Preparation method of PSR.Syn.CD19.CD38 CAR-T cell as well as cell and application of PSR.Syn.CD19.CD38 CAR-T cell

Abstract

The invention provides a preparation method of a PSR.Syn.CD19. CD38 CAR-T cell as well as the cell and application of the PSR.Syn.CD19. CD38 CAR-T cell, the PSR.Syn.CD19. CD38 CAR-T cell is characterized in that after the CAR-T cell and a CD19 antigen positive tumor cell are co-incubated, effector molecule anti-CD38-CAR can be induced to express, and when the tumor cell simultaneously expresses CD19 and CD38 antigens, the CAR-T cell capable of recognizing and killing tumors can be identified. The CAR-T cell provided by the invention can efficiently and specifically kill tumor cells (CD19 + CD38 +), has a persistent killing effect, and has a safety switch capable of starting a killing function. Besides, the tumor can be specifically killed, the cell proliferation rate is high, the anti-tumor function can be improved through a large amount of secreted IL-2, IFN-gamma, TNF-alpha and Granzyme B, and the application safety of the cell is greatly improved.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and in particular to a preparation method of PSR.Syn.CD19.CD38 CAR-T cells, cells thereof and applications thereof. Background Art

[0002] CAR-T cell therapy is a therapy that transfers the coding gene of the specific antigen chimeric receptor CAR into T cells, and then re-injects the cells into the patient's body. The CAR expressed by the T cells recognizes the targeted antigens on the surface of tumor cells, activates the killing activity of T cells, and then releases perforin, granzyme, cytokines, etc. to exert tumor killing effects. CAR-T cells will directly exert anti-tumor killing effects without the need for major histocompatibility complex (MHC) recognition restrictions.

[0003] The side effects of CAR-T cell therapy include cytokine release syndrome, cytopenia, neurotoxic syndrome, graft-versus-host disease (GVHD), "On target off tumor" toxicity, etc. Among them, "On target off tumor" toxicity is related to the single mechanical killing recognition mode of CAR-T cells.

[0004] In 2016, Roybal et al. developed a new SynNotch system, which is an "AND GATE" circuit system and successfully applied it to CAR-T cell therapy. Mode of action of the SynNotch system: The corresponding two antigens must be expressed on the surface of tumor cells at the same time to activate the specific killing function of SynNotch CAR-T (Syn-CAR-T) cells. Therefore, Syn-CAR-T cells can achieve the goal of intelligently identifying and killing tumors, thereby improving the safety of CAR-T cell therapy. The SynNotch system only transforms and replaces the extracellular region, intracellular region, and downstream effector elements of the wild-type Notch receptor, retaining the core regulatory region of the Notch receptor. The extracellular region (input recognition signal) can be replaced with scFv molecules of homologous specific antibodies targeting various tumor cells (such as CD19-scFv), and the downstream effector elements (output transcription signals) can be replaced with antibody scFv molecules, cytokines, immune activation or inhibition molecules, fluorescent proteins, etc. The NICD required for transcriptional regulation is replaced with the artificial transcription factor Gal4-VP64, which is a new fusion protein obtained by combining two natural transcription factors. The working principle of the Gal4 / VP16-UAS expression system is that the DNA binding domain of Gal4 can specifically activate the transcription of the target gene after binding to the upstream activation sequence (UAS), and the herpes simplex virus VP16 protein can enhance gene transcription expression. This system has been widely used in the study of gene expression regulation.

[0005] SynNotch is a synthetic Notch receptor. The mouse Notch1 receptor is modified. The extracellular domain is replaced with a single-chain antibody (A antibody scfv (single-chain antibody)), and the intracellular domain is replaced with the transcriptional activation domain Gal4VP64, retaining only the transmembrane core domain (NC) that can be recognized and cleaved by proteases. The Notch receptor protein is composed of an extracellular region fragment (NECD), a transmembrane region fragment (TMD), and an intracellular region fragment (NICD). When the extracellular region receptor binds to the ligand, it changes conformation, exposes the cleavage site, is recognized by metalloproteinases and γ-secretase, and is cleaved. After cleavage, the intracellular region NICD is released. NICD can translocate to the nucleus through the nuclear localization signal NSL and play the role of a transcription factor, thereby activating downstream signaling pathways.

[0006] The response program of the SynNotch system represents a strategy for reconstructing T cell responses. Taking SynNotch CAR-T cells as an example, the surface of tumor cells needs to express two corresponding antigens at the same time to activate the specific killing function of CAR-T cells. Therefore, SynNotch CAR-T cells can achieve the goal of accurately identifying and killing tumors. However, the SynNotch system is relatively large. The system control elements include the Notch receptor core region, the intracellular transcription factor Gal4VP64, the UAS recognition sequence, and the internal promoter, which are about 2.5kb in total. The input signal molecules (such as CD19-scfv) and output signal molecules (such as BCMA-CAR) in the editable region of the system are about 2.5kb in total. The entire system occupies about 5kb and needs to be delivered through two lentiviral vector plasmids, namely a GAL4 induction vector and a UAS effector vector. Therefore, when transducing target cells, it is necessary not only to prepare two lentiviral vectors, but also to perform double virus transduction of target cells.

[0007] The SynNotch system also faces a problem. When the UAS effector vector is not activated, the effector molecule is not expressed, and the transduction efficiency cannot be detected by flow cytometry, unless a promoter is added to express a fluorescent protein signal alone for transduction efficiency detection. The use of lentiviral vectors for dual-virus transduction of T cells will cause a production problem, that is, the efficiency of preparing double-positive T cells is low, and flow sorting and enrichment are required to obtain T cells with a high double positive rate. In addition, due to the toxicity of VSV-G envelope protein and the use of third-generation self-inactivating lentiviral vectors for packaging, lentiviral vectors can only be transiently transfected and packaged, and cannot be prepared on a large scale. The packaging titer is low and enrichment and purification are required, which greatly limits the clinical application of Syn-CAR-T cell therapy. Due to the above reasons, the application of the SynNotch system in CAR-T cell therapy is greatly limited, and further receptor system optimization or vector optimization is needed.

[0008] The problem of low preparation efficiency faced by delivering the SynNotch system through lentiviral vectors can be solved by replacing the viral vector for packaging. Currently, commonly used viral vectors include γ-retroviral vectors (γ-RV). γ-RV is a simple retrovirus with a diameter of about 100nm and an envelope. The genome is 2 copies of positive-strand RNA. The genome size is about 8.3kb, and the genome only includes 2 LTRs, Gag-Pol, and Env. γ-RV can only transduce dividing cells, but not non-dividing cells. It can integrate the host genome and has a high packaging titer. Inserting an exogenous target gene larger than 4kb will greatly reduce the vector packaging titer. In order to further improve the safety of γ-RV and reduce the generation of replicative RCR, the U3 promoter of the 3'LTR of γ-RV was deleted to transform it into a self-inactivating γ-retroviral vector (SIN-RV).

[0009] The γ-RV vector has a mature large-scale stable transfection packaging method and high production titer, but the retroviral vector is randomly integrated into the host chromatin, and there is a risk of insertion mutation inducing host proto-oncogene expression. The U3 enhancer of SIN-RV is deleted, which reduces the risk of carcinogenesis and greatly improves the safety of the vector. The challenge facing SIN-RV is the difficulty in large-scale production of viral vectors. Due to the lack of U3 elements, it is impossible to construct a stable transfection packaging cell line. It can only be obtained through transient transfection packaging, which is difficult to expand production, and it is difficult to screen out cell clones that produce SIN-RV stable transfection using traditional methods. Summary of the invention

[0010] In order to solve the above problems, the present invention provides a method for preparing PSR.Syn.CD19.CD38 CAR-T cells, wherein the PSR.Syn.CD19.CD38 CAR-T cells refer to CAR-T cells that will induce expression of effector molecules anti-CD38-CAR after being co-incubated with CD19 antigen-positive tumor cells, and will recognize tumor-killing CAR-T cells only when the tumor cells express CD19 and CD38 antigens at the same time; the method comprises: step 1: using the PiggyBac transposon system to construct a stably transfected SIN-γ-RV vector, i.e., a PSR vector; step 2: using the PSR vector prepared in step 1 to express the SynNotch system, merging the GAL4 induction vector and the UAS effector vector of the SynNotch system on one of the PSR vectors, so that the SynNotch system is delivered by one of the PSR vectors; constructing PSR.Syn.CD19.CD38 The plasmid of the CAR-T retroviral vector, i.e., the PSR.SynNotch vector targeting CD19 and BCMA, a plasmid vector with CD19 as an induction target and CD38 as an effector target; and step 3: transducing the plasmid of the above retroviral vector into T cells to prepare the PSR.Syn.CD19.BCMACAR-T cells.

[0011] The PiggyBac transposon (PB) system is a DNA transposon that can integrate the target gene between ITRs into the target cell genome and express it stably for a long time through a "cut-and-paste" mechanism. In the PB system, the ends of the PB transposon are 13bp inverted repeat sequences (ITRs), and the PB transposase is expressed by a separate plasmid. PB integration mechanism: After double plasmid transfection, the PB transposase recognizes the ITRs at both ends of the vector, cuts off from both ends of the ITR to become a free PB transposon (carrying the target gene), the genomic TTAA site is cut to form a sticky end, and the PB transposon is inserted into the "TTAA" site of the genome for integration.

[0012] In one embodiment, in step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element which is a viral vector packaging signal and a SD which is a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region.

[0013] In one embodiment, the 5'UTR deletes all Gag and Pol coding region sequences and the start codon ATG.

[0014] In one embodiment, when constructing the PSR.Syn.CD19.BCMA plasmid, the effector receptor UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, induced receptor anti-CD19 scfv-Notch-Gal4VP64, WPRE element are respectively inserted between the 5'LTR and the 3'SIN-LTR, and the induced receptor is expressed by the SFFV promoter.

