A rapid detection method for 20bp indel polymorphism upstream of bovine OR2AD1 gene and application thereof

Abstract

The application discloses a rapid detection method of 20bp indel polymorphism of a bovine OR2AD1 gene upstream and application thereof, and belongs to the field of molecular genetics. The detection method comprises the following steps: according to the feature of 20bp indel insertion existing in the promoter region of the OR2AD1 gene, designing upstream and downstream primers of the site and using P to represent the primers; carrying out jugular vein blood sampling on different breeds of bovine to be detected, extracting genomic DNA, performing PCR amplification on the primers P, and finally detecting the indel polymorphism of the gene through agarose gel electrophoresis; when the 20bp indel insertion exists, the genotype is II; when the 20bp deletion exists, the genotype is DD; and when the site is a hybrid individual, the genotype is ID. Meanwhile, the application also analyzes the genotype distribution and allele frequency of different breeds of bovine, and carries out correlation analysis on the body weight and body size traits of the Xianan bovine population, so as to be used for auxiliary selection and molecular breeding of bovine.

Description

Technical Field

[0001] This invention specifically relates to a rapid detection method for a 20bp indel polymorphism upstream of the bovine OR2AD1 gene, and the application of the detection method, belonging to the field of molecular genetics. Background Technology

[0002] The sense of smell plays a crucial role in many aspects of vertebrate life, such as locating prey or food, mating behavior, predator avoidance, and social interaction. Smell is primarily generated by olfactory receptors (ORs) capturing volatile odor substances, producing nerve impulses, which are transmitted via the olfactory nerve to the cerebral cortex to produce the sensation of smell. OR genes are encoded by a large superfamily of genes, second only to immune system-encoding genes in mammals, accounting for 3%–5% of the total genome. During development, each olfactory neuron "selectively" produces only one type of OR; once an olfactory neuron recognizes a functional receptor, it stops producing other ORs. The coding region of an OR gene is approximately 1 kb long and contains no introns. In cattle, the OR2AD1 gene, located on chromosome 23, contains one exon. Studies have shown that the OR2A2 gene CNV is associated with phenotypes such as residual feed intake and dry matter intake in cattle. This invention detected the distribution of the 20bp upstream indel polymorphism of the OR2AD1 gene in different cattle breeds. By conducting association analysis with the body weight and body size traits of the Xia'nan cattle population, it lays the foundation for screening homozygous high-quality local cattle populations and molecular genetic markers closely related to cattle growth traits. Summary of the Invention

[0003] The purpose of this invention is to provide a rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene and its application.

[0004] 1. To achieve the above objectives, the technical solution adopted by this invention is as follows:

[0005] (1) A primer for detecting the genotype of a bovine economic trait locus, comprising primer pair P:

[0006] Upstream primer PF: 5'- GGCACCAAAAACACATTGCAC -3';

[0007] Downstream primer PR: 5'-TCCTCCGCTTTTTCCTGCTT-3'.

[0008] (2) Using the whole bovine genome DNA containing the OR2AD1 gene as a template, the sequence of the bovine OR2AD1 gene, including the upstream -611~-591, was simultaneously amplified by PCR using primer pair P to obtain the amplification product.

[0009] (3) The amplification products were subjected to agarose gel electrophoresis to detect the nucleotide polymorphism of the 20bp indel upstream of the bovine OR2AD1 gene. Different genotypes of the bovine OR2AD1 gene were identified based on the agarose gel electrophoresis results. When a 20bp indel was inserted, the amplification product was a single band with a band size of 124bp, named genotype II; when a 20bp deletion occurred, the amplification product was a single band with a band size of 104bp, named genotype DD; when the individual at this site was heterozygous, the amplification product was two bands with band sizes of 124bp and 104bp, respectively, named genotype ID.

[0010] (4) A rapid detection method for 20bp indel polymorphism upstream of bovine OR2AD1 gene, characterized in that the 20bp indel site is located between -611 and -591 upstream of bovine OR2AD1 gene, wherein the accession number of bovine gene sequence is NC_037350.1.

[0011] (5) A rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene, characterized in that the amplification reaction system is: 5.00μL of 2×Taq PCR MasterMix, 3.00μL of ddH2O, 0.5μL of PF, 0.5μL of PR, and 1.0μL of DNA template. The PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 53℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ extension for 5 min; storage at 4℃.

[0012] (6) A rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene, characterized in that the mass fraction of agar used in the agarose gel electrophoresis detection is 3.0%.

[0013] (7) A rapid detection method for detecting the 20bp indel polymorphism upstream of the bovine OR2AD1 gene, characterized in that: the voltage of agarose gel electrophoresis in step 5 is 120V and the electrophoresis time is 40min.

[0014] 2. The technical solution adopted in this invention also involves the application of a rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene. This detection method can be used for assisted selection and molecular breeding in cattle. By performing association analysis between genotypes and the body weight and body size traits of Xia'nan cattle, the correspondence between genotypes and traits is determined, which can be used for molecular breeding of cattle.

[0015] (1) The traits mentioned are growth traits, mainly including body weight and body size traits.

