target protein with the His6 tag. Then, use an ultrafiltration tube to replace the buffer system containing the protein with PBS buffer (pH 7.2), which is the HrpW protein solution.

[0121] II. Preparation of pathogenic bacteria inoculum

[0122] Same as step two in Example 3.

[0123] III. Disease Resistance Testing

[0124] Experimental group: Jingxin No. 4 watermelon was cultured normally. Two weeks after germination (when the plant has two cotyledons and some true leaves), the whole plant was sprayed with HrpW protein solution (when spraying, the protein concentration was adjusted to 100nM with PBS buffer, and the amount sprayed per plant was 20mL). Then, the plant was cultured at 28℃ for 24h in a humid environment. After that, the pathogenic bacteria solution was sprayed (the amount sprayed per plant was 20mL).

[0125] Control group: The HrpW protein solution was replaced with an equal volume of PBS buffer, and all other aspects were the same as the experimental group.

[0126] Five days after spraying the pathogenic bacteria solution, observe the disease and necrosis of true leaves and assign disease severity values. Then calculate and statistically analyze the disease index.

[0127] The criteria for assigning disease severity levels are shown in Table 1.

[0128] Table 1

[0129] 0 No disease 1 The percentage of diseased and necrotic parts covering ≤25% of the leaf area. 3 25% < Percentage of necrotic area to leaf area ≤ 50% 5 50% < Percentage of necrotic area to leaf area ≤ 75% 7 75% < percentage of necrotic area to leaf area ≤ 100% 9 Plant death

[0130] The Disease Index (DI) is calculated as follows:

[0131] DI = ∑(A×B)×100 / (∑C×9)

[0132] A: Disease grade, which is 0, 1, 3, 5, 7 or 9;

[0133] B: The number of true leaves of this plant at this disease level;

[0134] C: The total number of true leaves of the plant.

[0135] See example photos Figure 6 The right-hand image shows the results of the disease index statistics. Figure 6 The left image shows the average number of plants in each group (9 plants per group). Spraying with a low concentration of HrpW enhanced the disease resistance of watermelons.

[0136] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of HrpW protein in positively regulating disease resistance and / or antibacterial activity in plants; The HrpW protein is as follows (a1) or (a2) or (a3): (a1) The protein represented by positions 41-361 in SEQ ID NO: 1; (a2) The protein shown in SEQ ID NO: 1; (a3) The protein shown in SEQ ID NO: 3; In the application, the protein is sprayed as a protein solution onto the entire plant of a plant that has been germinating for 2 weeks. The protein concentration in the protein solution is 100 nM, and the spraying amount per plant is 20 mL. The disease resistance refers to resistance to bacterial fruit spot disease; the antibacterial property refers to resistance to watermelon acidophilus; and the plant is watermelon.

2. A method for cultivating plants with enhanced disease resistance and / or antibacterial properties, comprising the following steps: Introducing recombinant microorganisms containing nucleic acid molecules encoding HrpW protein into recipient plants yields plants with enhanced disease resistance and / or antibacterial activity. The HrpW protein is as follows (a1) or (a2) or (a3): (a1) The protein represented by positions 41-361 in SEQ ID NO: 1; (a2) The protein shown in SEQ ID NO: 1; (a3) The protein shown in SEQ ID NO: 3; The recombinant microorganism is a recombinant bacterium obtained by introducing a recombinant vector containing a nucleic acid molecule encoding the HrpW protein into *Pseudomonas fluorescens* EtHAn. The recombinant microorganisms were injected as a bacterial suspension into each cotyledon of a plant 2-3 weeks into germination, with injections made on either side of the main vein to fill the leaf with the suspension; the concentration of the recombinant bacteria in the suspension was 5 × 10⁻⁶. 6 cfu / mL; The disease resistance refers to resistance to bacterial fruit spot disease; the antibacterial property refers to resistance to watermelon acidophilus; and the plant is watermelon.

3. The method as described in claim 2, characterized in that: The coding region of the nucleic acid molecule encoding the HrpW protein is shown as positions 121-1083 in SEQ ID NO: 2.

Images