[0015] In one embodiment, when constructing the plasmid of the PSR.Syn.CD19.CD38 retroviral vector, two molecular tags CopGFP P2A Puro for screening monoclonal cells are inserted between the 3'SIN-LTR and 3'TIR transposon, that is, CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, connected by P2A.

[0016] In one embodiment, the molecular tag is expressed by the composite promoter hEF1α-HTLV.

[0017] In one embodiment, the present invention provides a PSR.Syn.CD19.CD38CAR-T cell constructed by the above method.

[0018] In one embodiment, the present invention provides the use of the above-mentioned PSR.Syn.CD19.CD38 CAR-T cells in the preparation of tumor drugs.

[0019] In one embodiment, the present invention provides a pharmaceutical composition for treating tumors, which contains the above-mentioned CAR-T cells and a pharmaceutically acceptable carrier, diluent or excipient.

[0020] In one embodiment, the present invention provides a method for inhibiting tumor cells in vitro, comprising contacting tumor cells with the above-mentioned CAR-T cells or the above-mentioned pharmaceutical composition, thereby inhibiting the tumor cells.

[0021] The PiggyBac transposon (PB) system belongs to DNA transposons, and the target gene between ITRs can be integrated into the target cell genome and expressed stably for a long time through a "cut-and-paste" mechanism. The present invention combines the PiggyBac transposon system and SIN-RV to construct a vector (PSR) for stable transfection of SIN-RV. In order to facilitate the rapid screening of cell clones stably transfected with SIN-RV, fluorescent protein CopGFP and puromycin drug screening genes are inserted during vector design. In theory, the new PSR vector packaging element designed by the present invention is only 1.1kb, while the classic MFG vector packaging element is 2.6kb, which greatly improves the vector packaging capacity, and the CopGFP and puromycin drug screening genes on the PSR vector greatly improve the screening efficiency of cell clones stably transfected with SIN-RV.

[0022] The present invention utilizes a PSR vector to express the SynNotch system, and combines a GAL4 inducible vector and a UAS effector vector on a PSR vector (single vector system). Only one PSR.SynNotch vector needs to be constructed for viral packaging, and a single viral vector is used to transduce target cells. When the UAS effector element is not activated and not expressed, the transduction efficiency can be detected by using the label of the GAL4 inducible element. The PSR.SynNotch system of the present invention not only solves the problem that the transduction efficiency of the downstream effector molecules of the dual vectors of the original system is difficult to detect, but also solves the problem that the efficiency of preparing double positive cells by dual vector transduction of target cells is low. Most importantly, a stable transfection packaging cell line can be constructed for expanded production, which is very beneficial to the application of the SynNotch system.

[0023] In order to further verify the induction efficiency of the SynNotch system in the PSR.Syn vector, the present invention selected four tumor antigens (human BCMA antigen, human CD38 antigen, human CD19 antigen, and human GPC3 antigen) as targets, and constructed PSR.SynCAR vectors respectively. In order to facilitate the detection of the induction efficiency of the SynNotch system, the UAS downstream effector molecule will select the fluorescent protein tagBFP. After co-culture with the corresponding tumor cells, the SynNotch receptor activation efficiency in the PSR.Syn vector can be evaluated by detecting the expression efficiency of tagBFP, and the target with the best induction efficiency can be screened out. The results showed that the induction efficiency of targets BCMA, CD38, and GPC3 was extremely low and they were not suitable for the SynNotch system; the target CD19 had the highest induction efficiency and was most suitable for the SynNotch system because CD19-Syn-CAR-T cells recognized CD19 antigen-positive tumor cells, exposed restriction sites, and cleaved and released the artificial transcription factor Gal4-VP64. Gal4-VP64 entered the cell nucleus through the nuclear localization signal NSL and bound to the upstream activation sequence UAS to activate the expression of downstream effector molecules.

[0024] On this basis, the present invention designs a PSR.SynNotch vector targeting CD19 antigen and CD38 antigen, with CD19 as an induction target and CD38 as an effector target. The successfully prepared cells of the present invention were co-incubated with 5 tumor cells (2 single positive and 3 double positive tumor cells) to detect the induction effect. The experimental results show that the cells of the present invention have a strong intelligent specific induction expression function (induction efficiency is greater than 70%), and the background leakage expression is low (about 0). After successfully verifying that the cells of the present invention have a strong induction expression ability, the anti-tumor function verification was started. The killing effect of the cells of the present invention on tumor cells was studied by the luciferase method, with 6 target cells. The experimental results show that under different effect-target ratios, the cells of the present invention have a specific killing function for double positive tumor cells (CD19+CD38+), and have no specific killing effect on single positive tumor cells (CD19+ or CD38+), indicating that the cells of the present invention can efficiently and specifically kill double positive tumor cells (CD19+CD38+), and have a safety switch to start the killing function. Through the study of Incucyte real-time cell dynamic monitoring system, the experimental results show that the killing efficiency of the cells of the present invention on RPMI-CD19 cells (double positive) and Raji-Lu tumor cells (double positive) is higher than that of the PAN-T group after 72h of co-incubation monitoring. The results show that the cells of the present invention have a persistent killing effect on both RPMI-CD19 tumor cells and Raji-Lu tumor cells. The cytokine content in the cell culture supernatant of the present invention was quantitatively detected by CBA method. The experimental results show that the levels of IL-2, IFN-γ, TNF-α, IL-4, IL-10, and Granzyme B secreted by the present group and CAR21-T group are significantly higher than those of the PAN-T group, with statistical differences. The experimental results further show that the cells of the present invention have powerful anti-tumor function (CD19+CD38+), and the induction recognition and re-killing mode can play an effective anti-tumor function. CD69 is a signal protein for early activation of T cells. By detecting the expression efficiency of CD69 on the surface of T cells, the activation differences after incubation of the cells of the present invention and different tumor cells are compared. The experimental results showed that the CD69 expression efficiency (83.9%) of the experimental group of cells of the present invention after co-incubation with CD19-positive tumors (RPMI-CD19) was similar to that of the positive control group CAR21-T group (90.1%), and 54.9% higher than that of no incubation (29.0%). After co-incubation with CD19 antigen-negative tumors (RPMI), the CD69 efficiency expression was low (46.0%), which was similar to that of the PAN-T group (34.1%), indicating that the activation of the cells of the present invention is regulated by the SynNotch system, and can only be activated by co-incubation with CD19 and CD38 double-positive tumor cells, which is consistent with the regulation theory of the SynNotch system.The experiment detected the proliferation ability of T cells by the CFSE method. The experimental results showed that after CFSE staining, when the three groups of T cells were not co-incubated with tumor cells, the cell proliferation efficiency was high after 48 hours of culture, and there was no significant difference in the three groups of T cells. After incubation and culture with RPMI-CD19 cells for 48 hours, the proliferation efficiency of the present invention and CAR21-T cells was higher than that of PAN-T cells. The results show that the cell proliferation rate of the present invention under tumor cell stimulation is higher than that of PAN-T cells. In summary, the experimental results show that the cells of the present invention can efficiently and specifically kill tumor cells (CD19+CD38+), have a persistent killing effect, and have a safety switch to start the killing function. In addition, in addition to being able to specifically kill tumors, the cell proliferation rate of the present invention is high, and the proliferation rate under tumor cell stimulation is higher than that of the PAN-T group. When the cells of the present invention specifically kill tumors, a large amount of IL-2, IFN-γ, TNF-α, and Granzyme B secreted can improve the anti-tumor function, which greatly improves the safety of the application of the cells of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 It is a schematic diagram of the design of the vector PSR vector plasmid of the present invention;

[0027] Figure 2 It is a schematic diagram of the design of the PSR.Syn.BFP plasmid of the present invention;

[0028] Figure 3 This is a graph showing the transduction efficiency of Syn-CAR-T flow cytometry of the present invention;

[0029] Figure 4 This is a flow cytometry result diagram of the induction efficiency after incubation of Syn-CAR-T cells and tumor cells;

[0030] Figure 5 It is a schematic diagram of the design of the PSR.Syn.CD19.CD38 plasmid of the present invention;

[0031] Figure 6 This is a diagram showing the gel electrophoresis identification results of the PCR amplification product in the construction of the vector Syn-CAR188 of the present invention;

[0032] Figure 77A: The three groups of T cells were co-incubated with K562-CD19-CD38 (double positive) for 12 h; 7B: co-incubated with K562-CD38 (single positive) for 15 h; 7C: co-incubated with RPMI-CD19 (double positive) for 12 h; 7D: co-incubated with RPMI (single positive) for 8 h; 7E: co-incubated with Raji-Lu (double positive) for 12 h; 7F: co-incubated with K562-CD19-BCMA (single positive) for 15 h;

[0033] Figure 8 The figure is a graph of the persistent killing effect of Syn-CAR188-T on different target cells detected by the Incucyte method (n=3), wherein 8A: 3 groups of T cells were co-cultured with RPMI-CD19, and the effector-target ratio was 1:2; 8B: 3 groups of T cells were co-cultured with Raji-Lu cells, and the effector-target ratio was 1:1;

[0034] Fig. 9 Flow cytometry detection of CD69 expression in Syn-CAR188-T cells (n=3), wherein 9A: PAN-T cells were not incubated; 9B: PAN-T cells were co-incubated with RPMI-CD19; 9C: PAN-T cells were co-incubated with RPMI; 9D: CAR21-T cells were not incubated; 9E: CAR21-T cells were co-incubated with RPMI-CD19; 9F: CAR21-T cells were co-incubated with RPMI; 9G: Syn-CAR188-T cells were not incubated; 9H: Syn-CAR188-T cells were co-incubated with RPMI-CD19; 9I: Syn-CAR188-T cells were co-incubated with RPMI. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of this application.