[0016] (2) The 20bp indel of the bovine OR2AD1 gene is located at positions 51-70 of the 124bp target fragment of the bovine OR2AD1 gene amplification. The II genotype has the 20bp indel sequence "AAAATTAATACAAGAAAAAA" inserted, while the DD genotype has the above sequence deleted at the corresponding position. The distribution of different genotypes of the 20bp indel upstream of the OR2AD1 gene in the Xia'nan cattle population and other different breeds of cattle is as follows:

[0017] Table 1. Genotype distribution of the 20bp indel of the OR2AD1 gene in different cattle breeds.

[0018]

[0019] (3) The correlation analysis between the 20bp indel polymorphism of the OR2AD1 gene and the body weight and body size traits of the Xia'nan cattle population showed that the polymorphism was significantly associated with some important growth traits of cattle. The deletion of the D allele, i.e., a total of 20bp, was beneficial to the growth of cattle, and the DD genotype was the dominant genotype.

[0020] (4) The present invention uses agarose gel electrophoresis to detect the results of PCR products, which is a method for screening and detecting molecular genetic markers closely related to bovine growth traits at the DNA level. The molecular biology method established by the present invention is simple to operate, low in cost, and short in cycle, which greatly improves the accuracy of genotype determination at this locus. It does not require special instruments and is easy to promote and popularize. Experiments show that this method can effectively determine the genotypes of the two indel polymorphisms upstream of the bovine OR2AD1 gene, and can be used for molecular marker-assisted selection of economic trait loci in cattle, thereby establishing a homozygous high-yielding local cattle population. Attached Figure Description

[0021] Figure 1 Agarose gel electrophoresis image of bovine OR2AD1 gene amplification products;

[0022] Figure 2Sequencing diagrams of bovine OR2AD1 gene insertion and deletion genotypes. The dashed box in the upper image represents the 20bp insertion sequence upstream of the OR2AD1 gene, and the arrows in the lower image indicate the 20bp indel insertion sites. Detailed Implementation

[0023] The following Example 1 is only for further detailed description of the present invention, but does not constitute any limitation on the present invention.

[0024] This embodiment 1 mainly includes the following steps:

[0025] (1) Sample preparation and preservation

[0026] Animal materials: Blood DNA from Xia'nan cattle, Jiaxian Red cattle, Nanyang cattle, Wandong cattle, Yanbian cattle, Xinjiang Brown cattle, Dabieshan cattle, Denan cattle, Simmental cattle, Holstein cattle, and Limousin cattle was provided by the Cattle Breeding Laboratory of the Animal Husbandry Institute of Henan Academy of Agricultural Sciences. All DNA samples were stored at -20℃ for future use.

[0027] (2) Primer design

[0028] Primer pair P was designed using the OR2AD1 gene sequence (GenBank Accession NC_037353.1) as a template.

[0029] Upstream primer PF: 5'- GGCACCAAAAACACATTGCAC -3';

[0030] Downstream primer PR: 5'-TCCTCCGCTTTTTCCTGCTT-3'.

[0031] (3) PCR amplification

[0032] Using primer pair P as primer, a 10.0 μL amplification system was established: 5.00 μL of 2×Taq PCR MasterMix (purchased from Beijing Kangwei Company), 3.00 μL of ddH2O, 0.5 μL of PF, 0.5 μL of PR, and 1.0 μL of DNA template.

[0033] The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 38 cycles; 72℃ extension for 5 min; storage at 4℃.

[0034] (4) Agarose gel electrophoresis

[0035] Weigh 2.5g of agarose and transfer it to an Erlenmeyer flask. Add 100ml of 1×TBE and gently shake to suspend the agarose. Heat in a microwave on medium heat until boiling. Remove from the microwave and cool to 65°C. Add 5ul of DNA nucleic acid dye and mix thoroughly. Quickly pour the agarose solution into the prepared gel, being careful to avoid air bubbles. After 20 minutes, when the agarose gel has completely cooled and solidified, remove the comb and transfer the gel to an electrophoresis tank. Take 8ul of PCR amplification product and load it into the wells of the agarose gel. Electrophoresis at 120V for 40 minutes.

[0036] (5) Imaging with a gel imaging system

[0037] from Figure 1 As can be seen, lane 3 contains the amplification product with a fragment size of 124 bp, consistent with the theoretically designed size, thus proving that the promoter region of the bovine OR2AD1 gene has been successfully amplified. Specifically, lane 1 shows DL2000 (2000, 1500, 1000, 750, 500, 250, and 100 bp); lane 3 shows a single band of 124 bp, named genotype II. Lanes 5 and 6 show a single band of 104 bp, named genotype DD; lanes 2 and 4 show two bands of 124 bp and 104 bp, named genotype ID.