[0036] DH5α competent cells were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. PB transposon plasmids and PB transposase plasmids were purchased commercially. Plasmids pCDH-CMV-TNFRSF17 (human), pHR_PGK_antiCD19_synNotch_Gal4VP64, pHR_Gal4UAS_tBFP_PGK_mCherry, pCDH-CMV-TNFRSF17 (human)-EF1a-CopGFP-T2A-Puro were purchased from Wuhan Miaoling Biotechnology Co., Ltd. Other genes EGFP, WPRE, SFFV are from commercial plasmids. Pheonix-Ampho cells and PG13 cells were purchased from the American Type Culture Collection (ATCC). 293T cells were purchased from the Cell Resource Center of Peking Union Medical College, Institute of Basic Medicine, Chinese Academy of Medical Sciences.

[0037] Pyrobest DNA polymerase, TAKARA BIO, Japan; plasmid purification kit, QIAGEN, Germany; 50×TAE gel electrophoresis buffer; ethidium bromide (EB) nucleic acid staining solution, Beijing Solebow Technology Co., Ltd.; 6×DNA loading buffer, TAKARA; sodium chloride, agarose, yeast powder, tryptone, agar powder, dimethyl sulfoxide (DMSO solution), Sigma, USA; anhydrous ethanol, Beijing Chemical Industry Group Co., Ltd.; PCR product purification kit, Nanjing Novozyme Biotechnology Co., Ltd.; DNA Assembly Mix Plus, puromycin hydrochloride, Beijing Rambolide Trading Co., Ltd.; endotoxin-free midi-plasmid extraction kit, Beijing Tiangen Biochemical Technology Co., Ltd.; ampicillin powder, BioRuler, USA. DMEM medium, Opti-MEM medium, fetal bovine serum (FBS), trypsin (1×EDTA), phosphate buffered saline (1×PBS), 100× penicillin-streptomycin solution (P / S), Gibco, USA; FuGene HD transfection reagent, Promega, USA; Retronectin (recombinant human nexin fragment), Takara, Japan; Trypan blue solution, Invitrogen, USA. Polybrene virus infection enhancement reagent, from Beijing Solaibao Technology Co., Ltd. If not otherwise specified, the reagents and raw materials used in the present invention are all from commercial reagents.

[0038] Example 1 Construction of PSR.SynNotch vector and preparation of Syn-CAR-T cells targeting different antigens

[0039] 1. Construction of PSR vector

[0040] The present invention utilizes the PB transposon system (PB transposon plasmid and PB transposase plasmid) to construct a stably transfected SIN-γ-RV vector (PSR), which can stably produce self-inactivating retroviral vectors. The specific design pattern is shown in FIG. Figure 1 As shown. The 5'LTR, non-coding region UTR (Ψ element is the viral vector packaging signal, SD is the splicing donor site), and 3'SIN-LTR sequence of the SIN-γ-RV vector are inserted between the 5'ITR and 3'ITR sequences of the PB transposon. According to SCHAMBACH A, MUELLER D, GALLAM, et al. Overcoming promoter competition in packaging cells improves production of self-inactivating retroviral vectors [J]. Gene Therapy, 2006, 13 (21): 1524-33, the SIN-γ-RV vector was designed based on pSRS11.SF.GFP. SFFV is the internal promoter of the PSR vector. To facilitate the insertion of the target gene at a later stage, a multiple cloning site sequence (MCS) is inserted after the SFFV promoter. In order to increase the viral vector packaging titer, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) sequence is inserted at the C-terminus of the MCS. In order to facilitate the screening of stable cell lines, two screening tags were designed. hEF1-HTLV promoter-CopGFP-T2A-Puro was inserted after the 3'SIN-LTR element. The Puro gene can be used for puromycin drug screening, and the CopGFP gene can be used for later fluorescence microscopy screening of high-expressing monoclonal cells. The 5' end packaging signal non-coding region (5'UTR) deleted all Gag and Pol coding region sequences and the start codon ATG, thereby further improving the vector packaging capacity and vector safety. The designed vector PSR.MCS was sent to Jinweizhi Biotechnology Co., Ltd. for gene synthesis.

[0041] 2. Design and construction of PSR.SynNotch plasmids targeting different antigens

[0042] Since the downstream effector molecules need the transcription factor Gal4VP64 to induce expression, they cannot be placed downstream of the promoter, so they should be designed upstream of the internal promoter and Gal4 induction receptor. The plasmids of the PSR.SynNotch vector targeting CD19 molecules, BCMA molecules, CD38 molecules, and GPC3 molecules are named PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.GPC3.BFP (p170). The schematic diagram of the four plasmid designs is shown in the figure below. Figure 2 As shown, the effector molecule (UAS tagBFP) and the inducible receptor (SFFV_scfv Notch Gal4VP64) of the SynNotch system were inserted between the 5'LTR and 3'SIN-LTR, and the inducible receptor protein was expressed by the SFFV promoter. In addition, P2A-EGFP fluorescent protein was added downstream of the GAL4VP64 protein as a detection tag for the vector receptor protein (CD19scfv, BCMA scfv, CD38 scfv, GPC3scfv).

[0043] 5'LTR(SEQ ID NO.1):ATGTAGTCTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGC ATTGCAGAGATTTGTATTTAAGTGCCTAGCTCGATACAATAAACGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTaTTCCCAATAAAgCCTCTTGCTGTTTGCATCCGAATCGTGGaCTCGCTGaTCCTTGGGAGGGTCTCCTCaGAtTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0044] 5’UTR(SEQ ID NO.2):TTGGAGACCCCTGCCCAGGGACCACCGACCCCCCCGCCGGGAGGTAAGCTGGCCAGCGGTCGTTTCGTGTCTGTCTCTGTCTTTGGGCGTGTTTGTGCCGGCATCTAGTGTTTGCGCCTGCGTCTGTACTAGTTGGCTAACTAGATCTGTATCTGGCGGTCCCGCGGAAGAACTGACGAGTTCGTATTCCCGGCCGCAGCCCCTGGGAGACGTCCCAGCGGCCTCGGGGGCCCGTTTTGTGGCCCATTCTGTATCAGTTAACCTACCCGAGTCGGACTTTTTGGAGCTCCGCCACTGTCCGAGGGGTACGTGGCTTTGTTGGGGGACGAGAGACAGAGACACTTCCCGCCCCCGTCTGAATTTTTGCTTTCGGTTTTACGCCGAAACCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAAAATTAGCGGCCCG

[0045] 3’SIN-LTR(SEQ ID NO.3):ATGAAAGACCCCACCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATaGACTGcGTCGCCCGGGTACCCGTGTTCtCAATAAACCCTCTTGCaGTTGCATCCGAcTCGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTGCCCACCTCGGGGGTCTTTCATT

[0046] The construction of the four plasmids is divided into four target DNA fragments and a vector, which are connected by seamless cloning. The construction of the four plasmids is composed of four DNA fragments and a vector. Three of the DNA fragments and the vector fragment are consistent in each plasmid, and only the template plasmid of the SFFV_scfv Notch Gal4 fragment is different. The p167 plasmid consists of four fragments: fragment 1 (UAS tagBFP), the template comes from pHR_Gal4UAS_tBFP_PGK_mCherry (Wuhan Miaoling); fragment 2, the template comes from pHR_PGK_antiCD19_synNotch_Gal4VP64 (Wuhan Miaoling); fragment 3 (P2A EGFP), fragment 3 is a fusion fragment of EGFP and P2A, pBT2-4xUAS:P2A-EGFP (addgene#127591); fragment 4 (WPRE), fragment 8 is a vector fragment after double enzyme digestion. The SFFV_scfv Notch Gal4 of the other three plasmids are fragment 5, fragment 6, and fragment 7, respectively. The templates are replaced with anti BCMA scfv, anti CD38 scfv, and anti-GPC3-scfv based on fragment 2. Among them, anti BCMA scfv is from the bb2121 anti-BCMA antibody approved by the FDA; anti CD38 scfv is obtained by this research team through phage display antibody library screening, and it has been proven to have strong killing function in both in vivo and in vitro experiments. For details, see LI X, FENG Y, SHANG F, et al. Characterization of the Therapeutic Effects of Novel Chimeric Antigen Receptor T Cells Targeting CD38 on Multiple Myeloma [J]. Frontiers In Oncology, 2021, 11: 703087; anti BCMA scfv comes from commercial antibody anti BCMA scfv comes from commercial antibody mouse GC33 clone. Amplification primers need to add homology arms, where the primers for fragment 2, fragment 5, fragment 6, and fragment 7 are the same. The primer sequences are shown in Table 1 below. The vector plasmid is PSR.MCS, and the restriction endonucleases are XhoI and NotI-HF. The PCR product and the enzyme digestion product are subjected to agarose gel electrophoresis and gel recovery.

[0047] Table 1 Primer design for PCR amplification of four targeted PSR.SynNotch plasmids

[0048]

[0049] Note: The underlined part is the homology arm.

[0050] Among them, the sequence number of S-16-1F is SEQ ID NO.4, the sequence number of S-16-1R is SEQ ID NO.5, the sequence number of S-16-2F is SEQ ID NO.6, the sequence number of S-16-2R is SEQ ID NO.7, the sequence number of S-16-3F is SEQ ID NO.8, the sequence number of S-16-3R is SEQ ID NO.9, the sequence number of S-16-4F is SEQ ID NO.10, and the sequence number of S-16-1R is SEQ ID NO.11.

[0051] The preparation process of the target fragment is as follows: PCR amplification, agarose gel electrophoresis, and gel recovery. Finally, the recovered 4 target fragments are recombined and connected, and the connection reaction is carried out at 50℃ for 30min. The connection product is transformed into competent E. coli DH5α and then spread on LB plate, cultured at 37℃ overnight, 3 to 5 positive clones are selected for expansion culture, and the plasmid is extracted and sent to the company for sequencing. The plasmid strain with correct sequencing is selected for expansion culture, and the plasmid is extracted and concentrated.

[0052] 3. Preparation of four vectors PSR.Syn.BFP self-inactivating retroviral vectors

[0053] After Pheonix-Ampho cells and PG13 cells were revived, the cells were in good condition, and the cell generation was preferably within 5 generations. When the cell confluence was about 80%, the cells were digested and inoculated in a six-well plate at a cell density of 5×10 5 / well, 2mL per well, and 4 wells are reserved for later flow cytometry detection of transfection efficiency. On the second day of inoculation, wait until the cell confluence is 70%-80%. Remove the culture medium and add fresh warm Opti-MEM culture medium dropwise, 1.8mL per well. Calculate the volume of plasmid required for transfection, and add 3.3μg of plasmid to each well. The transfection plasmids are PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), PSR.GPC3.BFP (p170). Add Opti-MEM culture medium to dilute to 200μL / well, gently blow to mix, and incubate at room temperature for 10min. After incubation, the transfection complex was added dropwise and evenly into the six-well plate, 200 μL per well, and the six-well plate was gently cross-mixed and placed in a 37°C, 5% CO2 cell culture incubator for culture.

[0054] 24 hours after transfection, remove the supernatant of the six-well plate, replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and place in a 32°C, 5% CO2 cell culture incubator for culture. After 24 hours of culture at 32°C, gently aspirate the supernatant (48h virus vector supernatant), replace with fresh warm 10% FBS-DMEM medium, 2.5 ml / well, and continue to culture in a 32°C, 5% CO2 cell culture incubator. After 24 hours of culture, collect the cell supernatant (72h virus vector supernatant). The collected supernatant was filtered and purified with a 0.45μm disposable syringe filter, and the filtered virus vector was immediately placed in a -80°C refrigerator for aliquoting and storage.

[0055] 4. Preparation of Syn-CAR-T

[0056] 10 mL of venous blood was collected from healthy volunteers, PBMC cells were extracted, IL-2 and OKT-3 were added to activate T cells, and after culturing with AIM-V complete medium for 48 hours, T cells were transduced with the supernatants of the four retroviral vectors prepared above, PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170), and retronectin was used as a transduction reagent.

[0057] One day before transduction, add the transduction reagent Retronetin to the Non-treated 12-well plate for incubation, that is, add 1mL of 1×PBS solution and 10μL Retronetin reagent to each well and mix well. Store at 4℃ in the dark. 48h after T cell activation, observe the growth status of T cells. If T cells grow in large clusters, the growth status is good and viral vector transduction of T cells can be performed. Take out the Non-treated 12-well plate incubated with Retronetin, and recover the Retronetin supernatant of the 12-well plate. Add 2% BSA for neutralization for 30min. Add 1×PBS solution for washing and remove the PBS solution. Add 1mL of retroviral vector supernatant (Syn-CAR167, Syn-CAR168, Syn-CAR169, Syn-CAR170) to each well and centrifuge at 2500rpm for 60min at 32℃. To treat T cells, take 5×106 cells / well, add 1mL of retroviral vector supernatant and mix well, centrifuge at 2500rpm for 60min, 32℃. After centrifugation, return to the cell culture incubator for incubation for at least 1h. After incubation, add retroviral vector supernatant again and centrifuge for 1h for transduction. After centrifugation, return to the incubator for incubation for at least 1h. After incubation, centrifuge each well of cells and replace with 1mL of fresh AIM-V complete medium for culture, add IL-2, 1μL / well. Return to the incubator for culture. If the viral vector titer is low, transduction can be continued on the second day, using the same method as the first day. 48h after transduction, take an appropriate amount of Pan-T cells as a blank control, and use flow cytometry to detect the transduction efficiency. The positive rate of EGFP detection is the transduction efficiency.

[0058] 5. Cultivation of target cells

[0059] RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were revived from liquid nitrogen tanks. RPMI-CD19, K562-hBCMA, and RPMI cells were cultured aseptically in a 37°C, 5% CO2 cell culture incubator using RPMI complete medium, and passaged once every 48 hours using RPMI complete medium to a cell density of 5×10 5 HepG2 cells were cultured in MEM complete medium in a 37°C, 5% CO2 cell culture incubator and passaged once every 48 hours with MEM complete medium to a cell density of 5×10 5 / mL, and were cultured to the logarithmic growth phase for subsequent experiments until the end of the experiment.

[0060] 6. Co-culture of Syn-CAR-T cells and target cells

[0061] Observe the growth status of target cells and Syn-CAR-T cells. If the cells are in good condition, they can be co-cultured. The co-culture is divided into 5 groups. Syn-CAR167 is co-cultured with RPMI-CD19 and RPMI respectively. Syn-CAR168 is co-cultured with K562-hBCMA. Syn-CAR169 is co-cultured with RPMI. Syn-CAR170 is co-cultured with HepG2. Count the target cells and Syn-CAR-T cells. The co-culture ratio of effector cells to target cells is 1:1. Take 5×10 5 cells in a 1.5 mL centrifuge tube. Centrifuge at 300 g for 5 min. Carefully remove the supernatant and resuspend in AIM-V complete medium. Mix each group of effector cells with target cells and supplement with IL-2. Return to the incubator for culture. After 48 h of culture, treat the cells for flow cytometry. The flow cytometry was divided into 9 groups, 5 of which were co-incubated groups and 4 of which were unincubated groups.

[0062] 7. Experimental results

[0063] 1. Successfully constructed 4 PSR.SynNotch plasmids targeting different antigens

[0064] In this experiment, the lentiviral dual vector of the original SynNotch system was transformed into a PSR (stable self-inactivating γ-retroviral vector) single vector for transduction, namely PSR.SynNotch. In order to verify the induction efficiency of the PSR.SynNotch system for different antigen targets, four antigen-targeted PSR.SynNotch vectors were designed, namely targeting CD19, BCMA, CD38, and GPC3, respectively. The effector molecule after induction was the reporter gene tagBFP fluorescent protein. Since the downstream effector molecule requires the transcription factor Gal4VP64 to induce expression, it cannot be placed downstream of the promoter, so it is designed to be placed upstream of the internal promoter and the Gal4 induction receptor. The four constructed plasmids PSR.Syn.CD19.BFP, PSR.Syn.BCMA.BFP, PSR.Syn.CD38.BFP, and PSR.Syn.GPC3.BFP were downloaded from the official website of the sequencing company. The sequencing results were analyzed and compared using the biological software SnapGene, and the sequencing results were correct. Therefore, this experiment successfully constructed four vector plasmids PSR.Syn.CD19.BFP (p167), PSR.Syn.BCMA.BFP (p168), PSR.Syn.CD38.BFP (p169), and PSR.Syn.GPC3.BFP (p170).

[0065] 2. Successfully prepared 4 different targeted Syn-CAR-T cells

[0066] The four successfully constructed plasmids were transiently transfected into Ampho cells, and the viral vectors were harvested 48h and 72h after transfection, namely PSR.Syn.CD19.BFP (Syn-CAR167), PSR.Syn.BCMA.BFP (Syn-CAR168), PSR.Syn.CD38.BFP (Syn-CAR169), and PSR.Syn.GPC3.BFP (Syn-CAR170). Volunteers were recruited to collect venous blood, and PBMCs were isolated and activated and cultured for 48h. The harvested viral vectors were transduced into T cells. The transduction efficiency was detected by flow cytometry 48h after transduction. Since P2A-EGFP was added as a molecular tag at the C-terminus of Gal4VP64, the positive rate of EGFP detected by flow cytometry can be used as the transduction efficiency of T cells. The flow cytometry results are as follows Figure 3 As shown, the transduction efficiencies of the four Syn-CAR-Ts were 50.0%, 30.36%, 36.36%, and 41.68%, respectively. The transduction efficiency was greater than 30%, proving that the four Syn-CAR-T cells were successfully prepared in this experiment.

[0067] 3.4 Verification of Syn-CAR-T cell induction function with different targets

[0068] The target cells RPMI-CD19, K562-hBCMA, RPMI, and HepG2 were revived and cultured respectively. Syn-CAR-T cells targeting four different antigens were co-cultured with the corresponding target cells at a ratio of 1:1 for 48 hours. There were 5 groups of co-culture, Syn-CAR167 was co-cultured with RPMI-CD19 and RPMI, Syn-CAR168 was co-cultured with K562-hBCMA. Syn-CAR169 was co-cultured with RPMI, and Syn-CAR170 was co-cultured with HepG2. There were 4 groups without incubation, Syn-CAR167, Syn-CAR168, Syn-CAR169, and Syn-CAR170. The flow cytometry results are as follows Figure 4As shown. When the four Syn-CAR-Ts were not co-incubated with tumor cells, the effector molecule tagBFP fluorescent protein had low background leakage expression, and the MFI (mean fluorescence intensity) values ​​of the four Syn-CAR-Ts were 3344, 3228, 4986, and 3257, respectively, which were all higher than the Control group (2567); when the four Syn-CAR-Ts were co-incubated with CD19+, BCMA+, CD38+, and GPC3+ tumor cells, only Syn-CAR167 had the highest induction efficiency (MFI: 17528), and the MFI value was 5.2 times that of the non-incubated (3344). When Syn-CAR167 was co-cultured with RPMI (CD19-), the induction efficiency was extremely low, and the MFI value was the same as that when it was not incubated, proving that Syn-CAR167-T cells can be specifically induced to express, and only when co-incubated with CD19-positive cells can the expression be induced. The MFI values ​​of the induced group of the other three groups of Syn-CAR-T were similar to those of the uninduced group, indicating that the induction efficiency of the targets BCMA, CD38, and GPC3 was extremely low and not suitable for the SynNotch system. In summary, the target CD19 had the highest induction efficiency and was most suitable for the SynNotch system.

[0069] Example 2 Preparation of PSR.Syn.CD19.CD38 CAR-T cells and verification of their anti-tumor function

[0070] 1. Construction of the new vector PSR.Syn.CD19.CD38 plasmid

[0071] The PSR.SynNotch vector targeting CD19 and CD38 was constructed, with CD19 as the induction target and CD38 as the effector target. That is, the PSR.Syn.CD19.CD38 CAR-T (Syn-CAR188-T) cells were constructed and co-incubated with CD19 antigen-positive tumor cells to induce the expression of the effector molecule anti-CD38-CAR. Syn-CAR188-T will only recognize and kill tumors when tumor cells express both CD19 and CD38 antigens.