[0038] (6) Sequencing of amplified products

[0039] Sequencing of PCR amplification products from individuals with different genotypes revealed a 20bp indel site in the promoter region of the bovine OR2AD1 gene. (See attached image.) Figure 2 The insertion was performed with genotype II, such as... Figure 2 The above image shows the DD genotype when it is missing. Figure 2 The image below shows the ID genotype at this locus in heterozygous individuals. The top image shows the 20bp insertion sequence within the dashed box, while the bottom image shows the 20bpindel insertion site indicated by the arrow. The sequencing results were identical to the genotypes identified by agarose gel electrophoresis, confirming the effectiveness and accuracy of this detection method.

[0040] (6) Genotypic distribution and allele frequency statistics of the 20bp upstream indel site of the bovine OR2AD1 gene in different bovine breeds

[0041] The genotype and allele frequency distribution of the 20bp upstream indel of the OR2AD1 gene in different cattle breeds are as follows:

[0042] Table 2. Genotype and allele frequency distribution of the OR2AD1 gene 20bp indel in different cattle breeds.

[0043]

[0044] (7) Association analysis of the 20bp upstream indel polymorphism of the bovine OR2AD1 gene with body weight and body size traits in the Xia'nan cattle population

[0045] Of the Xia'nan cattle population, 612 individuals had partially complete records of body weight and body size traits used for association analysis of this polymorphic locus. The measurement methods are as follows: from birth to two years of age, body weight, height, cross-shaped height, body length, chest circumference, abdominal circumference, and cannon bone circumference were measured every six months. In addition, the above indicators were also measured at weaning (4 months of age), for a total of 36 indicators.

[0046] (8) Association analysis model

[0047] The correlation between gene loci and economic traits was analyzed using SPSS (26.00) software. To ensure that each trait data was normally distributed, the data were corrected using least squares analysis. Based on the data characteristics, genotype effects were analyzed using a multiple linear model, and the least significant difference (LSD) method was used to compare differences between genotypes. The results are shown in Table 3.

[0048] Table 3 Association analysis of OR2AD1 gene 20bp indel site polymorphism with growth traits in Xia'nan cattle

[0049]

[0050] Note: Different lowercase letters in the same row indicate significant differences (P<0.05).

[0051] Table 3 shows the association analysis results: the 20bp upstream indel polymorphism of the OR2AD1 gene was significantly associated with body weight, height, body length, and abdominal circumference at 6 months of age in Xia'nan cattle (P<0.05); and was extremely significantly associated with abdominal circumference at 24 months of age (P<0.01). This polymorphism can serve as a genetic marker for the selection of some growth traits in Xia'nan cattle, providing a scientific basis for their breeding.

Claims

1. A rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene, characterized in that, The cattle are Xia'nan cattle, and the main steps include: (1) Based on the gene sequence of the promoter region of the bovine OR2AD1 gene, design a pair of primers P: Upstream primer PF: 5'- GGCACCAAAAACACATTGCAC -3'; Downstream primer PR: 5'-TCCTCCGCTTTTTCCTGCTT-3'; (2) Using the sequence containing the bovine OR2AD1 gene as a template, PCR amplification was performed using the primers designed in step (1); (3) Nucleotide polymorphism of bovine OR2AD1 gene was detected by agarose gel electrophoresis. When a 20bp indel insertion was present in the promoter region, the amplification product was a single band with a band size of 124bp, named II genotype; when a 20bp indel deletion occurred in the promoter region, the amplification product was a single band with a band size of 104bp, named DD genotype; when both a 20bp indel insertion and deletion were present in the promoter region, the amplification product was two bands with band sizes of 124bp and 104bp, respectively, named ID genotype. The 20bp indel site is located upstream of the bovine OR2AD1 gene from -611 to -591, with the bovine gene sequence accession number NC_037350.1 and the 20bp indel sequence being AAAATTAATACAAGAAAAAA; The association between genotype and growth traits in cattle was analyzed, wherein the growth traits are at least one of the following: body weight at 6 months of age, body height at 6 months of age, body length at 6 months of age, abdominal circumference at 12 months of age, and abdominal circumference at 24 months of age.

2. The rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene according to claim 1, characterized in that, The amplification reaction system was as follows: 5.00 μL of 2×Taq PCR MasterMix, 3.00 μL of ddH2O, 0.5 μL of PF, 0.5 μL of PR, and 1.0 μL of DNA template. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 53℃ annealing for 15 s, 72℃ extension for 15 s, 38 cycles; 72℃ extension for 10 min; and storage at 4℃.

3. The rapid detection method for the upstream 20bp indel polymorphism of the bovine OR2AD1 gene according to claim 1, characterized in that, The agar used in the agarose gel electrophoresis assay had a mass fraction of 3.0%.

4. The rapid detection method for detecting the 20bp upstream indel polymorphism of the bovine OR2AD1 gene according to claim 1, characterized in that, In step 3, the voltage for agarose gel electrophoresis is 120V, and the electrophoresis time is 40min.

5. The application of a rapid detection method for the 20bp upstream indel polymorphism of the bovine OR2AD1 gene as described in claim 1 in marker-assisted selection of growth traits in Xia'nan cattle, characterized in that: The growth trait is at least one of the following: 6-month-old body weight, 6-month-old body height, 6-month-old body length, 12-month-old abdominal circumference, and 24-month-old abdominal circumference.

Images