[0072] 1. Plasmid Design

[0073] Since the downstream effector molecules need the transcription factor Gal4VP64 to induce expression, they cannot be placed downstream of the promoter, so they should be designed upstream of the internal promoter and Gal4 induction receptor. Figure 5As shown, effector molecule UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, Gal4-induced receptor anti CD19 scfv-Notch-Gal4VP64, WPRE element are inserted between 5'LTR and 3'SIN-LTR respectively. CopGFP-P2A-Puro is inserted between 3'SIN-LTR and 3'TIR transposon. Among them, anti-CD38 scfv is a CAR21 molecule obtained by phage display technology screening in the early stage. Anti-CD38-CAR (CAR21) has been shown to have high-efficiency and specific tumor killing activity both in vivo and in vitro. Gal4-induced receptor anti CD19 scfv is expressed by promoter SFFV, and myc tag is added to the 5' end to detect the transduction efficiency of viral vector. CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, connected with P2A, and expressed by composite promoter hEF1α-HTLV. The total length of the gene fragment inserted between the 5'UTR and 3'SINLTR of the vector is 5500bp, which is considered to be an ultra-large packaging capacity, while the conventional packaging size of γ-retroviral vectors is about 4kb. The larger the designed insertion target fragment, the more difficult it is to package the viral vector, and the production titer of the viral vector will decrease. From 5'LTR to 3'SIN-LTR, that is, the total size of the entire recombinant SIN-γ-RV is 6629bp, which does not exceed the 8kb of the wild-type γ-retroviral genome, and the viral vector packaging experiment can be carried out normally.

[0074] 2. Target fragment PCR amplification, seamless cloning connection, transformation, sequencing, plasmid extraction

[0075] The construction of PSR.Syn.CD19.CD38 (Syn-CAR188) plasmid consists of 4 PCR amplification fragments, including a vector fragment. Fragment 1 is UAS anti-CD38-CAR, and the template plasmid comes from the commercialized plasmid p184; Fragment 2 is anti-CD19scfv-Notch-Gal4VP64, and the template plasmid comes from the commercialized plasmid p184; Fragment 3 is hEF1-HTLV promoter-CopGFP-T2A-Puro, and the template plasmid comes from the commercialized plasmid MFU-BCMA, and Fragment 4 is a vector fragment, and the template plasmid comes from the commercialized plasmid p184. The PCR primers are designed as shown in Table 2 below, and the designed primers are sent to the company for synthesis.

[0076] Table 2 Primer design for plasmid Syn-CAR188 amplification

[0077]

[0078] Note: The underlined part is the homology arm. The sequence number of S-188-1F is SEQ ID NO.12, the sequence number of S-188-1R is SEQ ID NO.13, the sequence number of S-188-2F is SEQ ID NO.14, the sequence number of S-188-2R is SEQ ID NO.15, the sequence number of S-188-3F is SEQ ID NO.16, the sequence number of S-188-3R is SEQ ID NO.17, the sequence number of S-188-4F is SEQ ID NO.18, and the sequence number of S-188-4R is SEQ ID NO.19.

[0079] The PCR products and enzyme digestion products were subjected to agarose gel electrophoresis and gel recovery. The gel recovery products were directly cloned and connected seamlessly, and the four DNA fragments were incubated at 50°C for 40 minutes. The connection products were transformed into competent cells, plated, and 1 to 5 single colonies were selected for expansion culture. After PCR identification of the bacterial solution, the correct clone was selected for sample sequencing. Sequencing comparison analysis Select a clone with correct sequencing to expand the culture for plasmid extraction and sequencing analysis comparison.

[0080] 3. Experimental results

[0081] 3.1. Gel electrophoresis results of target fragments

[0082] The construction of PSR.Syn.CD19.CD38 plasmid (Syn-CAR188) consists of 4 PCR amplified fragments, including the vector fragment. The theoretical sizes of fragment 1, fragment 2, fragment 3, and fragment 4 (vector fragment) are: 3412bp, 3601bp, 1973bp, and 3665bp, respectively. The gel electrophoresis results are as follows Figure 6 As shown, the band sizes of fragment 1, fragment 2, fragment 3, and fragment 4 are consistent with the theoretical sizes, and the preliminary identification of the PCR amplification products is correct.

[0083] 3.2 Analysis of sequencing results

[0084] The construction of PSR.Syn.CD19.CD38 plasmid (Syn-CAR188) consists of 4 PCR amplified fragments, including the vector fragment. After the gel recovery fragments were correctly identified, seamless cloning and connection, transformation, single clone selection, bacterial liquid PCR identification, and the bacterial liquid of the correct colony clone was selected and sent to the company for sequencing. The base sequence sequencing of the joint parts of the 4 fragments was completely correct, the sequencing was basically completed, and the sequencing results were completely correct. The experimental results showed that this experiment successfully constructed a new vector PSR.Syn.CD19.CD38 plasmid and named Syn-CAR188.

[0085] 2. Construction of a stable cell line with a novel vector PSR.Syn.CD19.CD38

[0086] Construct a virus vector packaging cell line stably transfected with the vector PSR.Syn.CD19.CD38 (Syn-CAR188). Since the gene loaded by the vector Syn-CAR188 is too large, the total insertion fragment is 5500bp, and the size from 5'LTR to 3'SINLTR is 6629bp, so the virus vector packaging capacity will be greatly reduced. In order to obtain stable virus production and high titer virus packaging cells, it is necessary to screen the successfully constructed stable transfected cell line for monoclonal cells. There are 3 screening markers, CopGFP fluorescent protein, puromycin drug screening, and Myc tag upstream of the anti-CD19 scfv fragment. Ampho cells were selected as the virus packaging cell line of Syn-CAR188. The specific process is: revive Ampho cells, transfect Ampho cells, obtain stable transfected cell lines with puromycin drug screening, flow cytometry detection, monoclonal cell plating, fluorescence microscopy observation, and screening of monoclonal cells.

[0087] 1. Cell recovery, plating, transfection and cell drug screening

[0088] Resuscitate Ampho cells and observe Ampho cells. When the growth state is good and the cell density reaches 80% to 90%, the cells can be subcultured. After counting the cells, plate and culture them. 24 hours after cell plating, observe the cells under a microscope. When the density reaches 80% to 90% and the cells are in good condition, transfection can be performed. 48 hours after transfection, subculture the cells, take a part of the cells for flow cytometry detection, and the remaining cells are used for subculture. Add puromycin for subculture. Long-term drug screening until the cell line is stable and highly expresses Myc and CopGFP. Detect the positive rate of cells expressing Myc and CopGFP.

[0089] 2. Monoclonal plating, monoclonal cell screening and monoclonal cell expansion culture The viral vector supernatant was harvested. When the cell line was stable and highly expressed Myc and CopGFP by flow cytometry, it was proved that the stable transfected cell line had been successfully constructed and monoclonal cell plating and culture could be performed. When the 96-well monoclonal cells were cultured for about 7 days, the 96-well plate cells were observed under a microscope, and the single-group cell wells were picked out. Two or more groups of cells were polyclonal cell wells. The 96-well plate monoclonal cells were observed under a fluorescence microscope, and the wells expressing CopGFP green fluorescent protein were picked out. The fluorescence was bright and uniform, and they were marked as early positive cells. When the early positive cells with bright and uniform fluorescence proliferated to a density of more than 50%, they could be passaged and passaged to 24-well plates. When the cell density of the 24-well plate reached more than 80%, they could be passaged to 6-well plates. Another part of the cells was taken for flow cytometry detection, and the flow antibody AF647 anti-c-Myc (Biolegend) was added for staining for 60 minutes, and incubated at 4°C in the dark. After staining, detect the positive rate of cells expressing Myc and CopGFP. Screen out monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry and mark them. When the cells in the 6-well plate proliferate to a density greater than 80%, perform cell subculture, take a part of the cells for flow cytometry, and pass the remaining cells 1 to 3. Add flow cytometry antibody AF647 anti-c-Myc (Biolegend) for staining to detect the positive rate of cells expressing Myc and CopGFP. Screen out monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry, and mark them. Add flow cytometry antibody AF647 anti-c-Myc (Biolegend) for staining to detect the positive rate of cells expressing Myc and CopGFP. Screen out monoclonal cells with a positive rate of Myc and CopGFP greater than 70% by flow cytometry (two rounds of flow cytometry), and when the cells in the 6-well plate proliferate to a density greater than 80%, perform cell subculture and expand culture. After culturing at 32°C for 24 h, the cell supernatant (A188-H1) was carefully collected.

[0090] 3. Experimental results

[0091] 3.1 Construction of the PSR.Syn.CD19.CD38 (Syn-CAR188) stably transfected packaging cell line

[0092] The constructed plasmid Syn-CAR188 and transposase plasmid were co-transfected into the viral vector packaging cell line Ampho cells. Since the Syn-CAR188 plasmid carries CopGFP fluorescent protein and puromycin resistance gene, puromycin drug screening was performed 48h after transfection. In order to obtain a stable transfection packaging cell line, long-term drug screening is required. Plasmid Syn-CAR188 added a Myc tag upstream of anti-CD19 scfv, so the flow cytometry transfection efficiency after transfection has two tags, CopGFP fluorescent protein and Myctag tag. The positive rates of Ampho cells expressing CopGFP at 48h (day 2), day 10, and day 20 after transfection were 82.95%, 91.55%, and 99%, respectively; the positive rates of Ampho cells expressing Myc at 48h (day 2) and day 10 after transfection were 59.48% and 56.9%, respectively. The experimental results showed that the positive rate of Ampho cells expressing CopGFP reached 99% on day 20 after transfection, proving that the Ampho packaging cell line (A188) stably transfected with vector Syn-CAR188 has been successfully prepared in this experiment. However, at 48h (day 2) and day 10, the positive rate of Ampho cells expressing Myc was 35% lower than that of CopGFP, which may be related to the expression efficiency of different promoters and the location of the vector integration into the host genome.

[0093] 3.2. Screening of monoclonal cells stably transfected with the vector PSR.Syn.CD19.CD38 (Syn-CAR188)

[0094] In order to obtain virus vector packaging cells with high production titer and stable transfection, this experiment will perform monoclonal cell screening. Syn-CAR188-Ampho (A188) stably transfected cells were inoculated into 4 96-well plates, with 1 cell in each well. Fifty clones with bright and uniform green fluorescence were initially screened by fluorescence microscopy. When the cell density in a single well reaches more than 50%, they were subcultured to 24-well plates and 6-well plates. When the 6-well plate was subcultured, a portion of the cells were taken for flow cytometry detection to detect the positive rate of A188 cells expressing CopGFP fluorescent protein and Myc tag labels, and monoclonal cells with positive rates greater than 70% were screened. In this experiment, a monoclonal cell A188-47 that met the standards was finally screened from the 50 monoclonal cells with bright and uniform green fluorescence in the initial screening, and the positive rates of CopGFP and Myc tag were both greater than 70%. The positive rates were 91.26% and 86.3%, respectively. After successfully screening out monoclonal cells, monoclonal cell A188-47 was subcultured to a T75 flask for expansion culture. When the density reached more than 90%, the medium was changed and placed in a 32°C incubator for low-temperature culture for 5 days. The cell supernatant, i.e., the viral vector supernatant, was harvested every 24 hours.

[0095] 3. Preparation of PSR.Syn.CD19.CD38 CAR-T cells and verification of their induction function

[0096] PSR.Syn.CD19.CD38 CAR-T cells (Syn-CAR188-T) targeting CD19 and CD38 were prepared, with CD19 as the induction target and CD38 as the effector target. Syn-CAR188-T cells can only have a specific killing function on tumor cells that express both CD19 and CD38 antigens. In order to verify the induction expression efficiency of Syn-CAR188-T cells, Syn-CAR188-T cells were co-cultured with tumor cells expressing different antigens (CD19 antigen, CD38 antigen), and the positive rate of anti-CD38-scfv expression in positive T cells expressing anti-CD19scfv was detected by flow cytometry. The experimental process is: the viral vector produced by the harvested monoclonal cell A188-47 is transduced into T cells, and after successful transduction, it is co-cultured with tumor cells, and the induction efficiency of Syn-CAR188-T cells is detected by flow cytometry.

[0097] 1. Preparation of Syn-CAR188-T cells

[0098] Human PBMCs were isolated and activated with OK-T3 and IL-2. 48 hours after PBMC activation, the virus vector (A188-H3) produced by monoclonal cell A188-47 was added to transduce T cells. 72 hours after transduction, the transduction efficiency of T cells was detected by flow cytometry, and the staining antibody was AF647 anti-c-Myc (Biolegend).

[0099] 2. Co-incubation of Syn-CAR188-T cells with tumor cells

[0100] Tumor cells expressing different antigens were revived, RPMI-CD19, RPMI, Raji-Lu, K562-CD38, and K562-CD19-CD38. The successfully prepared Syn-CAR188-T cells were co-cultured with tumor cells for 48 hours, with a co-culture ratio of 1:1, and the number of T cells and tumor cells was 5×10 5 cells. After the co-incubation, the co-cultured T cells and tumor cells were transferred to a 1.5 mL centrifuge tube, the supernatant was removed by centrifugation, and the cells were resuspended in 1× PBS solution and mixed. The supernatant was removed by centrifugation, and the staining buffer and staining antibody were added for co-incubation for 60 min at 4°C in the dark. The staining antibodies were AF647 anti-c-Myc (Biolegend) and FITC-CD38FC. After the staining was completed, the cells were resuspended in staining buffer to terminate the staining, the supernatant was removed by centrifugation, the cells were resuspended in staining buffer, and the cells were detected by flow cytometry.

[0101] 3. Experimental results

[0102] 3.1. Preparation of Syn-CAR188-T cells

[0103] The viral vector (A188-H3, viral supernatant harvested on the third day) produced by the prepared monoclonal cell A188-47 was transduced into T cells, and the transduction efficiency was detected by flow cytometry 72 hours after transduction. The results of flow cytometry showed that the transduction efficiency of Syn-CAR188-T was 32.34%. The results of the study showed that Syn-CAR188-T cells were successfully prepared in this experiment, which can be used to subsequently verify the induction efficiency of Syn-CAR188-T cells co-cultured with tumor cells expressing different antigens.

[0104] 3.2 Induction efficiency of Syn-CAR188-T cells on different tumor cells

[0105] The successfully prepared Syn-CAR188-T cells were co-incubated with K562-CD38 cells (CD19 antigen negative, CD38 antigen positive, single positive tumor cells), K562-CD19-CD38 cells (CD19 positive, CD38 positive, double positive tumor cells), RPMI cells (CD19 negative, CD38 positive,), RPMI-CD19 cells (CD19 positive, CD38 positive), Raji-Lu (CD19 positive, CD38 positive) for 48 hours. After the co-incubation, flow cytometry was performed, and the flow staining antibodies were AF647 anti-c-Myc and FITC-CD38 Fc. The flow cytometry results were analyzed using Flowjo software, and the positive rate of T cells expressing CD38Fc-FITC was analyzed in the Myc-APC positive T cell population. The induction efficiency of Syn-CAR188-T cells co-incubated with single positive tumor cells K562-CD38 and RPMI was 18.3% and 1.08% respectively; the induction efficiency of co-incubated with double positive tumor cells K562-CD19-CD38, RPMICD19, and Raji-Lu was 73.7%, 71.9%, and 70.7% respectively; the induction efficiency was 0.21% when not incubated with tumors. The experimental results showed that the induction efficiency of Syn-CAR188-T cells after co-incubation with a variety of CD19 antigen positive tumor cells was greater than 70%, and the induction efficiency after co-incubation with CD19 negative tumor cells was lower (18.3%, 1.08%), and the background expression was about 0 when not incubated with tumors, proving that Syn-CAR188-T cells have strong intelligent specific induction expression function, and low background leakage expression, which can be used for further research on the specific killing effect of Syn-CAR188-T cells on tumor cells.

[0106] 4. Validation of the anti-tumor function of PSR.Syn.CD19.CD38 CAR-T cells

[0107] PSR.Syn.CD19.CD38 CAR-T (Syn-CAR188-T) cells were co-cultured with tumor cells expressing different antigens (CD19 antigen, CD38 antigen), and CAR21-T cells were used as the positive ginseng group to study the anti-tumor function of Syn-CAR188-T cells. Among them, CAR21 is a CAR that specifically targets CD38 and has a specific killing function against CD38 antigen-positive tumors. The killing effect of Syn-CAR188-T cells on tumor cells was mainly studied by luciferase method, the persistent killing effect of Syn-CAR188-T cells on tumor cells was studied by real-time dynamic live cell imaging monitoring system Incucyte, the expression of CD69 in Syn-CAR188-T cells was detected by flow cytometry to study the activation difference of Syn-CAR188-T cells after incubation with different tumor cells, and the proliferation effect of Syn-CAR188-T cells was studied by CFSE (live cell fluorescent dye) flow cytometry. The differences in cytokine secretion levels of Syn-CAR188-T cells were studied by CBA (multiple cytokine assay) flow cytometry.

[0108] 1. Cell Recovery and Culture

[0109] Tumor cells were recovered, RPMI-CD19, RPMI, Raji-Lu, K562-CD38, K562-CD19-CD38, all of which were suspension cells, and the culture medium was RPMI complete medium. Syn-CAR188-T cells, CAR21-T cells, and PAN-T cells were prepared and cultured.

[0110] 2. Luciferase assay to detect the killing efficiency of Syn-CAR188-T cells on tumor cells

[0111] PAN-T cells, Syn-CAR188-T cells, CAR21-T cells and tumor cells were observed under a microscope. Cells were plated when the cells were in good growth state and the proliferation rate was normal. There were 5 types of target cells, RPMI-CD19, RPMI, Raji-Lu, K562-CD38, and K562-CD19-CD38. They were divided into 3 groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. There were 5 ratios for co-culture of T cells and tumor cells, and the effector-target ratios were 2:1, 1:1, 1:2, 1:4, and 1:8, respectively. In order to facilitate luciferase detection, T cells and tumor cells were co-cultured and plated in a white, light-proof 96-well cell culture plate. Gently blow and mix the T cells and tumor cells, and use trypan blue to count the cells. The tumor cells were diluted to 4×10 with AIM-V complete medium. 5 Take out the white light-proof 96-well cell culture plate and put it in the biosafety cabinet. Add 50 μL of diluted tumor cells to each well. In addition to the wells incubated with T cells, add tumor cells. Add 3 more tumor cell maximum release wells (no T cells, only tumor cells).

[0112] PAN-T cells, Syn-CAR188-T cells, and CAR21-T cells were diluted with AIM-V complete medium. The three groups of T cells after gradient dilution were added to a light-proof 96-well plate, co-incubated with target cells and cultured in an incubator. The co-incubation time of T cells and target cells RPMI-CD19 and RPMI was 8 hours. The co-incubation time of T cells and target cells Raji-Lu, K562-CD38, and K562-CD19-CD38 was 12 hours. After the co-incubation, luciferase detection can be performed. Detect the relative luminescence units (RLU) of each well. Killing efficiency = 1-(RLU of experimental group-RLU of blank well) / (RLU of tumor cell maximum release well-RLU of blank well)×100%. Each group was repeated 3 times. Graphpad Prim 9.5 software was used for statistical analysis. The experimental results were expressed as Mean±SD. ANOVA analysis of variance was used to compare the means of multiple groups. A P value less than 0.05 was considered statistically significant.

[0113] 3. Incucyte detects the persistent killing effect of Syn-CAR188-T cells on tumor cells

[0114] The Incucyte real-time live cell imaging system can capture the real-time growth status of differently labeled cells, and more realistically displays the cell status than the traditional endpoint method, which destroys or labels cells. The Incucyte detection method has the advantages of real-time non-destructiveness and long-term cell detection. In this experiment, the successfully prepared Syn-CAR188-T cells were co-incubated with tumor cells, and the cell killing effect was detected using the Incucyte real-time live cell imaging system.

[0115] There are 3 groups in total: PAN-T group, Syn-CAR188-T group, and CAR21-T group. There are 5 ratios of T cells and tumor cells co-cultured, with effector-target ratios of 2:1, 1:1, 1:2, 1:4, and 1:8. In order to facilitate Incucyte camera detection, a transparent 96-well cell culture plate was used for plating, the total co-culture volume was 200 μL, and the number of tumor cells per well was 2×10 4 Calculate the required number of tumor cells and T cells in advance. First, dilute the tumor cells to 2×10 5 cells / mL, and 100 μL of diluted tumor cells were added to each well of the 96-well plate. PAN-T cells, Syn-CAR188-T cells, and CAR21-T cells were diluted with AIM-V complete medium to the density corresponding to the effective target ratio, and the three groups of T cells were added to 96-well plates and co-incubated and cultured with tumor cells. Bright field photography and green fluorescence photography were set every 2 hours, and the monitoring time was 72 hours. After the co-incubation culture, the Incucyte detection system software was used for data analysis, and the experimental results were expressed as Mean±SD.

[0116] 4. CBA detection of cytokine secretion by Syn-CAR188-T cells against tumor cells

[0117] Cytometric bead array (CBA) is a multiplex protein quantitative technology that can detect multiple cytokines simultaneously. The CBA kit used in this experiment is Human CD8 / NK Panel (13-plex), Biolegend. T cells in good growth state were co-incubated with tumor cells RPMI and SW620 cells respectively. A total of 3 groups were divided into PAN-T group, Syn-CAR188-T group, and CAR21-T group. The effector-target ratio was 1:1, and the co-incubation volume was 200 μL per well. After 12 hours of co-incubation, the cell supernatant was collected, centrifuged at 500g for 5 minutes, and CBA detection was started. The flow cytometry test results were uploaded to the CBA online analysis system on the Biolegend official website for data processing. The website address is: https: / / legendplex.qognit.com / user / login? next=home. Graphpad Prim 9.5 software was used for statistical analysis. The experimental results were expressed as Mean±SD. ANOVA analysis of variance was used to compare the means of multiple groups. A P value less than 0.05 was considered statistically significant.

[0118] 5. Detection of CD69 on the surface of Syn-CAR188-T cells

[0119] T cells were co-incubated with RPMI-CD19 cells and RPMI cells for 12 h. The experiment was divided into 3 groups.

[0120] PAN-T group, Syn-CAR188-T group, CAR21-T group. The co-incubation effector-target ratio was 1:1. After the co-incubation, staining antibodies APC / CY7-anti human CD69 and AF647 anti-c-Myc (Biolegend) were added for staining.

[0121] 6. CFSE detection of Syn-CAR188-T cell proliferation ability

[0122] The proliferation ability of Syn-CAR188-T cells was detected by CFSE method. CFSE (Carboxyfluoresceindiacetate succinimidyl ester) is a living fluorescent dye that can penetrate the living cell membrane and irreversibly bind to proteins. When the cell divides, the CFSE fluorescence intensity of the daughter cells is halved, which can be used for cell tracing and T cell proliferation detection. The experiment was divided into 3 groups, PAN-T group, Syn-CAR188-T group, CAR21-T group, and the effector-target ratio was 1:1. First, count the T cells and RPMI-CD19 tumor cells. Calculate the number of T cells and RPMI-CD19 tumor cells required. Prepare CFSE staining solution and take 2 times of the 3 groups of T cells for cell staining. After the staining is completed, centrifuge at 300g for 5 minutes, remove the cell staining solution, and inoculate the T cells into a 96-well plate to co-culture with tumor cells. In addition, a group of cells not co-incubated with tumor cells was added, and 100 μL of AIM-V complete medium was added to each well. The remaining stained T cells were subjected to flow cytometry. Centrifuge at 300g for 5 minutes, remove the supernatant, filter the cells through a cell mesh, and perform flow cytometry detection. The FITC channel can detect the CFSE fluorescence signal. After co-incubation for 48 hours, remove the co-incubated cells, centrifuge at 300g for 5 minutes, resuspend the cells with 49 μL flow staining buffer, add 1 μL APCantiCD3 antibody for staining, and stain at 4°C in the dark for 60 minutes. After staining, remove the supernatant by centrifugation, resuspend and wash with PBS, remove the supernatant by centrifugation, resuspend with 200 μL flow staining buffer, filter the cells through a cell mesh, and perform flow cytometry detection. The APC channel can detect the stained CD3 antibody signal, and the FITC channel can detect the CFSE fluorescence signal. Flow data were analyzed using FlowJo software.

[0123] 7. Experimental Results

[0124] 7.1. Luciferase assay to detect the killing efficiency of Syn-CAR188-T cells on tumor cells

[0125] This experiment requires the preparation of Syn-CAR188-T (experimental group) and CAR21-T cells (positive control group). After Syn-CAR188-T cells and tumor cells were co-incubated for 8h to 15h, luciferase detection reagent was added for lysis reaction and then detected using the chemiluminescence mode of a multifunctional microplate reader. There are 6 types of target cells, K562-CD19-CD38, K562-CD38, RPMI-CD19, RPMI, Raji-Lu, K562-CD19-hBCMA. There are 5 effector-target ratios, namely 2:1, 1:1, 1:2, 1:4, and 1:8. Some co-incubation groups have only 4 effector-target ratios. The experiment was divided into 3 groups, PAN-T group, Syn-CAR188-T group, and CAR21-T group. The PAN-T group was a co-culture of non-transduced T cells and tumor cells (negative control group), the Syn-CAR188-T group was a co-culture of T cells transduced with the viral vector A188-H3 and tumor cells (experimental group), and the CAR21-T group was a co-culture of T cells transduced with the viral vector CD38-CAR (CAR21) and tumor cells (positive control group). The results of the microplate reader were analyzed, the killing efficiency of the effector cells was calculated according to the formula, and the Graphpad Prim 9.5 software was used for statistical analysis. The experimental results are as follows Figure 7 shown.

[0126] Figure 7 A is the killing efficiency test results of three groups of T cells after co-incubation with K562-CD19-CD38 tumor cells for 12 hours at five effector-target ratios. K562-CD19-CD38 tumor cells express CD19 and CD38 antigens and are double-positive tumor cells. In theory, the experimental group T cells and the positive control group T cells co-incubated with double-positive tumor cells have specific tumor killing function. Figure 7 A Experimental results show that under different effector-target ratios, the Syn-CAR188-T group has a higher killing efficiency on K562-CD19-CD38 tumor cells, and is significantly higher than the negative control PAN-T group, with statistical differences. Compared with the positive control group CAR21-T group, it has a strong killing effect on K562-CD19-CD38 tumor cells, with no significant difference. Figure 7 B is the killing efficiency test result after 15 hours of co-incubation of 3 groups of T cells with K562-CD38 tumor cells. K562-CD38 tumor cells do not express CD19 antigen, but express CD38 antigen, and are single positive tumor cells. Therefore, in theory, the Syn-CAR188-T group co-incubated with K562-CD38 tumor cells cannot induce the expression of antiCD38-CAR and cannot activate the specific killing function, while the positive control group CAR21-T cells can specifically kill tumor cells expressing CD38 antigen. Figure 7B Experimental results showed that the killing efficiency of CAR21-T cells in the positive control group against K562-CD38 tumor cells was significantly higher than that in the Syn-CAR188-T group and PAN-T group. The killing efficiency of the Syn-CAR188-T group and PAN-T group against K562-CD38 tumor cells was lower and there was no significant difference, which was consistent with the theoretical results. Figure 7 F is the killing efficiency test result of the three groups of T cells after co-incubation with K562-CD19-BCMA tumor cells for 12 hours. K562-CD19-BCMA tumor cells express CD19 antigen but not CD38 antigen. Theoretically, Syn-CAR188-T cells can induce the expression of anti CD38-CAR after co-incubation with K562-CD19-BCMA tumor cells, but tumor cells do not express CD38 antigen and cannot activate the specific killing function. Similarly, CAR21-T cells cannot theoretically activate the specific killing function after co-incubation with K562-CD19-BCMA tumor cells. Figure 7 F The experimental results showed that the killing efficiency of the three groups of T cells on K562-CD19-BCMA tumor cells was low, which was consistent with the theoretical results. Figure 7 C is the killing efficiency test results of the three groups of T cells after co-incubation with RPMI-CD19 tumor cells for 12 hours. RPMI-CD19 tumor cells express CD19 antigen and CD38 antigen, and are double-positive tumor cells. Figure 7 C Experiment

[0127] The results showed that at four different effector-target ratios, the killing efficiency of Syn-CAR188-T and CAR21-T groups on RPMI-CD19 tumor cells was significantly higher than that of the negative control group. When the effector-target ratio was 2:1, the killing efficiency of Syn-CAR188-T and CAR21-T groups was greater than 90%. Figure 7 D is the killing efficiency test result after 8 hours of co-incubation of 3 groups of T cells with RPMI tumor cells. RPMI tumor cells do not express CD19 antigen, but express CD38 antigen, and are single positive tumor cells. Theoretically, Syn-CAR188-T cells have no specific killing function on RPMI cells, while CAR21-T cells can specifically kill RPMI cells. Figure 7 D Experimental results showed that at four different effector-target ratios, the killing efficiency of CAR21-T cells against RPMI tumor cells was significantly higher than that of the Syn-CAR188-T group and PAN-T group. Figure 7 E is the killing efficiency test results of the three groups of T cells after co-incubation with Raji-Lu tumor cells for 12 hours. Raji-Lu tumor cells express CD19 antigen and CD38 antigen, and are double-positive tumor cells. Figure 7E Experimental results showed that at two different effector-target ratios, Syn-CAR188-T cells and CAR21-T cells had a higher killing efficiency against Raji-Lu tumor cells, and both were significantly higher than the negative control group PAN-T group, with statistically significant differences.

[0128] In summary, Syn-CAR188-T cells have a specific killing function against double-positive tumor cells (expressing both CD19 and CD38 antigens), but have no specific killing effect on single-positive tumor cells (expressing only CD19 or CD38 antigens). This proves that Syn-CAR188-T cells can efficiently and specifically kill tumor cells and have a safety switch to activate the killing function.

[0129] 7.2. Incucyte detection of the persistent killing effect of Syn-CAR188-T cells on tumor cells

[0130] The successfully prepared Syn-CAR188-T cells were co-incubated with tumor cells RPMI-CD19 and Raji-Lu, and the Incucyte real-time live cell imaging system was used to detect the persistent killing effect of T cells. The experiment was divided into 3 groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. The experimental results are as follows Figure 8 The horizontal axis represents the co-incubation time, and the vertical axis represents the average fluorescence intensity of tumor cells. If the vertical axis value at a certain time is lower, it means that the T cell killing effect is stronger at that moment. Figure 8 A is the killing test result of the three groups of T cells co-incubated with RPMI-CD19 tumor cells for 72 hours, with an effector-target ratio of 1:2. The experimental results showed that the killing effect of Syn-CAR188-T cells on RPMI-CD19 tumor cells was always higher than that of the PAN-T group after 72 hours of co-incubation monitoring, and the CAR21-T cells in the positive control group had the strongest killing effect on RPMI-CD19 tumor cells. Figure 8 B is the killing test results of the three groups of T cells co-incubated with Raji-Lu tumor cells for 72 hours, with an effector-target ratio of 1:1. The experimental results showed that the killing effect of Syn-CAR188-T cells on Raji-Lu tumor cells was always higher than that of the PAN-T group after 72 hours of co-incubation monitoring, and the killing effect of CAR21-T cells in the positive control group on Raji-Lu tumor cells was the strongest. The results of the Incucyte detection experiment showed that Syn-CAR188-T cells had a persistent killing effect on both RPMI-CD19 tumor cells and Raji-Lu tumor cells.

[0131] 7.3.CBA detection of cytokine secretion by Syn-CAR188-T cells against tumor cells

[0132] The cytokine content in the culture supernatant of Syn-CAR188-T cells was quantitatively detected by CBA method to analyze the anti-tumor cell ability of Syn-CAR188-T cells. In the experiment, T cells were co-incubated with tumor cells RPMI-CD19 for 12 hours and then the supernatant was collected for detection, with an effector-target ratio of 2:1. The experiment was divided into 3 groups, PAN-T group, Syn-CAR188-T group, and CAR21-T group. The levels of cytokine IL-2, interferon IFN-γ, tumor necrosis factor TNF-α, cytokine IL-4, cytokine IL-10, and granzyme Granzyme B secreted by Syn-CAR188-T group and CAR21-T group were significantly higher than those of PAN-T group, with statistical differences. Among them, IFN-γ, TNF-α, and Granzyme B have strong anti-tumor functions. The experimental results further showed that Syn-CAR188-T cells have strong anti-tumor functions, and the induced recognition and re-killing mode can play an effective anti-tumor function.

[0133] 7.4. Detection of CD69 on Syn-CAR188-T cell surface

[0134] CD69 is a signal protein for early activation of T cells. By detecting the expression efficiency of CD69 on the surface of T cells, we can compare the activation differences of Syn-CAR188-T cells after incubation with different tumor cells. The experiment was divided into 3 groups: PAN-T group, Syn-CAR188-T group, and CAR21-T group. After the three groups of T cells were co-incubated with RPMI-CD19 and RPMI cells for 12 hours, the results of flow cytometry detection of CD69 expression were as follows Fig. 9 shown. Fig. 9 The results of A, 9B, and 9C are that when the negative control group PAN-T cells were not incubated, the CD69 expression efficiency was 16.3%, 26.4%, and 34.1% when they were co-incubated with RPMI-CD19 and RPMI, respectively. Fig. 9 The results of D, 9E, and 9F show that when the positive control group CAR21-T cells were not incubated, the expression efficiencies were 29.0%, 90.1%, and 79.4%, respectively, when they were co-incubated with RPMI-CD19 and RPMI. Fig. 9The results of G, 9H, and 9I show that when the experimental group Syn-CAR188-T cells were not incubated, the expression efficiency was 29.0%, 83.9%, and 46.0% when they were co-incubated with RPMI-CD19 and RPMI, respectively. The experimental results show that the CD69 expression efficiency of PAN-T cells was low when they were not incubated and incubated with tumor cells (16.3%, 26.4%, and 34.1%), proving that tumor cells have a low effect on PAN-T cell stimulation and low activation efficiency. The positive control group CAR21-T cells had the highest CD69 expression efficiency (90.1%, 79.4%) after incubation with two tumor cells (CD38 antigen positive), proving that CAR21-T cells have the greatest effect and the highest activation efficiency after stimulation with CD38 antigen positive tumor cells. After Syn-CAR188-T cells in the experimental group were co-incubated with CD19-positive tumors (RPMI-CD19), the CD69 expression efficiency (83.9%) was similar to that of the positive control group CAR21-T group (90.1%), 54.9% higher than that without incubation (29.0%), and the CD69 efficiency expression was low (46.0%) after co-incubation with CD19 antigen-negative tumors (RPMI), which was similar to that of the PAN-T group (34.1%), proving that the activation of Syn-CAR188-T cells is regulated by the SynNotch system, and can only be activated by co-incubation with CD19 and CD38 double-positive tumor cells, which is consistent with the theoretical results. In summary, Syn-CAR188-T cells can be activated efficiently after co-incubation with CD19 and CD38 double-positive tumor cells, and the activation efficiency is low after co-incubation with CD19-negative tumor cells, and is similar to the blank group. The results are consistent with the regulation theory of the SynNotch system.

[0135] 7.5. CFSE detection of Syn-CAR188-T cell proliferation ability

[0136] The experiment detected the proliferation ability of T cells by CFSE method, and divided them into 3 groups, PAN-T group, Syn-CAR188-T group, and CAR21-T group. After CFSE staining, the 3 groups of T cells were divided into 2 groups, non-incubated group and co-incubated group with tumor cells. After 48 hours of culture, the CFSE expression efficiency was detected by flow cytometry. After CFSE staining, the cell proliferation efficiency of the 3 groups of T cells was high after 48 hours of culture without incubation, and there was no significant difference among the 3 groups of T cells, which proved that the proliferation of Syn-CAR188-T cells was not affected after transduction of viral vectors; after 48 hours of incubation with RPMI-CD19 cells, the proliferation efficiency of Syn-CAR188-T and CAR21-T cells was higher than that of PAN-T cells, which proved that the cell proliferation rate of Syn-CAR188-T under the stimulation of tumor cells was higher than that of PAN-T cells.

[0137] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. A method for preparing PSR.Syn.CD19.CD38 CAR-T cells, characterized in that: The PSR.Syn.CD19.CD38CAR-T cells refer to the CAR-T cells that will induce the expression of effector molecules anti-CD38-CAR after co-incubation with CD19 antigen-positive tumor cells. The tumor cells will recognize and kill tumors only when they express CD19 and CD38 antigens at the same time. The method comprises: Step 1: Use the PiggyBac transposon system to construct a stable transfection SIN-γ-RV vector, namely the PSR vector; Step 2: Use the PSR vector prepared in step 1 to express the SynNotch system, merge the GAL4 induction vector and the UAS effector vector of the SynNotch system into one PSR vector, so that the SynNotch system is delivered by one PSR vector; construct a plasmid of a PSR.Syn.CD19.CD38 CAR-T retroviral vector, i.e., a PSR.SynNotch vector targeting CD19 and BCMA, with CD19 as an induction target and CD38 as an effector target; Step 3: Transduce the plasmid of the above retroviral vector into T cells to prepare the PSR.Syn.CD19.BCMACAR-T cells.

2. The preparation method according to claim 1, characterized in that: In step 1, the 5'LTR, 5'UTR, and 3'SIN-LTR sequences of the SIN-γ-RV vector are sequentially inserted between the 5'ITR and 3'ITR sequences of the PB transposon of the PiggyBac transposon system; the non-coding region UTR includes a Ψ element for a viral vector packaging signal and a SD for a splicing donor site, and the U3 region is deleted in the 3'SIN-LTR sequence, leaving only the R region and the U5 region.

3. The method according to claim 2, characterized in that The 5'UTR deleted all Gag and Pol coding region sequences and the start codon ATG.

4. The method according to claim 2, characterized in that: When constructing the PSR.Syn.CD19.BCMA plasmid, the effector receptor UAS anti-CD38-CAR, SFFV promoter, SP signal peptide, Myc tag, induced receptor anti-CD19 scfv-Notch-Gal4VP64, and WPRE element were respectively inserted between the 5'LTR and the 3'SIN-LTR, and the induced receptor was expressed by the SFFV promoter.

5. The method according to claim 2, characterized in that: When constructing the plasmid of the PSR.Syn.CD19.CD38 retroviral vector, two molecular tags CopGFPP2A Puro for screening monoclonal cells are inserted between the 3'SIN-LTR and 3'TIR transposon, that is, CopGFP fluorescent protein and puromycin resistance gene are two molecular tags for screening monoclonal cells, connected by P2A.

6. The method according to claim 5, characterized in that The molecular tag is expressed by the composite promoter hEF1α-HTLV.

7. PSR.Syn.CD19.CD38 CAR-T cells constructed according to any one of claims 1-6.

8. Use of the PSR.Syn.CD19.CD38 CAR-T cells according to claim 1 in the preparation of tumor drugs.

9. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition contains the CAR-T cells according to claim 7, and a pharmaceutically acceptable carrier, diluent or excipient.

10. A method for inhibiting tumor cells in vitro, characterized in that: The method comprises contacting a tumor cell with the CAR-T cell of claim 7 or the pharmaceutical composition of claim 9, thereby inhibiting the tumor cell.

Images